ID: 969496458

View in Genome Browser
Species Human (GRCh38)
Location 4:7529196-7529218
Sequence ATGTTTGCACAGAGTCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969496458_969496465 24 Left 969496458 4:7529196-7529218 CCTTCCAGACTCTGTGCAAACAT 0: 1
1: 0
2: 1
3: 24
4: 213
Right 969496465 4:7529243-7529265 CCACTCTGTCTGCAACCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 222
969496458_969496462 -7 Left 969496458 4:7529196-7529218 CCTTCCAGACTCTGTGCAAACAT 0: 1
1: 0
2: 1
3: 24
4: 213
Right 969496462 4:7529212-7529234 CAAACATCACCTTGTCTAAGGGG 0: 1
1: 0
2: 4
3: 23
4: 266
969496458_969496461 -8 Left 969496458 4:7529196-7529218 CCTTCCAGACTCTGTGCAAACAT 0: 1
1: 0
2: 1
3: 24
4: 213
Right 969496461 4:7529211-7529233 GCAAACATCACCTTGTCTAAGGG 0: 1
1: 0
2: 2
3: 13
4: 129
969496458_969496460 -9 Left 969496458 4:7529196-7529218 CCTTCCAGACTCTGTGCAAACAT 0: 1
1: 0
2: 1
3: 24
4: 213
Right 969496460 4:7529210-7529232 TGCAAACATCACCTTGTCTAAGG 0: 1
1: 0
2: 2
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969496458 Original CRISPR ATGTTTGCACAGAGTCTGGA AGG (reversed) Intronic
902138160 1:14328773-14328795 ATGTGTACATAGAATCTGGAGGG - Intergenic
902735405 1:18397509-18397531 ATATTTGCACACACTCTGGGTGG + Intergenic
903288408 1:22291601-22291623 ATGTTTGGACTGAGTCTTGATGG + Intergenic
903642106 1:24867312-24867334 ATGTCTGCACAGAGGCTGAGCGG + Intergenic
904055267 1:27665829-27665851 ATGTCTGAACTGAGTCTGGAAGG + Intergenic
913107475 1:115627932-115627954 ATTTTTGCAAAGAGTTTGAATGG - Intergenic
913658666 1:120986675-120986697 ATATTTTCACAGAGTCTTTATGG + Intergenic
914010031 1:143769800-143769822 ATATTTTCACAGAGTCTTTATGG + Intergenic
914648649 1:149678458-149678480 ATATTTTCACAGAGTCTTTATGG + Intergenic
916192663 1:162194330-162194352 TTGTTTGCAGAGAGCCTGGTTGG + Intronic
916744438 1:167673873-167673895 ATGTTTACGCAGAGTCTTGAAGG - Intronic
918246161 1:182661315-182661337 CTGTTTGCACAGGGCATGGAGGG - Intronic
919367358 1:196679749-196679771 CTGTATGCACTGAATCTGGATGG + Exonic
919691357 1:200531266-200531288 ATGTTTTCACAGCCTCTGGTGGG + Intergenic
921885162 1:220298066-220298088 ATGTCTACACTGACTCTGGAAGG + Intergenic
923592272 1:235329012-235329034 GTGCTAGCACAGAGTCCGGAGGG - Intronic
924209637 1:241751341-241751363 CTGTTTGCCCAGAAACTGGAAGG + Intronic
924348900 1:243096192-243096214 ATGGATGCACAGTGCCTGGATGG + Intergenic
1066932990 10:41789907-41789929 CTGTTTTCACAGAATCTGTAAGG + Intergenic
1067967508 10:50929233-50929255 ATGTTTGAGCAGAGACTTGAGGG - Intergenic
1068501698 10:57846967-57846989 ATGTTTTCACTGGGTCTTGAAGG - Intergenic
1071396284 10:85227244-85227266 AGGTTTTCTCAGGGTCTGGATGG + Intergenic
1071587707 10:86841513-86841535 ATATTTGAGCAGAGTCTTGATGG + Intronic
1071735075 10:88289458-88289480 ATGTTTATACTGAGTCTTGAAGG - Intronic
1073676332 10:105650884-105650906 ATGTTTGCAGAGAGTTAGAATGG + Intergenic
1074180587 10:111059506-111059528 ATATCTGCCCAGAGTCAGGAGGG + Intergenic
1074699932 10:116083897-116083919 ATGTTTGCAGAGTGGCAGGAGGG - Intronic
1074779210 10:116788578-116788600 ATGTGTTGATAGAGTCTGGAAGG - Intergenic
1075306065 10:121368322-121368344 ATGTTTACATAGAGACTTGAAGG - Intergenic
1075571740 10:123551371-123551393 ATGTTTGAGCAGAGACCGGAAGG + Intergenic
1075716083 10:124556222-124556244 ATTTGTGCACACAGTTTGGAAGG - Intronic
1075772386 10:124950672-124950694 ATATTTCCACAGTTTCTGGATGG + Intronic
1080162747 11:29197941-29197963 ATGTTTGCATGAAATCTGGAAGG + Intergenic
1080301051 11:30785386-30785408 ATGCATGCACAGAGTCTTCAAGG - Intergenic
1083399626 11:62414773-62414795 AGGTTTGCTCTGATTCTGGAAGG - Intronic
1086386434 11:86313737-86313759 ATGTTTGTACAAAGTGTGGAGGG + Intronic
1090063497 11:123484046-123484068 AGCTTTGCACAGAGAGTGGAGGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091148905 11:133307571-133307593 ATGTTTGACCTGAGTCAGGAAGG - Intronic
1091150792 11:133326606-133326628 ATGTGTGTACAGAGTGTGGGTGG + Intronic
1092213255 12:6662196-6662218 ATGTTTGAATAGGGTCTTGAAGG - Intronic
1092287361 12:7136431-7136453 AAGTTTGGACAGAGGTTGGATGG - Intronic
1092596214 12:10007740-10007762 ATGTATGCACAGAGTAGGTAGGG + Intronic
1092847075 12:12593725-12593747 CTGTTTGTACAGAGTCATGATGG - Intergenic
1093458080 12:19384085-19384107 AGGTATGCACAGAGTATAGAAGG + Intergenic
1093692042 12:22119867-22119889 AGGTTTGCAGAAAGTGTGGAAGG - Intronic
1094227069 12:28057617-28057639 ATGTTTTCATAGTGTTTGGAAGG + Intergenic
1094406914 12:30126048-30126070 ATGTTGACACAAAATCTGGAAGG + Intergenic
1101514697 12:105423986-105424008 ATGTGTGGACGGAGTCTGGCTGG - Intergenic
1102992254 12:117323342-117323364 ATATTTTCTCAGAGTCTGAAAGG - Intronic
1103646248 12:122395431-122395453 ATGTTTGCCCAGCTTCTGGCAGG - Intronic
1104609647 12:130217703-130217725 AATTCTGCACAGAGACTGGAAGG + Intergenic
1105729707 13:23200763-23200785 ATCTTTGCACAGAGAGTTGAGGG + Intronic
1108498840 13:51050293-51050315 ATGTTTTCACAGAGACTTGTGGG - Intergenic
1108648691 13:52454939-52454961 ACGTTTGCACAGCGTGTGAAGGG - Intergenic
1109551108 13:63901836-63901858 CTGTTTGCCCACAGTTTGGAAGG + Intergenic
1110787625 13:79549794-79549816 ATCTTTGAACAGCATCTGGAAGG + Intronic
1110999398 13:82159436-82159458 ATGTTTGCCCAGAGTGGGCAGGG - Intergenic
1125686567 15:41567101-41567123 ATATTTGCACTGAGTCTTAAAGG + Intronic
1125987892 15:44073271-44073293 TTGTGTGCAGAGTGTCTGGAAGG - Intronic
1127680891 15:61296866-61296888 AACTCTGCAGAGAGTCTGGAGGG + Intergenic
1129762467 15:78138122-78138144 ATCTTTTCAGAGAGTCTGCAAGG + Intronic
1130123093 15:81069224-81069246 ACATTTGCGCAGAGACTGGAAGG + Intronic
1134092206 16:11397658-11397680 TTGTTGGAACAGAGACTGGATGG + Intronic
1134096717 16:11423388-11423410 AGGTTTGCACAGGGACTTGAGGG + Intronic
1135798401 16:25468711-25468733 ATGTTTGCACACAGCCTGATAGG + Intergenic
1137334380 16:47533527-47533549 ATCAATGCCCAGAGTCTGGAGGG + Intronic
1137400436 16:48148826-48148848 ATGTTTGAACTGAGCCTTGAAGG - Intronic
1138214971 16:55196296-55196318 GTGGTTGCACAGAGCTTGGAGGG + Intergenic
1139182847 16:64768154-64768176 GTGTTTGCAAAGATTCTGGGAGG + Intergenic
1140214968 16:72999992-73000014 AGGTGTGCACAGAGTTTTGAAGG + Intronic
1140292398 16:73672523-73672545 ATGTTGGCTCTGAGTTTGGAAGG - Intergenic
1140729908 16:77846513-77846535 ATGTTTGCATAGAGACTGGCTGG - Intronic
1140955956 16:79865594-79865616 AGGTTTTCACTGAGTTTGGAAGG - Intergenic
1141395050 16:83697036-83697058 ATGTTTGCACAGTTCCTGAATGG - Intronic
1143619780 17:8074161-8074183 GAGTGGGCACAGAGTCTGGAAGG - Intronic
1145320305 17:21763310-21763332 AAATTTGAACAGAGACTGGATGG + Intergenic
1146464972 17:33079308-33079330 ATGTTTGCACTGAATCTTGGAGG + Intronic
1147228859 17:39002584-39002606 ATGTTTGGGCTGAGCCTGGAAGG - Intergenic
1148515074 17:48209346-48209368 TTGTATTTACAGAGTCTGGAAGG + Intronic
1149413978 17:56439007-56439029 ATGGTTGCACAAAGTAAGGAAGG + Intronic
1151653242 17:75483049-75483071 ATGTTTGAGCTGAGTCTTGAAGG + Intronic
1152451259 17:80381924-80381946 CTGCTTGCCCAGAGGCTGGAAGG + Intronic
1152707783 17:81853946-81853968 TTGTTTGCACAGTGTCAAGATGG - Intronic
1153473028 18:5468138-5468160 TTGTTGGCACAAAGTCTGGAGGG - Intronic
1153493662 18:5675602-5675624 ATGTGTGCACAGAATCTCGGAGG - Intergenic
1154163154 18:11994930-11994952 ATGTTTGAACTGAGTCATGAAGG + Intronic
1155357059 18:24963081-24963103 TTGTGTGCCCAGAGCCTGGAAGG + Intergenic
1155535124 18:26809075-26809097 ATGTATGCACAGAGGCTGAAGGG + Intergenic
1156924473 18:42559038-42559060 ATTTTTGGAAAGAGTCTGTAAGG - Intergenic
1159842078 18:73410954-73410976 AAGTTTGCACAAATTCTTGATGG - Intergenic
1160233504 18:77067249-77067271 ATGATTGTGCAAAGTCTGGAAGG - Intronic
1160296784 18:77645718-77645740 ATGTGTGAACACAGTTTGGAAGG + Intergenic
1160993658 19:1872007-1872029 TTATCTGCACAGAGTCGGGAGGG + Intergenic
1161066817 19:2242722-2242744 AGATTTGCACAGAGCCTGAAAGG + Intronic
1161225485 19:3143010-3143032 ATGTTTTTACAGAGTCTGGGAGG - Intronic
1161431321 19:4233848-4233870 ATGTATGCACAGAGACCCGAAGG - Intronic
1161979078 19:7621158-7621180 CTGTTTGAACAGGCTCTGGACGG - Exonic
1165022567 19:32936290-32936312 ATGGGTGCCCAAAGTCTGGAGGG - Intronic
1165052019 19:33147882-33147904 TTGCTTGCAAAAAGTCTGGAGGG + Intronic
1165638449 19:37363699-37363721 ATATTTGCAGAAAGTGTGGACGG + Exonic
924991901 2:319618-319640 ATGCTTGCAGGGAGGCTGGAGGG + Intergenic
925651288 2:6092178-6092200 CTATTTGCCCAGAGTCAGGATGG - Intergenic
926644814 2:15278292-15278314 ATGTTTGCACTGTGTCTTAATGG - Intronic
927676847 2:25112409-25112431 AGTTTTGCAAAGAGTCTTGAAGG + Intronic
927849302 2:26488952-26488974 AACTCTGCACAGAGCCTGGAAGG - Intronic
928243118 2:29603719-29603741 ATGTTTCCAGAGAGACTGAATGG - Intronic
930020358 2:46998141-46998163 CTGTTTGCACTGAGGCTGGGAGG + Intronic
930114383 2:47706415-47706437 CTGATTGCACAGAGCATGGATGG - Intronic
930310434 2:49732837-49732859 ATTTTAGCAAAGAGTCTGGTGGG - Intergenic
933213118 2:79594332-79594354 AGGCTTGAACACAGTCTGGATGG - Intronic
934557558 2:95295480-95295502 AGGCTTGCTCAGAGTCAGGAGGG + Intergenic
934618530 2:95790103-95790125 ATGTTTGAGCAGAGCCGGGAAGG + Intergenic
934642363 2:96034456-96034478 ATGTTTGAGCAGAGCCGGGAAGG - Intronic
935430932 2:102974775-102974797 GTCATTGCAAAGAGTCTGGATGG + Intergenic
936869768 2:117121991-117122013 ACGTTTGCACAGAGTAAAGAAGG + Intergenic
937798052 2:126049024-126049046 ATATTTGGACAGTGTCAGGATGG - Intergenic
939423100 2:141999094-141999116 ATGTTAGCCTAGAGTCAGGATGG + Intronic
941351430 2:164442075-164442097 ACGTGTGCAAAGAGTTTGGAAGG - Intergenic
942272139 2:174287076-174287098 ATGTTTGCTCAGACTCATGATGG - Intergenic
942963320 2:181859333-181859355 CTGTTTGCACGGTGTCTGGATGG - Intergenic
944273451 2:197807951-197807973 ATGTTTTCACAAATTATGGAGGG - Intronic
944373947 2:199018065-199018087 GTGGATGCACAGATTCTGGATGG + Intergenic
944502006 2:200371501-200371523 ATGTTTGAGCAAGGTCTGGATGG + Intronic
945440092 2:209868006-209868028 AGGTTAGCACATGGTCTGGAAGG - Intronic
945689234 2:213011624-213011646 ATGTTTGCAGAGAGTACAGAAGG + Intronic
946326146 2:218985538-218985560 CTGTTTGCAGAGAGTCAGGGAGG - Exonic
947031349 2:225799597-225799619 ATGTTTGCTGAGAGTCTGCGGGG - Intergenic
947159693 2:227199947-227199969 ATGTTTACTCACAGTCTAGAAGG + Intronic
947723542 2:232382927-232382949 CTGTGGGCACAGTGTCTGGAGGG + Intergenic
948734678 2:239994106-239994128 ATGTCAACACAGCGTCTGGAAGG - Intronic
1173351561 20:42250241-42250263 ATGTTAGCACAGATTCTGACTGG + Intronic
1173780191 20:45749514-45749536 GTATTTGCACAGACTCTGGCGGG + Intronic
1174378313 20:50140610-50140632 ACGTTTGCACAGAGACCTGAAGG - Intronic
1175278232 20:57786406-57786428 TTGTCTGCTCAGGGTCTGGAAGG + Intergenic
1176256356 20:64155077-64155099 ATCTTGGGACAGAGACTGGAGGG + Intronic
1181415666 22:22756938-22756960 TTTTTTGCACAGAATGTGGAGGG - Intronic
1184920152 22:47600459-47600481 ATGTGTTCACAGAGGCTGGGGGG - Intergenic
1184920268 22:47600820-47600842 GGGTTTGCACAGAGGCTGGGAGG - Intergenic
949870043 3:8580641-8580663 TTGTTTGGACAGAGTGTGGGTGG - Intergenic
950110817 3:10417450-10417472 ATGTTTACACAGAAGCTGGACGG + Intronic
950453681 3:13079962-13079984 ATGTTGAAACAGAGTCTTGAAGG + Intergenic
950674321 3:14545411-14545433 ATGTGAACACAGAGTCAGGAGGG + Intergenic
952051970 3:29394935-29394957 ACTTTTGAACAAAGTCTGGAAGG - Intronic
953771665 3:45782279-45782301 ATGTTTGCACAGAGGTTGAGTGG - Intronic
954652110 3:52171450-52171472 ATGTTTGAACAAAGTCCTGATGG - Intergenic
955744853 3:62130142-62130164 ATGGTTCCACTGAGGCTGGATGG + Intronic
955984067 3:64555107-64555129 ATTGTTGCACAGTGTATGGACGG + Intronic
957154535 3:76530713-76530735 ATGTGTGCACAAACTTTGGAAGG + Intronic
957242495 3:77676579-77676601 TTGTTTGCAGACATTCTGGAGGG - Intergenic
959536856 3:107496577-107496599 ATATTTTCAAAGAGTCTTGAGGG - Intergenic
959880370 3:111438496-111438518 AGGCTTGCACAGAGGCTGGGAGG + Intronic
960451121 3:117809334-117809356 AGGTTTACACAGTGTCTGTATGG + Intergenic
961992198 3:131204156-131204178 GAGTTTGCCCAGATTCTGGATGG + Intronic
962293687 3:134160527-134160549 TTGTTTGCATAGATTCTGGGGGG - Intronic
963920865 3:150903406-150903428 ATATTTGCACAGAATCATGAAGG - Exonic
965437771 3:168673640-168673662 ATGTTTGCAGATACTCTGAATGG + Intergenic
969496458 4:7529196-7529218 ATGTTTGCACAGAGTCTGGAAGG - Intronic
970742320 4:19252322-19252344 CTGTTGGCACAGAGTCAGGAGGG - Intergenic
971407098 4:26331834-26331856 CTGTTTCCACAGCCTCTGGAAGG + Intronic
972158156 4:36190725-36190747 ATGTTTGCACAGAATGTTGATGG + Intronic
972741349 4:41889697-41889719 ATGTGTGCAAAGAGACTGCATGG - Intergenic
972830899 4:42812463-42812485 ATGGTTGCACAAAGTCCGGTTGG - Intergenic
973867966 4:55133247-55133269 ATATTTGCACTGGGTATGGAAGG - Intergenic
974505370 4:62763049-62763071 ATGTATACACAGAGTCTGCAAGG + Intergenic
976268873 4:83210716-83210738 ATGTTTGCAAGAATTCTGGAGGG + Intergenic
976782280 4:88774153-88774175 ATGCTTGCACAGAGGCCTGAAGG - Intronic
977197175 4:94077626-94077648 AAGATAGCACAAAGTCTGGAAGG - Intergenic
981050874 4:140308358-140308380 ATGCTTTCACAGAGCCTGGGAGG + Intronic
985930792 5:3056112-3056134 ATTTTCCAACAGAGTCTGGAAGG - Intergenic
986202232 5:5589142-5589164 CTGTTTGCACATAGTTTGCAGGG - Intergenic
990878709 5:60517195-60517217 CTTGGTGCACAGAGTCTGGAGGG - Intronic
992564644 5:77985540-77985562 GTGTTTGCTCAGAGCCTGCATGG - Intergenic
993677922 5:90839676-90839698 ATATTTGAACAGAGACTGCAAGG - Intronic
997029468 5:130108391-130108413 TACTTTGCACAGACTCTGGATGG - Intronic
998146909 5:139734199-139734221 GGGTTTGCACAGAGGCTGGAGGG + Intergenic
999810241 5:155120594-155120616 ATGTTTACACAGAGGTTGGATGG + Intergenic
999878179 5:155831762-155831784 TTGCTTCCACAGAGTCTGTAGGG + Intergenic
999962176 5:156767620-156767642 ATTTTTGCATAGAGTGTGCAAGG - Intronic
1000428410 5:161120072-161120094 TTTTTTGCACAGCCTCTGGAGGG - Intergenic
1007078854 6:39084855-39084877 TTGTTTGCACAGGGGCTGGTGGG + Intronic
1008636206 6:53413388-53413410 ATGCTTGGACAGGGTTTGGACGG + Intergenic
1009032779 6:58080833-58080855 CAGTCTGCACAGAGCCTGGAGGG + Intergenic
1011775786 6:90729074-90729096 ATATTTACACAAAGTCAGGATGG + Intergenic
1013488346 6:110619463-110619485 TTGTCTGCAAAGAGGCTGGAGGG + Intronic
1013805865 6:113995157-113995179 ATGTCTGCACAGAGCCTTGAAGG - Intronic
1016013386 6:139161091-139161113 ATGTTTGAACCGAGCCTTGAAGG + Intronic
1018073727 6:160190996-160191018 ATGCTGGCATGGAGTCTGGAAGG + Intronic
1018689617 6:166334145-166334167 ATGAGTGTACAGAGGCTGGAAGG - Intronic
1020812202 7:12862222-12862244 ATGTTTGCTCAGAGTATGCAGGG - Intergenic
1024284118 7:47742407-47742429 ACATTTGCAGAGAGACTGGAAGG - Intronic
1026505343 7:70977850-70977872 ATTTTTAGACAGAGCCTGGAAGG - Intergenic
1026771579 7:73204451-73204473 GTGTTTGTACAGAGTCTAGAGGG + Intergenic
1027012445 7:74757847-74757869 GTGTTTGTACAGAGTCTAGAGGG + Intronic
1027047728 7:75002250-75002272 ATGTTTGAACTGAGTCTTAAAGG + Intronic
1027075595 7:75188206-75188228 GTGTTTGTACAGAGTCTAGAGGG - Intergenic
1031369725 7:120950488-120950510 ATTTTTGCACAGAGAATGGCGGG - Intergenic
1031936600 7:127741618-127741640 ATGTTAGCAAAGAGTGAGGAAGG - Intronic
1032103593 7:129004911-129004933 ATTTTTGCACAGTAACTGGAAGG - Intronic
1032447942 7:132000784-132000806 AGGTTTGCACAAAGTGTTGAAGG + Intergenic
1034258173 7:149735833-149735855 GTGCTTGCACAGAATCAGGAAGG + Intergenic
1035487378 7:159236684-159236706 GTCTCTGCACTGAGTCTGGAAGG - Intergenic
1036455518 8:8903336-8903358 ATGTTAGGACAGAGTCAGGTTGG - Intergenic
1036597876 8:10230386-10230408 AAGTATGCACACAGTCAGGAGGG + Intronic
1037683431 8:21117646-21117668 ATGTTTGAACTGAGCCTGGAAGG - Intergenic
1038048995 8:23791460-23791482 ATGTTTCCACATCCTCTGGAGGG + Intergenic
1038218711 8:25587179-25587201 ATATTTGCACACAGCCTGGCAGG - Intergenic
1039561406 8:38515109-38515131 ATGTTTGAACAGGGTCTTGAAGG - Intronic
1040062727 8:43117834-43117856 ATGCTAGCACAGACTTTGGAGGG + Intronic
1041835661 8:62210428-62210450 ATTTTTCCACAGAGTGGGGATGG - Intergenic
1043090522 8:75896378-75896400 ATGTTTTCATACAGTCTGAAAGG + Intergenic
1043219071 8:77635985-77636007 ATCTTTGCACAGTGGTTGGATGG + Intergenic
1043613462 8:82094242-82094264 ATGTCTGCACTGAGACTAGAAGG - Intergenic
1044226696 8:89727409-89727431 AAGTTTTTCCAGAGTCTGGATGG - Intergenic
1044469811 8:92553667-92553689 ATATATCCCCAGAGTCTGGATGG - Intergenic
1044726747 8:95200634-95200656 ATGTTTACACAGAGATTGCATGG - Intergenic
1045899423 8:107258918-107258940 ATGTTAGCAGAGACTCTGAAAGG - Intronic
1049364217 8:142228927-142228949 ATGTGTGAACAGATTGTGGATGG + Intronic
1050654682 9:7814059-7814081 ATCTTAGCACAGTGTATGGATGG - Intronic
1051351567 9:16202692-16202714 AGTTCTGCACAGAGCCTGGATGG - Intergenic
1052582885 9:30383870-30383892 AAGTTTGGACAGAGTCTAAAAGG - Intergenic
1054724996 9:68641339-68641361 ATGTTTGTCCAGAGCCTGGGAGG - Intergenic
1057477087 9:95411952-95411974 ATGTCTGCACAGAGACTGGACGG + Intergenic
1059104731 9:111501575-111501597 ATGGGTGCTCAAAGTCTGGAGGG - Intergenic
1059567835 9:115400965-115400987 ATTCTTGCAAGGAGTCTGGATGG + Intronic
1059908872 9:119020557-119020579 ATGTTTGCACAGAGACAGTTGGG - Intergenic
1060797779 9:126524395-126524417 ATATGTGCACAGAGACTGGAGGG - Intergenic
1187887448 X:23902863-23902885 ATGTTTGTGCAGAGTGGGGATGG - Intronic
1188170879 X:26924399-26924421 ATATTTGGCCAGATTCTGGATGG + Intergenic
1188373218 X:29394479-29394501 CGGTTTGCACAAAGCCTGGAAGG - Intronic
1192365870 X:70472605-70472627 ATGTTTGAGCAGAGGCTGAAGGG + Intronic
1192546626 X:72019631-72019653 CTGTTTGAACCGAGTCTTGAAGG + Intergenic
1198440119 X:136654980-136655002 ATGTTTGATCAGAGGCTGGACGG - Intronic
1198680971 X:139181844-139181866 ATGCTTGAACAGGGTCTTGAAGG + Intronic
1199656595 X:150001936-150001958 ATGTTTGCACAGACTCACTATGG - Intergenic
1202168522 Y:22017090-22017112 CTGTTTCCACAGAGTCATGAAGG - Intergenic
1202222839 Y:22569278-22569300 CTGTTTCCACAGAGTCATGAAGG + Intergenic
1202320276 Y:23626382-23626404 CTGTTTCCACAGAGTCATGAAGG - Intergenic
1202550491 Y:26043674-26043696 CTGTTTCCACAGAGTCATGAAGG + Intergenic