ID: 969495830

View in Genome Browser
Species Human (GRCh38)
Location 4:7525693-7525715
Sequence AAGGGACAAGTGACTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969495830 Original CRISPR AAGGGACAAGTGACTGAGGT GGG (reversed) Intronic
900383777 1:2399830-2399852 GAGGGACCACTGACTGGGGTGGG - Intronic
900790302 1:4675538-4675560 AAGGGGCAGGACACTGAGGTAGG - Intronic
900822155 1:4898070-4898092 AGGGGAGAAGAGAGTGAGGTGGG - Intergenic
901279615 1:8023731-8023753 TAGGGAAAAGTTACTGAGGGGGG - Intronic
903234988 1:21944378-21944400 AAGGAACAAGGGACTGGGGGTGG - Intergenic
903719178 1:25391685-25391707 AACGGACAAGTGAAGAAGGTAGG - Intronic
906453510 1:45973281-45973303 AGGGCATAAGTGATTGAGGTAGG - Intronic
907343025 1:53750686-53750708 AAGGGACAGGTGACAGAGAATGG - Intergenic
907944708 1:59124972-59124994 AAGGGGCTAATGACTGAGATTGG + Intergenic
908428289 1:64030541-64030563 AAGGAATGAGTGACGGAGGTAGG - Intronic
909382775 1:75018880-75018902 TAGGGACAAGTGACAGAGGAAGG - Intergenic
911313530 1:96327438-96327460 AAGGCACAAGTGAATGAAGCAGG - Intergenic
912310644 1:108617664-108617686 AAAGAACCAGAGACTGAGGTGGG + Intronic
912569482 1:110610915-110610937 AAAGGTCAAGTGAGTGAGCTTGG - Intronic
914204489 1:145515462-145515484 AAGGGCCCAGGGACTGATGTTGG + Intergenic
914483613 1:148088650-148088672 AAGGGCCCAGGGACTGATGTTGG + Intergenic
917796534 1:178537001-178537023 CAGAGAGAAGTGACTCAGGTTGG - Intronic
918389360 1:184041738-184041760 AAAAGAGCAGTGACTGAGGTGGG + Intergenic
918873034 1:190001653-190001675 AAGATACAAGTGCCTGAGCTAGG - Intergenic
919122302 1:193356411-193356433 CAGGGATAAGGGCCTGAGGTGGG - Intergenic
920414457 1:205789450-205789472 AAGGGGCGAGTGACTGGGGTAGG + Exonic
920524001 1:206652390-206652412 AAGGGGCCTGTGGCTGAGGTTGG + Intronic
920920800 1:210295805-210295827 AAGGGCCATGTCACTGAGGTTGG + Intergenic
922443706 1:225678417-225678439 CTGGGAGAAGTGACAGAGGTAGG - Intergenic
923998805 1:239527631-239527653 AAAGCACAATTGACTGATGTGGG - Intronic
1063691366 10:8290588-8290610 AAGGCAAAAGTGAGAGAGGTTGG + Intergenic
1065610009 10:27463532-27463554 AAGGGACAAGTTAAAGAAGTTGG + Intergenic
1065811218 10:29445553-29445575 AAGGGACAAGTTAAAGAAGTTGG + Intergenic
1067385810 10:45817175-45817197 AAGGTACAGCTGGCTGAGGTCGG - Exonic
1068713735 10:60163041-60163063 AAGGTTCAAGTGATTGAGTTTGG - Intronic
1069796287 10:71053750-71053772 CGGGGCCAGGTGACTGAGGTTGG - Intergenic
1070618218 10:77985898-77985920 TAGGGACAAGTACATGAGGTAGG - Exonic
1071609861 10:87022374-87022396 AAGGTACAGCTGGCTGAGGTCGG + Exonic
1072264504 10:93714343-93714365 AAGGTAGAGGTGACTGAGTTGGG - Intergenic
1073350469 10:102815980-102816002 CAGGGAGATGTGACTGAGGCTGG + Exonic
1074966525 10:118495566-118495588 ATGGGACAAGTAGCTGAGGGCGG + Intergenic
1076668937 10:132108570-132108592 GAGGGACGAGTTAATGAGGTAGG - Intronic
1080169323 11:29280513-29280535 CAGGGAAAAGGGACTGAGGCTGG + Intergenic
1081715292 11:45245879-45245901 AAGAGAGAAGAGACTGGGGTGGG + Intronic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1084072026 11:66743099-66743121 AAAGGACAAGAGACTGGGGGTGG + Intergenic
1085376826 11:76071333-76071355 AAGGGCAAAGTCCCTGAGGTAGG + Intronic
1085515879 11:77111797-77111819 AAGGGCCATGAGACTGAGATAGG + Intronic
1086332309 11:85766164-85766186 ATGGGGCAAGTGACCAAGGTTGG + Intronic
1090588629 11:128240661-128240683 AAGGAACCAGTGACTCAGTTTGG - Intergenic
1091320337 11:134644992-134645014 AAGGGAGAGGTGACTGGGCTTGG - Intergenic
1091949518 12:4581227-4581249 TAGGGACAAGACACTGAAGTGGG + Intronic
1092111482 12:5967886-5967908 AATGCACAGGTGCCTGAGGTGGG + Intronic
1093407762 12:18825801-18825823 CAGGGACAAGTTACTTATGTGGG + Intergenic
1094475091 12:30834533-30834555 AAGGTACATGTGACTGTGATAGG + Intergenic
1096050136 12:48600275-48600297 AAGGGACTAGTGATAGAGATGGG - Intergenic
1100100756 12:91101561-91101583 AAGGGAAAAGGAACTTAGGTGGG + Intergenic
1100920298 12:99476988-99477010 ATGGGACAAGGAACTGAGGGAGG - Intronic
1101566796 12:105913665-105913687 AAGTGACAAATGAGTTAGGTTGG - Intergenic
1101642908 12:106601362-106601384 CAGGGACAGGAGACTGGGGTGGG + Intronic
1101881869 12:108631078-108631100 AGAGGACATGTGACTGAGGCAGG + Intronic
1103084676 12:118053239-118053261 AGGGGACAAGGGAAGGAGGTTGG - Intronic
1103409845 12:120703141-120703163 AAGGGATAACTGAGGGAGGTAGG - Intergenic
1104078229 12:125409228-125409250 AAGGGAAGAGGGACTGAGATAGG + Intronic
1104948463 12:132427945-132427967 ATGGGGCAAGAGACTGAGGGCGG - Intergenic
1106936783 13:34731232-34731254 AAGGCCCATGTGACTGAGTTTGG - Intergenic
1107201332 13:37722110-37722132 AAGGAACTAGAGACTGAGGAAGG + Intronic
1107268253 13:38583246-38583268 AAGGAACAGGTGACTATGGTAGG + Intergenic
1109194781 13:59366532-59366554 AAGGGACAAATGGCTGGGGGTGG + Intergenic
1110433057 13:75448212-75448234 AACGAACAAGTGAATGAGCTGGG + Intronic
1111459950 13:88526155-88526177 AATGAAAAAGTGACTGAGGCAGG + Intergenic
1113523091 13:110954305-110954327 CAGAGACCAGTGACTGAGGCTGG - Intergenic
1115664168 14:35529509-35529531 ATGGGTCAAGTGGCTGAGGTGGG + Intergenic
1116530346 14:45965104-45965126 AATGGTCAAGTGTCTGAGGCAGG + Intergenic
1117721583 14:58633963-58633985 AAGGGACAAAAGTCTGAGGCTGG + Intronic
1118066518 14:62198082-62198104 AAGGGACAAGTGAGAGAAATTGG - Intergenic
1119769810 14:77213491-77213513 ACTGGAGAAGTGACTCAGGTGGG + Exonic
1120654347 14:87170870-87170892 AAATGACAAGTGACTGAGGTAGG + Intergenic
1122086333 14:99309241-99309263 GAGGGACAAGTGGTTGAGGAAGG - Intergenic
1122418713 14:101562418-101562440 AACGGACAATTGACTGAACTTGG + Exonic
1122965351 14:105121524-105121546 GAGGGACCAGAGACTGAGGTTGG - Intergenic
1123848013 15:24324166-24324188 AACTGAAAAGTGACTGAGGCAGG + Intergenic
1123867059 15:24531531-24531553 AACTGAAAAGTGACTGAGGCAGG + Intergenic
1126859803 15:52872737-52872759 AAGGGTCAAGTGAATGAGGAAGG - Intergenic
1127989991 15:64106967-64106989 TAGGGAGAAATGAGTGAGGTGGG - Intronic
1128271633 15:66315681-66315703 AAGGGACATGGGACTCAGGGAGG - Intronic
1128748934 15:70134728-70134750 AATGGACAAGAGGCTGAGTTAGG - Intergenic
1129630986 15:77260164-77260186 AAGGGACAAATCACTGAGTGAGG + Intronic
1135042914 16:19131701-19131723 AAGGAACAAGTGACCCAGATAGG + Intronic
1135199912 16:20428410-20428432 AAGGGACAAGGCACTGATGATGG + Intronic
1135218791 16:20595200-20595222 AAGGGACAAGGCACTGATGATGG - Intergenic
1135617984 16:23928569-23928591 CACAGACAAGTGACTGAGCTAGG + Intronic
1138431331 16:56971094-56971116 AAGGGACAGGTGAGTGAGGCTGG + Exonic
1139594658 16:67950640-67950662 CCGGGACAAGTGAGTGAGCTGGG - Exonic
1139955854 16:70692655-70692677 AAGGGGCAAGTGGCTGCGGGGGG + Intronic
1140816940 16:78629938-78629960 AAGGGAAAATTAACTGAGTTTGG - Intronic
1141526379 16:84614508-84614530 AAGGGACAGTAGCCTGAGGTGGG + Intronic
1144251051 17:13417051-13417073 AGGGGAAAAGTCACTGAGTTTGG + Intergenic
1146516524 17:33493993-33494015 AAGGGAAAATTGAATCAGGTTGG - Intronic
1146674497 17:34763983-34764005 GATGGACAAGTGACTGAGTGAGG + Intergenic
1147889469 17:43707096-43707118 CAGGGACAAGTGCCTGGGCTGGG + Intergenic
1148358913 17:46995930-46995952 CAGGGACCAGCCACTGAGGTGGG - Intronic
1148953553 17:51335329-51335351 AGGGGCCAAGGGAGTGAGGTGGG + Intergenic
1155216342 18:23646465-23646487 AAGTGACAAATTGCTGAGGTTGG + Intronic
1155821969 18:30389120-30389142 AAGGGACAAGAGACACAGGAAGG + Intergenic
1158680973 18:59566286-59566308 AAGAGACAAGTGACTGACCCAGG - Intronic
1158984506 18:62800562-62800584 AAGGGGAAAGTGAGTGAGGGTGG + Intronic
1159020010 18:63135685-63135707 CAGGGACAATTGACGGAGGAAGG - Intronic
1159358157 18:67363861-67363883 AAGAGACATGTGAGTGAGCTTGG - Intergenic
1159970688 18:74648365-74648387 CAGGGACAATTGGGTGAGGTGGG + Intronic
1160133353 18:76249537-76249559 AAGGGACAAGATACTCACGTTGG + Intergenic
1161704059 19:5809939-5809961 AAGTAACAAGTGTCTGAGCTGGG - Intergenic
1163558896 19:18007699-18007721 AAGGGAGAAGTGGAGGAGGTGGG - Intronic
1163630675 19:18416695-18416717 AAGGGCCAAGGCCCTGAGGTGGG - Intergenic
1163662264 19:18585629-18585651 AAGGGATAGGTGACTGAAATAGG - Intronic
1165920873 19:39297233-39297255 GAGGGACAGGTGACAGAGGCAGG - Intronic
1167650762 19:50727348-50727370 AGGAGATAAGTGGCTGAGGTAGG - Intergenic
1168502423 19:56904630-56904652 AAAGGAAAAGAGGCTGAGGTGGG - Intergenic
925929686 2:8697041-8697063 CAGAGACAAGTGAGAGAGGTAGG + Intergenic
926462182 2:13144612-13144634 ATGGGAAAAGTAACAGAGGTTGG - Intergenic
927846603 2:26475516-26475538 AGGGGACAAGTGACAGAGGGGGG + Intronic
929993500 2:46810261-46810283 AAGGGAGATTTGACTGAGGAAGG + Intergenic
930717662 2:54608018-54608040 AATGGACAAGATACTAAGGTAGG + Intronic
931018707 2:58017251-58017273 ATAGGACAACTGGCTGAGGTGGG - Intronic
931781258 2:65580922-65580944 GAGGGACAGGGGACTGAGGTAGG + Intergenic
931845604 2:66200811-66200833 AAGGTACAGGTGACTGATTTTGG + Intergenic
934963992 2:98703934-98703956 CGATGACAAGTGACTGAGGTGGG - Intronic
938084577 2:128390428-128390450 AATGCACAAGTGACTCAGGGTGG - Intergenic
939521194 2:143232651-143232673 AAGGGACAACTGATAGGGGTTGG - Intronic
940708860 2:157137677-157137699 AAGAGAAAAGTGACTGAGAGGGG - Intergenic
941677083 2:168355338-168355360 AAGGGACTATTCACAGAGGTGGG - Intergenic
943068629 2:183115327-183115349 CAGGAACAAGAGAGTGAGGTGGG + Intergenic
944393858 2:199247549-199247571 AAGGAGAAAGTGATTGAGGTTGG - Intergenic
946156867 2:217812769-217812791 AGGTGAGAAGTGACTGAGCTGGG - Intronic
947527721 2:230889431-230889453 TAGGGACAAGTGACTCAGGAAGG + Intergenic
948388908 2:237598248-237598270 GAGGGAGAGGGGACTGAGGTGGG - Intronic
1169521006 20:6372844-6372866 AAGGGAGAAGTGGCTCAGGGTGG + Intergenic
1170397730 20:15946179-15946201 AAAGGACAAATAACTGAGTTGGG - Intronic
1170508982 20:17057717-17057739 AAGTGACACGTGACTGATGTAGG - Intergenic
1170764268 20:19276354-19276376 AAGGGACATGTGACTGAATTGGG - Intronic
1170974510 20:21149848-21149870 AAAGAGCAAGTGACTTAGGTTGG + Intronic
1171412625 20:24957119-24957141 CAGGGACAGGTGACAGGGGTAGG + Intronic
1172757246 20:37294568-37294590 AAGGGCCAAGTCCCTGAGGCAGG - Intronic
1172803061 20:37591739-37591761 AGGGGACAAGTGTCAGAGTTGGG + Intergenic
1173042220 20:39475191-39475213 AAGGGAAAAGGGAAGGAGGTTGG - Intergenic
1174876569 20:54232681-54232703 ATGGGACAAGGAACTGAGGGAGG + Intergenic
1175502452 20:59460156-59460178 CAGGGAGAAGAGACTGAGGTTGG + Intergenic
1176927513 21:14767984-14768006 AAGGCAAAAGTGAATGAGGGGGG - Intergenic
1178607239 21:34049919-34049941 AAGGGACAAGACACTGGGATGGG + Intergenic
1179311982 21:40204569-40204591 AAGGGACAACTGACTTAGAGAGG + Intronic
1180864320 22:19107199-19107221 AGGGGAGGAGTGACTGAGGGTGG - Intronic
1181079116 22:20401965-20401987 AAGGGAAAGGGGACTGGGGTGGG + Intronic
1181728886 22:24830549-24830571 AAGGGGCTATTGACTAAGGTGGG + Intronic
1181965727 22:26655589-26655611 TATGGACAAGTAACTGAGGAAGG + Intergenic
1183014840 22:34977578-34977600 ACAGTACAAGTCACTGAGGTGGG + Intergenic
1184975120 22:48056152-48056174 AAAGGACCAGTGAGTCAGGTTGG - Intergenic
1185120073 22:48960766-48960788 AAGAGACAGGTGAGTGAGCTCGG - Intergenic
953091608 3:39732525-39732547 AAGCAACAAGTGACTGAGATAGG - Intergenic
953749271 3:45596727-45596749 GAGGGACCAGTGATTGAGGCAGG + Intronic
954896080 3:53976166-53976188 AAGAGACAAGTGGTGGAGGTTGG + Intergenic
955061773 3:55498696-55498718 TAGGGGCATGTGACTCAGGTCGG + Intergenic
956175955 3:66473255-66473277 AAGGGACAAATGACATAAGTGGG + Intronic
956965862 3:74459289-74459311 GAGGAAGAAGTGACAGAGGTTGG - Intronic
959079040 3:101780367-101780389 AAGGGATAAATCACTGAAGTGGG + Intronic
959886790 3:111511908-111511930 AGGGGACAAGAGAGAGAGGTGGG - Intronic
960616279 3:119598949-119598971 TAGGGACAACTAATTGAGGTAGG - Intronic
960634078 3:119766538-119766560 AAATGACAAGTGAGTTAGGTTGG + Exonic
962486073 3:135843693-135843715 AAAAGAAAAGTGACTGGGGTGGG + Intergenic
965003323 3:162986211-162986233 AAGGGACAGGTTTCTGAGGCTGG + Intergenic
969495826 4:7525674-7525696 TGGGGACAGGTGACTGAGTTGGG - Intronic
969495830 4:7525693-7525715 AAGGGACAAGTGACTGAGGTGGG - Intronic
969495869 4:7525862-7525884 AGGGGACAGGTGACTGAGGAGGG - Intronic
969495874 4:7525881-7525903 AGGAGACAGGTGACTGAGGAGGG - Intronic
969495887 4:7525937-7525959 AGGGGACAGGTGACTGAGGAGGG - Intronic
969495892 4:7525956-7525978 AGGGGACAGGTGACTGAGAAGGG - Intronic
969495905 4:7526009-7526031 AGGGGACAGGTGACTGAGGAGGG - Intronic
971616795 4:28800820-28800842 AAAGGAGAAGTGACTGACGTGGG - Intergenic
972782893 4:42301356-42301378 ATGGGACAAGTTACAGGGGTAGG + Intergenic
973958602 4:56087743-56087765 TAGGGAGAAGGGACTGAGGTCGG - Intergenic
974010622 4:56603700-56603722 ACTGGAGAAGGGACTGAGGTAGG - Intergenic
975682960 4:76895462-76895484 AAGAGTATAGTGACTGAGGTGGG - Exonic
981460348 4:145006840-145006862 AAGGGAGAAGTGAGAGAGGTGGG - Intronic
982380878 4:154745538-154745560 AAAGGGCAAGTGACTGGGGGTGG + Intronic
983054843 4:163089702-163089724 AAGGGACAAATGATTGTGGTGGG + Intergenic
983434954 4:167701425-167701447 AGGGGATAAATGACTGAGGTTGG - Intergenic
984150189 4:176120361-176120383 AAGGGAAAAATGACTGATTTAGG - Intronic
984908752 4:184652502-184652524 AAAGGCAAAGTGACTGAAGTGGG + Intronic
986822618 5:11483922-11483944 GATAGACAAGTGACTCAGGTGGG + Intronic
987478804 5:18427703-18427725 AGTGGACAATTGACAGAGGTTGG + Intergenic
990516462 5:56535143-56535165 AACAGACAAGTGGCTGAGCTGGG + Exonic
990526967 5:56637612-56637634 AAGAGATAAATGACTGACGTGGG + Intergenic
991482812 5:67101339-67101361 AGGGACCCAGTGACTGAGGTAGG - Intronic
994151942 5:96457579-96457601 AAGGGCGAAGGCACTGAGGTAGG - Intergenic
995569233 5:113461834-113461856 AAGGGACTATTCACTGAGGGAGG + Intronic
995583469 5:113623586-113623608 AAGGGACAAGTACCTGGGTTGGG + Intergenic
995782429 5:115792629-115792651 AAGGGACATGTGAGTGAGAAGGG - Intergenic
996648648 5:125846294-125846316 CAGGGACTGGAGACTGAGGTGGG + Intergenic
996939287 5:128984488-128984510 AAGGGACAAGTTTCTTAGGAAGG - Intronic
997202106 5:132017028-132017050 AAGAGAAAAGTGATTGGGGTGGG - Intergenic
998884054 5:146675806-146675828 GAGAGAGAAGTGACTGAGGTTGG - Intronic
998926663 5:147134270-147134292 CAGGGACCTGAGACTGAGGTAGG + Intergenic
1000856197 5:166401307-166401329 AAGGGAAAAATGCCAGAGGTGGG - Intergenic
1001283222 5:170403112-170403134 AAGGGACAAATGAGAGAGGGAGG - Intronic
1001668875 5:173457263-173457285 AAGTGACAAATGACAGAGGTAGG - Intergenic
1005204340 6:23383548-23383570 AAAAAACAAGTGACTGTGGTAGG - Intergenic
1005839010 6:29728279-29728301 AAGGGAGAGATGACTGGGGTGGG - Intronic
1006687923 6:35853157-35853179 AAGGGGCAGGGCACTGAGGTGGG + Intronic
1008338638 6:50337068-50337090 AAAGGAAATGTGACTGGGGTGGG + Intergenic
1010466547 6:76173593-76173615 AAGTGAGAAGTGGCTGAGGGTGG + Intergenic
1011356825 6:86479914-86479936 AAGGCCCAATTGACTTAGGTGGG - Intergenic
1013039561 6:106420122-106420144 AACTGAAAAGTGACTGAGGCAGG + Intergenic
1013461264 6:110377467-110377489 ACTGGCCAAGGGACTGAGGTGGG + Intergenic
1014837428 6:126175293-126175315 AAGGGCCAAGTGTGTCAGGTTGG - Intergenic
1015628371 6:135205253-135205275 AAGAGCCAAGTAACTTAGGTGGG - Intronic
1017296252 6:152798140-152798162 AAGGGAAATGGGAGTGAGGTTGG + Intergenic
1017790154 6:157790730-157790752 CAAGGACAATTGGCTGAGGTGGG - Intronic
1019217786 6:170454759-170454781 AAGAGAAAAGAGGCTGAGGTGGG - Intergenic
1019315528 7:382551-382573 AAGGGAGAAGTGAGGGAGGGAGG + Intergenic
1020002972 7:4766048-4766070 AAGACACAAGTGGCTGAGGATGG - Exonic
1021514695 7:21471464-21471486 AATGGAAAAGTGACAGAGCTGGG - Intronic
1022531223 7:31068109-31068131 AAGGGAGCAGTGAGTAAGGTGGG + Intronic
1023560977 7:41472974-41472996 AAGGGAGGAGAGAATGAGGTAGG + Intergenic
1024242979 7:47449560-47449582 AAGGAACATATGACTCAGGTCGG - Intronic
1029249559 7:99226099-99226121 AAGAGACAATTTACTGAGGTGGG - Intergenic
1029535823 7:101156987-101157009 AAGGGACACGTGAGTGAGGCAGG - Intronic
1031116147 7:117670866-117670888 AAGGAAAAAGTGACTGAGGCAGG - Intronic
1032282500 7:130515745-130515767 AAGGGATAAATGAATGAGGCTGG + Intronic
1034113808 7:148564148-148564170 CAGGTACAAGGAACTGAGGTAGG - Intergenic
1034735330 7:153424021-153424043 AGGGGAGAAGAGAATGAGGTAGG + Intergenic
1034969846 7:155412152-155412174 AAGGGACAAGTGACGCAGTCAGG - Intergenic
1035757110 8:2042901-2042923 AAGGGACAAAAGACGGAGGGAGG - Intergenic
1037583419 8:20260440-20260462 CAGTGACCAGTGACAGAGGTGGG + Intronic
1037768443 8:21785691-21785713 AAGGGGAAAGTGACTCGGGTGGG - Intronic
1038635851 8:29286646-29286668 AAGGCTCCAGTGGCTGAGGTTGG + Intergenic
1041682525 8:60607574-60607596 AAAAGACAACTGACTTAGGTAGG - Intronic
1041964270 8:63656841-63656863 CAGAGTCAAGTGCCTGAGGTGGG - Intergenic
1042883295 8:73518897-73518919 AAGGGACAAGTTTCGGAGGGAGG + Intronic
1043148558 8:76683681-76683703 AAGAGACAAGAGACAGAGGAGGG + Intronic
1044942001 8:97353008-97353030 ATGTGACAAGGGACTGAGGATGG - Intergenic
1045902619 8:107302263-107302285 AAGAGACAAGTAATTTAGGTGGG + Intronic
1047017827 8:120742370-120742392 AAGGGATAAGTTACTGAGGCAGG + Intronic
1049186158 8:141255037-141255059 AAGGGAAAAGTGGGGGAGGTAGG + Intronic
1049443376 8:142619198-142619220 GAGGCACAAAGGACTGAGGTGGG + Intergenic
1051322581 9:15924206-15924228 AAGGGACAAGGGAGTTAGGAAGG + Intronic
1055253216 9:74333718-74333740 AAGAGACAAGTAACTGACTTCGG + Intergenic
1055917949 9:81426039-81426061 AAGGTACAAGTCCCAGAGGTAGG - Intergenic
1056865892 9:90227116-90227138 GAAGGACAAGTGACGGAGGGAGG + Intergenic
1057858824 9:98623979-98624001 ATGGGGCAAGTGGCTGAGCTGGG + Intronic
1058769930 9:108220833-108220855 AAGGGAAAAGAGATTGAGATGGG - Intergenic
1060623210 9:125086382-125086404 TAAGGAAAAGTGACTGAGGCAGG + Intronic
1061685797 9:132276663-132276685 AAGGAAGTAGTGACAGAGGTTGG - Intronic
1186319301 X:8406972-8406994 CAGGGAAATGTGAATGAGGTTGG + Intergenic
1189172298 X:38920991-38921013 GAGGGACTATTGACTGAGATGGG + Intergenic
1189184107 X:39037037-39037059 AAGGCAGATGTGACTGAGCTTGG + Intergenic
1195042803 X:101029766-101029788 AAGTGACAAGTGACTTAGCAAGG + Intronic
1195726081 X:107918113-107918135 AAGGGAAGAGTGACAGAGGCAGG - Intronic
1196888784 X:120272355-120272377 AAGGTCCCATTGACTGAGGTTGG + Intronic
1198992454 X:142530514-142530536 AAGGAAGAAGTGTTTGAGGTGGG - Intergenic
1202328232 Y:23716269-23716291 AATTGACAAGAGACTGAGGTGGG - Intergenic
1202542538 Y:25953783-25953805 AATTGACAAGAGACTGAGGTGGG + Intergenic