ID: 969497611

View in Genome Browser
Species Human (GRCh38)
Location 4:7535027-7535049
Sequence GTGTGTCAGCAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 1, 2: 6, 3: 62, 4: 597}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969497611_969497620 7 Left 969497611 4:7535027-7535049 CCCTCCTCCTCCTGCTGACACAC 0: 1
1: 1
2: 6
3: 62
4: 597
Right 969497620 4:7535057-7535079 GATTCCTGTTGGACCCCAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 135
969497611_969497619 4 Left 969497611 4:7535027-7535049 CCCTCCTCCTCCTGCTGACACAC 0: 1
1: 1
2: 6
3: 62
4: 597
Right 969497619 4:7535054-7535076 CCTGATTCCTGTTGGACCCCAGG 0: 1
1: 0
2: 1
3: 21
4: 156
969497611_969497616 -4 Left 969497611 4:7535027-7535049 CCCTCCTCCTCCTGCTGACACAC 0: 1
1: 1
2: 6
3: 62
4: 597
Right 969497616 4:7535046-7535068 ACACCGATCCTGATTCCTGTTGG 0: 1
1: 0
2: 0
3: 2
4: 45
969497611_969497622 11 Left 969497611 4:7535027-7535049 CCCTCCTCCTCCTGCTGACACAC 0: 1
1: 1
2: 6
3: 62
4: 597
Right 969497622 4:7535061-7535083 CCTGTTGGACCCCAGGTGGCAGG 0: 1
1: 0
2: 1
3: 21
4: 214
969497611_969497626 25 Left 969497611 4:7535027-7535049 CCCTCCTCCTCCTGCTGACACAC 0: 1
1: 1
2: 6
3: 62
4: 597
Right 969497626 4:7535075-7535097 GGTGGCAGGAGCAAAGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969497611 Original CRISPR GTGTGTCAGCAGGAGGAGGA GGG (reversed) Intronic
900358235 1:2274995-2275017 GTGTGTCAGCAGGTGGAGGCTGG + Intronic
900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG + Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900391282 1:2435061-2435083 CTTTGTCAGCAGCAGGAGGCAGG + Intronic
900987932 1:6083786-6083808 TAGTGTCAGCAGGAGAAGCAAGG - Intronic
901142003 1:7041048-7041070 GTGTGGGCGCAGGAGGCGGAGGG + Intronic
901210191 1:7520251-7520273 GTTTTTAGGCAGGAGGAGGAGGG - Intronic
901349186 1:8577576-8577598 CTGTGTCAGCATGATGAGTATGG - Intronic
901434842 1:9241018-9241040 GTCTGGAAGCAGCAGGAGGAAGG - Intronic
901689285 1:10962060-10962082 GTCTGTGAGGAGGAGGAGGAAGG - Intronic
902036913 1:13464575-13464597 GTGTGAGAGCAGGAGAGGGAGGG - Intergenic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903460005 1:23514258-23514280 GAGGCACAGCAGGAGGAGGATGG + Intronic
903787328 1:25870113-25870135 CTGAGCCAGCAGGATGAGGATGG + Intronic
904424995 1:30417374-30417396 GTGGGTCAACAGAATGAGGAAGG + Intergenic
904536716 1:31204289-31204311 GTCTGGCTACAGGAGGAGGATGG + Intronic
904941731 1:34168393-34168415 GGGGGCCAGGAGGAGGAGGATGG + Intronic
905791009 1:40789533-40789555 GAGTGCAAGGAGGAGGAGGAAGG - Intronic
905995868 1:42380506-42380528 GTGGGACAGCCGGAGCAGGAGGG - Intergenic
906617155 1:47241264-47241286 GGGTGGCAGGAGGAGGGGGAAGG + Intergenic
906938746 1:50237250-50237272 GGTTGGCAGCAGGAAGAGGATGG - Intergenic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
908067270 1:60420461-60420483 GTGTCTCAGCAGCAGGAAGGTGG + Intergenic
909960505 1:81835051-81835073 GTTTGTGGGAAGGAGGAGGAAGG - Intronic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
912007927 1:104927427-104927449 GTCTGTTAATAGGAGGAGGAGGG + Intergenic
912510375 1:110185655-110185677 ATGTGACTGCAAGAGGAGGATGG - Intronic
913072330 1:115310900-115310922 GAGTGGGAGGAGGAGGAGGAAGG + Intronic
914351311 1:146842801-146842823 GTGGGTGAGCAGGTGGATGATGG + Intergenic
915269303 1:154742291-154742313 GTGTGTGGGCAGTAGGTGGATGG - Intronic
915863865 1:159477223-159477245 TTGTGACAGCAGGAAGAGGTAGG + Intergenic
916106760 1:161438709-161438731 GTTTGCAAGCATGAGGAGGAAGG + Intergenic
916480665 1:165211729-165211751 GGGTTTCAGCAGGTGGAGGTGGG - Intronic
916583307 1:166127740-166127762 GTGTGTCTGTAGCAGGCGGAGGG + Intronic
916787262 1:168095684-168095706 ATCTGTGAGGAGGAGGAGGATGG + Intronic
918295222 1:183149942-183149964 GTGTGTGAGCAGGAGAGGGGTGG - Intergenic
919278451 1:195452039-195452061 GTGTTTCAGCAGTAGCAGGAGGG + Intergenic
920400471 1:205673060-205673082 GTGTGTGGGCAGGTGAAGGATGG - Intronic
921003527 1:211069015-211069037 TTCTGGCAGCAGGAGGAGAAAGG + Intronic
921498025 1:215864680-215864702 GTATGGAAGCTGGAGGAGGAAGG + Intronic
922059792 1:222077400-222077422 ATGTGGCAGCAGCAGGAGGTTGG - Intergenic
923015144 1:230120732-230120754 GTGTGTGCGGAGGAGGATGAGGG - Intronic
923272773 1:232372716-232372738 GTGTGACTGCAGGTGGAGGCCGG + Intergenic
923490899 1:234483232-234483254 GGGTGTTAGCAGCAGGAGAAAGG - Intergenic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
924802311 1:247336359-247336381 ATGTGAGAGCAGGAGGAAGAGGG + Intergenic
1062805311 10:415386-415408 GAGAGGCAGCAGGAGGAGGGAGG + Intronic
1062907281 10:1187409-1187431 GGATGGGAGCAGGAGGAGGAGGG - Intronic
1062969039 10:1631714-1631736 ATCTGGCAGCAGGAGGAGAATGG - Intronic
1063095625 10:2906224-2906246 CTGTGGCAGCAGGGGGAGAAAGG - Intergenic
1063298826 10:4833506-4833528 GGGTGTGAGCACGGGGAGGAAGG - Intronic
1063482146 10:6385332-6385354 GAGTGTGAGTGGGAGGAGGAGGG - Intergenic
1063755126 10:8998654-8998676 GTTTTTAAGTAGGAGGAGGATGG + Intergenic
1063958647 10:11287971-11287993 ATGTGGCAGCAGCTGGAGGAAGG - Intronic
1065261061 10:23923602-23923624 ATGTGTCGGAAGAAGGAGGAAGG + Intronic
1066358121 10:34704429-34704451 GTGTGACAGAGGGAGGAGAAAGG + Intronic
1066650693 10:37652162-37652184 GTGTGTGCGCTGGAGAAGGAAGG - Intergenic
1067095020 10:43294538-43294560 GTGTGTCCACAGGAGGAGCTGGG - Intergenic
1068884381 10:62083500-62083522 GAGTGTGGGAAGGAGGAGGAGGG - Intronic
1069617322 10:69814314-69814336 GTTTCCCAGGAGGAGGAGGAGGG + Intronic
1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG + Intronic
1070409405 10:76125646-76125668 GTCTGTCACCTAGAGGAGGAGGG + Intronic
1070778656 10:79125026-79125048 CTGTGGCAGCAGGAAGAGCAAGG + Intronic
1070843299 10:79502896-79502918 GTGAGCCGGCAGGAGGTGGAGGG - Intergenic
1070930362 10:80256692-80256714 GTGAGCCTGCAGGAGGTGGAGGG + Intergenic
1071049929 10:81435022-81435044 GAGAGTGAGCAGGATGAGGAGGG + Intergenic
1071791062 10:88954524-88954546 GTGAGTCAAAAGCAGGAGGAAGG - Intronic
1072424707 10:95320291-95320313 ATGTGTGAGCAGGGGCAGGAAGG - Intronic
1072436058 10:95415648-95415670 GAGGGTCAGGAGGAGGAGCAGGG + Intronic
1072460121 10:95611061-95611083 TTGTCACAGCTGGAGGAGGAGGG - Intronic
1072911808 10:99508872-99508894 GAGTGGGAGAAGGAGGAGGATGG - Intergenic
1073327496 10:102651101-102651123 GAGTGAGAGCAGGAAGAGGAAGG - Intronic
1074059288 10:109950283-109950305 GGGTGTGAGAAGTAGGAGGAGGG + Intronic
1074502439 10:114038750-114038772 GTGTGGGAGGAGGACGAGGATGG + Intergenic
1074833016 10:117263160-117263182 CTGTGTCAGCACCAGCAGGAGGG + Intronic
1076493930 10:130884595-130884617 GTGCGTCACCAGGTGCAGGAGGG - Intergenic
1076691304 10:132225048-132225070 ATGCCTGAGCAGGAGGAGGAAGG - Intronic
1076822411 10:132945978-132946000 GAGTGTCAGCAGGAGGGGGTGGG + Intergenic
1077308048 11:1876621-1876643 AAGTGTCTGCAGGGGGAGGACGG + Intronic
1077343168 11:2035040-2035062 GTGCTTCAGCTGGAGGAGGAAGG - Intergenic
1077486659 11:2841833-2841855 GGATGTCAGCAGCAGGGGGAAGG + Intronic
1077887402 11:6395844-6395866 ATGTGGCAGCAGAAGGAGGCTGG + Exonic
1077922885 11:6655098-6655120 ATGTGTCAGAATGTGGAGGATGG - Intronic
1079112834 11:17614600-17614622 GGTTGTCAGCAGGAGGGGGGAGG - Intronic
1079139403 11:17798017-17798039 GTGTGTAAGAAAGAGAAGGAAGG + Intronic
1079440419 11:20508462-20508484 GTGGGTCAGCAGGAGGGAGCTGG + Exonic
1079986974 11:27209885-27209907 GTGTGTAAAGAGGAGGAAGATGG + Intergenic
1080763670 11:35276472-35276494 GTGTGTCAGCAGAAGGGAGTTGG - Intronic
1081733737 11:45389365-45389387 GGGTGTAAACAGGAGGTGGAGGG + Intergenic
1081801876 11:45865674-45865696 GAGGGGCAGCAGGAGGCGGAGGG + Intronic
1083253914 11:61485040-61485062 GGCCGTGAGCAGGAGGAGGAAGG - Intronic
1083887741 11:65581081-65581103 CTTTGTGAGGAGGAGGAGGAAGG + Exonic
1084294108 11:68199329-68199351 GTGTTTCAGGTGGAGAAGGAGGG + Intronic
1084331523 11:68433214-68433236 GTGTGTTGCCGGGAGGAGGAAGG + Intronic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084645944 11:70457942-70457964 GGGTGGCGGGAGGAGGAGGATGG - Intergenic
1084727398 11:70950569-70950591 GTGTGGCAGCACGAAGAGGTGGG - Intronic
1084953584 11:72679773-72679795 CTGTCTCAGTTGGAGGAGGAAGG - Intergenic
1084978845 11:72817811-72817833 AAGTGGCAGGAGGAGGAGGAGGG + Exonic
1085471728 11:76762898-76762920 GAGTGTTAGCAGGGGGTGGATGG - Intergenic
1085842071 11:80023587-80023609 GTGTGTCATCAGGAGGAGGATGG - Intergenic
1085885501 11:80517329-80517351 TTGTCTGAGCAGGAGGAAGAGGG - Intergenic
1088662237 11:112059322-112059344 ATGTGTCAGCAGCAGTAGGTTGG - Intronic
1088712998 11:112525052-112525074 GTGTGTCAGCTGCCTGAGGAGGG + Intergenic
1089288457 11:117422674-117422696 GTGTGTCTGTAGGAGAAGGGTGG - Intergenic
1089749996 11:120644607-120644629 ATGTCTCAGGAGGAGGAGGAAGG + Intronic
1089930623 11:122307265-122307287 GTGTCACAGCAGGAGCAGAAAGG - Intergenic
1090258872 11:125304435-125304457 GTGTGGCAGCCTGAGAAGGAGGG + Intronic
1090901247 11:131033565-131033587 CTGAGTCAGCAGGGGAAGGATGG + Intergenic
1090952330 11:131484624-131484646 GTGTCTACGCAGGAGGAAGAGGG - Intronic
1090961238 11:131558755-131558777 TAGTGTCAGCTGGAGGAGAAGGG + Intronic
1091309189 11:134560841-134560863 TTTTTTAAGCAGGAGGAGGAGGG - Intergenic
1202826154 11_KI270721v1_random:90229-90251 GTGCTTCAGCTGGAGGAGGAAGG - Intergenic
1091607025 12:1962044-1962066 GGGTGTCAGCAGCAAGGGGAAGG + Intronic
1092238351 12:6823203-6823225 GAGTTCCAGCGGGAGGAGGAAGG + Intronic
1092445693 12:8554860-8554882 GTGCCTGAGCAGGAGGAGTAAGG + Intergenic
1093795682 12:23307775-23307797 GTCCATCACCAGGAGGAGGATGG - Intergenic
1093847746 12:23994671-23994693 GTGTGTGGGCAGGAGGAGAGAGG + Intergenic
1096481306 12:51942922-51942944 GTGTGTGAGAAGGGGGTGGATGG + Intergenic
1096502125 12:52070414-52070436 GGGCGTGAGGAGGAGGAGGAAGG + Exonic
1096596856 12:52701380-52701402 GTGTGTGAGCGGGCGGAGGAGGG - Intronic
1096653182 12:53072278-53072300 GAGTGTCAGAAGCAGCAGGAGGG + Intronic
1096850178 12:54430414-54430436 GTGTGACTGGAGGTGGAGGAAGG + Intergenic
1096886151 12:54721328-54721350 GAGTGGCAGAAGGAGGGGGAGGG - Intergenic
1096886175 12:54721412-54721434 GAGTGTGAGAAGGAGGGGGAGGG - Intergenic
1097008598 12:55936618-55936640 GGGTGTAATGAGGAGGAGGAGGG - Intronic
1097649352 12:62277334-62277356 GTGCTTCAGCAAGAGAAGGAAGG + Intronic
1097904376 12:64905032-64905054 GTGTGCATGCAGGAAGAGGAGGG - Intergenic
1098062251 12:66575115-66575137 GGGTGTCACCAGGAATAGGAAGG - Intronic
1098864469 12:75746104-75746126 GTGGCCCAGCAGGAGGAAGAAGG + Intergenic
1099941327 12:89192746-89192768 GTGGCTCAGCAGAGGGAGGAAGG + Intergenic
1100572091 12:95852441-95852463 GAGCCTGAGCAGGAGGAGGAAGG - Intergenic
1100604073 12:96136639-96136661 GAGTGTCTGCAGGAGCAGGCTGG - Intergenic
1102447004 12:113010905-113010927 CTGTGTCAGCAGGGGCAGAAAGG - Exonic
1102927466 12:116837158-116837180 TGATGTCAGGAGGAGGAGGAGGG - Intronic
1103900034 12:124298688-124298710 GTGTGGCAGCAGCAGGTGGATGG + Intronic
1103925855 12:124423046-124423068 GTGGGGCAGCAGGAGGGGGCTGG + Intronic
1105789880 13:23788003-23788025 GGGAGTCAGCTGGAGGAGGGTGG + Intronic
1106229930 13:27813956-27813978 GTGTGTCAGGGGCAGGAGGGTGG - Intergenic
1106475396 13:30094047-30094069 GTCTGTCAGGAGGATGTGGAGGG - Intergenic
1106933276 13:34690293-34690315 GAGGGGCAGCAGGAGGAGAAGGG - Intergenic
1107108688 13:36673744-36673766 GTGTGTCGGGGGGAGGAGGGGGG - Intergenic
1107421786 13:40254243-40254265 AGGTGGCAGAAGGAGGAGGAAGG - Intergenic
1108382742 13:49869675-49869697 GTGTGTCTGCAGGAACAGGGTGG - Intergenic
1108784432 13:53878189-53878211 GTCTATCAGAAGGTGGAGGATGG - Intergenic
1109230727 13:59753982-59754004 GTGTCCCAGTAGGAGGAGGCTGG - Intronic
1109649707 13:65310047-65310069 GGGTGTCATCAGGGGGAGCATGG - Intergenic
1110899313 13:80800617-80800639 CTCTGTCACCAGGATGAGGATGG + Intergenic
1111051316 13:82885642-82885664 GCATGACAGCAGCAGGAGGAAGG + Intergenic
1111555206 13:89871836-89871858 CTTTGTCACCAGGACGAGGATGG - Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111675279 13:91379224-91379246 GTGTCCCAGAAGGAAGAGGAAGG - Intergenic
1113756494 13:112815246-112815268 GTGTGTCTGAAGGGTGAGGAAGG - Intronic
1113756512 13:112815368-112815390 GTGTGTCTGAAGGGTGAGGAAGG - Intronic
1113756518 13:112815408-112815430 GTGTGTCTGCCGGGTGAGGAAGG - Intronic
1113756523 13:112815448-112815470 GTGTGTCTGAAGGATGAGGAAGG - Intronic
1113756528 13:112815488-112815510 GTGTGTCTGAAGGGTGAGGAAGG - Intronic
1113951513 13:114074279-114074301 GGGAGACAGCAGGAGGGGGATGG - Intronic
1114181650 14:20373139-20373161 ATGTGTCATCTGGAGGAGAAAGG + Exonic
1114210674 14:20611545-20611567 GTGAGTGAGAAGGAGGAGGAGGG + Intergenic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1115018596 14:28647313-28647335 GTCTGTCAGAAGGTGGAGGGTGG - Intergenic
1115736704 14:36339353-36339375 GTGTGAGAGCAAGAGCAGGAAGG + Intergenic
1116395787 14:44447430-44447452 GTATGTCAGCAGGAGTTGGTGGG - Intergenic
1116659110 14:47685068-47685090 GTGTGTCAGCAGCAGGTAGGGGG - Intergenic
1118348957 14:64960051-64960073 GAGTCACAGCAGGAAGAGGATGG - Intronic
1118906807 14:70029253-70029275 GGGTGTCAGCAGAATGAGGCTGG + Intronic
1119421877 14:74512068-74512090 GAGTGGCAACAGGAAGAGGAGGG + Intronic
1119539579 14:75429107-75429129 CTGGGTCAGTAGGAGGAGCAGGG + Intronic
1119655202 14:76412537-76412559 GTTTGCAAGGAGGAGGAGGATGG - Intronic
1119738834 14:77000762-77000784 GTGTGTCTGCAGGGATAGGAGGG - Intergenic
1120105594 14:80490608-80490630 GTCTGTTAGAAGGAGGAGGTGGG + Intronic
1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG + Intergenic
1121441425 14:93952077-93952099 GACTGGCAGCAGGGGGAGGAGGG + Intronic
1121885855 14:97542174-97542196 GTGTGTTAGCAGAAGCTGGAGGG - Intergenic
1122541554 14:102500444-102500466 GTGTGTGAGCAGGCGTTGGAGGG + Exonic
1122741591 14:103874738-103874760 GGGTGTCTGCAGAAGGAGGCTGG + Intergenic
1122874198 14:104655872-104655894 GGGCGTGATCAGGAGGAGGATGG + Intergenic
1122964792 14:105117743-105117765 CTGTGACAGCAGGAAGAGCAGGG + Intergenic
1123066148 14:105620375-105620397 GTGTGGCTGCAGGAGGCGGGGGG + Intergenic
1123070291 14:105639428-105639450 GTGTGGCTGCAGGAGGCGGGGGG + Intergenic
1123074881 14:105663087-105663109 GTGTGGCTGCAGGAGGCGGGGGG + Intergenic
1123089528 14:105736212-105736234 GTGTGGCTGCAGGAGGCGGGGGG + Intergenic
1123095316 14:105764372-105764394 GTGTGGCTGCAGGAGGCGGGGGG + Intergenic
1202902678 14_GL000194v1_random:52503-52525 GTGTGTGAGCAGGAAGTGCAGGG - Intergenic
1123691959 15:22845677-22845699 GGGTTGCAGGAGGAGGAGGAGGG + Intronic
1123811632 15:23932531-23932553 GTGAGAAAGCAGGAGCAGGAAGG + Intergenic
1123861876 15:24477091-24477113 GTGAGGAAGCAGGAGCAGGAAGG + Intergenic
1124093736 15:26629494-26629516 ATGTGTTGGCAGGAGGAGGAGGG + Intronic
1124095919 15:26648741-26648763 GTGCGTCAGCAGGGCGAGGCAGG + Intronic
1124887955 15:33704458-33704480 GTGTGTATGCAGGAGGTGGCTGG - Intronic
1124955022 15:34354640-34354662 GGGCAGCAGCAGGAGGAGGAAGG + Exonic
1125130070 15:36274068-36274090 GTCTGTCAGCAAGGGGAGAATGG + Intergenic
1125501028 15:40240386-40240408 GTGTGTCAGGAGGAGGGGGGAGG + Intronic
1125555342 15:40580116-40580138 GTGTGACAGGAGAAGGAGGGAGG + Intergenic
1125594959 15:40878938-40878960 TTTTGTCAGCAAGAGGGGGAGGG + Intergenic
1125610518 15:40966285-40966307 GCGGGTCAGCAGGCGGAGGAAGG + Intergenic
1126031240 15:44500063-44500085 GTTTGCCAGCAGGTGGAGGCAGG + Intronic
1126344076 15:47674714-47674736 GGCTGGCAGCTGGAGGAGGATGG + Intronic
1127222263 15:56892088-56892110 GTGTGTGAGCTGGTGGTGGAGGG + Intronic
1127372776 15:58356312-58356334 GGGTGTCAGGGAGAGGAGGAGGG - Intronic
1127525462 15:59788041-59788063 GTGGGTTAGCAGCAAGAGGAGGG + Intergenic
1127964265 15:63912107-63912129 GTATGTCCGCAGGCGGTGGAAGG - Exonic
1128067181 15:64772686-64772708 GTGGGTGAGTAGGAGGAGCAAGG - Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128733597 15:70036954-70036976 GAGGGTCAGCAGGTGGAGGGAGG - Intergenic
1129144329 15:73633355-73633377 CTGCGGCGGCAGGAGGAGGACGG - Exonic
1129795603 15:78374014-78374036 CTGTGTCAACATGAGGAGGGAGG - Intergenic
1129828262 15:78650034-78650056 GAGTGTGCCCAGGAGGAGGATGG + Intronic
1129953836 15:79615275-79615297 GTGTATCATAAGGAGAAGGAAGG - Intergenic
1130344634 15:83031627-83031649 GTGGGGCAGCGGGAGGGGGAAGG + Intronic
1130573705 15:85071789-85071811 GTGTGTAAACAGGATGAGAAGGG + Intronic
1130636021 15:85620808-85620830 GTGTCTAAGCAGGATGAGGGCGG + Intronic
1130772101 15:86934930-86934952 GTGTGATATCAGGAGGAGAATGG - Intronic
1131258457 15:90876366-90876388 GGGTGGCAGCAGGAGGGGGCTGG - Intronic
1131431458 15:92392535-92392557 GTGTGTAAGGAGGGGCAGGAGGG - Intergenic
1131933100 15:97467975-97467997 ATGTATCTGCAGGAGGGGGATGG + Intergenic
1132366950 15:101264723-101264745 GGGTGTCAGGAGGAGGAGAATGG + Intergenic
1132366957 15:101264753-101264775 GGGTGTCAGGAGGAGGAGAATGG + Intergenic
1132670407 16:1100162-1100184 GTGTGTGAGCAGGTGGGGCAGGG - Intergenic
1133118170 16:3589979-3590001 GTGCTGCAGCAGGAGGATGAGGG - Exonic
1133234845 16:4382950-4382972 GTGTGGCAGCAGGAGGGGGCTGG - Exonic
1133888109 16:9850923-9850945 GTGTGGGAGCAGGAGGAGAAGGG - Intronic
1134286004 16:12862590-12862612 GTGGGTCAGCAGGAGGTGAGCGG - Intergenic
1135294115 16:21264494-21264516 GTGTGGGGGCAGGAGGAGGGAGG + Intronic
1135554137 16:23421737-23421759 ATGTGTCAGGAGGCTGAGGAAGG + Intronic
1136468121 16:30459175-30459197 GTGTGGCAGCAGGAGGCTGCTGG - Intergenic
1137608440 16:49802577-49802599 GTGTCACAGGAGGAGGAGGAAGG + Intronic
1137713506 16:50583496-50583518 GTGTGGTTGCAGGGGGAGGAAGG - Intronic
1137773803 16:51039657-51039679 GTGTGTCAGGAGAAGGCCGAGGG + Intergenic
1138188800 16:54997758-54997780 GAGTGTCAGCAGGCAGAGGTTGG - Intergenic
1138719422 16:59061677-59061699 GTGTGTTAGCAGGAGATGAAGGG - Intergenic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139449677 16:67019481-67019503 GTGAGTCAGCATGTGAAGGAAGG + Intergenic
1139492376 16:67293259-67293281 GGGAGTCAGCAGGGGAAGGAAGG - Intronic
1139559145 16:67730552-67730574 AGGTGCCAGCATGAGGAGGATGG - Intronic
1139982727 16:70872749-70872771 GTGGGTGAGCAGGTGGATGATGG - Intronic
1141178172 16:81734372-81734394 GAGTGTGAGGAGCAGGAGGAGGG + Intergenic
1141466906 16:84212271-84212293 CTGTGTCAACAGGGCGAGGAAGG - Intergenic
1141618998 16:85226809-85226831 GTGTGTGTGAAGGAGGACGAAGG + Intergenic
1141817912 16:86425441-86425463 GTGGGTGAGAAGGAGAAGGAAGG + Intergenic
1141864688 16:86741974-86741996 GTTTGTCTGCTGGAGGAAGAGGG - Intergenic
1142107851 16:88315864-88315886 GTGACTCAGCAGGAGGGGGAGGG - Intergenic
1142362237 16:89632941-89632963 GAGGGGCTGCAGGAGGAGGAGGG + Intronic
1142552781 17:751408-751430 ATGTGTCAGCAGTAGTAGGCTGG - Intronic
1142591833 17:1009687-1009709 GTGTTCCAGCAGGAAGAGGAAGG + Exonic
1142798078 17:2324666-2324688 GTGGGTATGAAGGAGGAGGATGG - Exonic
1143462914 17:7115231-7115253 AAGCTTCAGCAGGAGGAGGAAGG + Intronic
1143532075 17:7511343-7511365 GTGTGGGAGTGGGAGGAGGAAGG - Intronic
1143739307 17:8941077-8941099 GTGTGTCAGCAGCAGGACAATGG + Intronic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1144761141 17:17708145-17708167 GGGTGGCAGCAGGAGGAAGGAGG - Intronic
1144825636 17:18104202-18104224 GTGTGTGCGCACCAGGAGGATGG - Intronic
1146164072 17:30574636-30574658 GTGGGGCAGCAGGGGAAGGAAGG - Intergenic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146789808 17:35744972-35744994 GTAGGTGAGGAGGAGGAGGAAGG - Exonic
1146925484 17:36742043-36742065 GTGTGTGAGAGGGAGGAAGAGGG + Intergenic
1146983420 17:37188340-37188362 GTTTGTCAGGAAGAGGCGGATGG + Exonic
1147038068 17:37696487-37696509 GAGTGTGAGCAGGAGGGAGAAGG - Intronic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1148053165 17:44779205-44779227 ATGTTTCTGCAGGGGGAGGATGG - Exonic
1148461231 17:47840155-47840177 GTGTGTCAGGCAGATGAGGAAGG + Intronic
1148796263 17:50198410-50198432 GTGAGCCAGCAGGGGGAGCATGG - Intronic
1148837637 17:50474268-50474290 GTGTGTAAGGTGGAGGAGGCTGG + Intronic
1149461356 17:56832687-56832709 GTGTTTAAGAGGGAGGAGGAGGG - Intronic
1149479634 17:56992319-56992341 CTGAGTCAGCATGAAGAGGAGGG + Intronic
1149604773 17:57916877-57916899 TTCTCTGAGCAGGAGGAGGAGGG + Intronic
1149644319 17:58228729-58228751 GTTAGTCACCAGGAGGAAGATGG - Intronic
1149671595 17:58417667-58417689 GTGTGTGAGCACCAGGAGGAGGG - Intergenic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1150333641 17:64314205-64314227 GTGTGGCAGCAGGGACAGGAAGG + Intergenic
1151320897 17:73351852-73351874 GTGTGGCAGGGGGAGGAGGCTGG + Intronic
1151955727 17:77379237-77379259 GGGTGTCAGGAGGTGGAGGGGGG + Intronic
1152091656 17:78250791-78250813 GTGGGTCAGGAAGAGGATGAGGG + Intergenic
1152601945 17:81267503-81267525 GTGAGTTAGCAGGAGAAAGAAGG - Intronic
1152610070 17:81311070-81311092 GGGTCTCAGCAGGGGGAGGCCGG - Intergenic
1152890810 17:82880734-82880756 GTCTGTCCACAGGAGCAGGAGGG + Intronic
1153544532 18:6192450-6192472 GTGTGGCAACAGGAGCAGGCAGG + Intronic
1153878110 18:9394737-9394759 GTGTGTCTGTAGGGAGAGGAAGG - Intronic
1153979389 18:10296420-10296442 CGGTGTCAGCAGCAGGAGAAAGG - Intergenic
1154052095 18:10970722-10970744 GTGAGTCAGGAGAAAGAGGAAGG + Intronic
1154078191 18:11225810-11225832 GAGTGTGAGCAGGTGGGGGAAGG - Intergenic
1155313878 18:24551997-24552019 GTGAGCCAGCAGAAGGAGAATGG - Intergenic
1157563589 18:48664763-48664785 GTGGGTCATCAGGAGCAGGTGGG - Intronic
1157632254 18:49109926-49109948 GTGTGTCAGCAGTAGCACAAAGG - Intronic
1157776934 18:50403202-50403224 CTCTCTCAGCAGGAGGAGGGGGG - Intergenic
1157910589 18:51614287-51614309 ATGGGTCAACAGGAGTAGGAAGG - Intergenic
1158543442 18:58376815-58376837 GTGAGTCTGGAGGAGGAGCAGGG - Intronic
1159327267 18:66938442-66938464 GTGGGTCAACAGGAAGCGGATGG - Intergenic
1159877366 18:73827543-73827565 GGGTGGGAGCAAGAGGAGGAGGG + Intergenic
1159904030 18:74074558-74074580 GTGAGTCAGCTGGAAGACGAAGG - Intronic
1159918312 18:74204826-74204848 GTGTGGGAGAAGGAGGGGGATGG + Intergenic
1159918321 18:74204853-74204875 GTGTGGGAGAAGGAGGGGGATGG + Intergenic
1160905980 19:1451935-1451957 GTGTGTGGCCAGGTGGAGGAGGG + Exonic
1161352774 19:3803226-3803248 GGGTGTGAGGTGGAGGAGGACGG + Intergenic
1161410407 19:4113809-4113831 GAGTGTCAGCGAGAGCAGGAGGG + Intronic
1161682821 19:5688436-5688458 GGGTCTGAGCGGGAGGAGGAGGG + Exonic
1162066580 19:8129407-8129429 GTGTGTCCGAGGCAGGAGGAGGG + Intronic
1162336998 19:10067924-10067946 GTGTGGCTACAGGAGGAGTAAGG + Intergenic
1162525029 19:11201884-11201906 GTGTGCCACCGGGAGGAGGTGGG - Exonic
1162571682 19:11478125-11478147 GGGTGACAGGAGGAGGTGGAGGG + Intronic
1163205559 19:15800037-15800059 GTGTGCGAGCAGGTGGGGGAAGG - Intergenic
1163775619 19:19215586-19215608 GTGTGAAGTCAGGAGGAGGATGG + Intronic
1163882876 19:19942741-19942763 GCATTTCAGCAAGAGGAGGAAGG + Intergenic
1164790572 19:30974242-30974264 GTGTGTAAGATGGAGGTGGAGGG - Intergenic
1165272772 19:34724775-34724797 CTCTCTCAGCAGGAGGAGGGGGG - Intergenic
1165338760 19:35194953-35194975 GTGTGTCAGGAAGTGGGGGAAGG + Intergenic
1165434668 19:35789378-35789400 GTGGGTCAGCAGGCTGGGGATGG + Intergenic
1166195209 19:41201337-41201359 GTATTTCATCAGGAGCAGGAGGG - Exonic
1166290098 19:41857505-41857527 GTGTGTCAGCATGGGGACTATGG + Intergenic
1166800786 19:45455858-45455880 GAGTGTCTGCAGGAGGGAGAGGG + Intronic
1166887719 19:45972168-45972190 GTGTGTAAAAAGGAGAAGGAAGG - Intronic
1166907819 19:46125578-46125600 CTGTGCCAGCAAGTGGAGGATGG - Intergenic
1166911148 19:46158858-46158880 TTGTGGCAGCAGGTGGGGGATGG + Intronic
1166950769 19:46426627-46426649 GGGTGACAGCCGAAGGAGGATGG + Intergenic
1167114893 19:47483456-47483478 GTGTGTAAGGAGGAGGGCGAAGG + Intronic
1167300331 19:48674084-48674106 GTGCATCAGCTGCAGGAGGATGG + Intergenic
1167583760 19:50361484-50361506 GTGCGTCACAAGGAGGGGGAGGG - Intronic
1167619602 19:50553410-50553432 GCGAGTGAGCAGGGGGAGGAGGG - Intronic
1167960018 19:53097915-53097937 GAGCTTCAGCAGCAGGAGGATGG - Intronic
925363538 2:3295822-3295844 GTGTGTGTGCAGGGAGAGGATGG - Intronic
925675895 2:6360679-6360701 CTGTGTCTGCAGGAGGAGATCGG + Intergenic
925720966 2:6826626-6826648 TTGTGTCAGCAGGAAGATCAGGG + Intergenic
925941752 2:8827396-8827418 TGGTGACAGCAGGAGGAGCAGGG - Intronic
926211958 2:10877977-10877999 GGCTGTGAACAGGAGGAGGAAGG + Intergenic
926698184 2:15785078-15785100 GTGGGTCAGGATGAGGAGCAGGG + Intergenic
927452951 2:23224378-23224400 GTGTCCCAGCAGGAAAAGGATGG - Intergenic
927827266 2:26317469-26317491 GTGTATGGACAGGAGGAGGAGGG - Intronic
927924431 2:27000623-27000645 GAGAGACAGGAGGAGGAGGAGGG + Intronic
928226668 2:29455190-29455212 GTGTGGCAGCAGGAGGTGGCGGG + Intronic
929300248 2:40295904-40295926 CTTTGTGAGCAGGAGGAGAAGGG + Intronic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
929533847 2:42768291-42768313 GTCTGGCCTCAGGAGGAGGAGGG + Intronic
929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG + Intergenic
929948031 2:46384958-46384980 GTGTGTGAGAAGGAGAAGGAGGG - Exonic
931054140 2:58449818-58449840 GTGTGTGAGAAGTAGGAGTAGGG - Intergenic
931306403 2:61033649-61033671 GAGTGTCAGGAGGAGGAACAGGG + Intronic
932020246 2:68077432-68077454 GTGTCCCAGCAGGAGGATGAGGG + Intronic
933076606 2:77935810-77935832 GTGTTTCAGAAGAGGGAGGATGG + Intergenic
933296844 2:80500684-80500706 TTCTGTCAGCAAGAGGGGGAGGG - Intronic
933599783 2:84317630-84317652 GTGTGTCTGAAGGAGTAGCAAGG + Intergenic
933718004 2:85376343-85376365 CTGTGCCAGCAGGGGAAGGAGGG + Intronic
933779132 2:85789198-85789220 GTATGTATGCAGGAGGGGGATGG - Intergenic
934101840 2:88660605-88660627 GTGTGTATGCAGGTGGGGGAGGG + Intergenic
934676606 2:96253813-96253835 GTGTGTAAGCAGGGGGTGGCTGG + Exonic
934946226 2:98543878-98543900 GTGTGTGAGCTGGAGGAGCTGGG + Exonic
935175386 2:100644199-100644221 TTGTGTCTGCGGGAGGAGGAAGG + Intergenic
935209052 2:100922788-100922810 GTGTCCCAGCCGGAGGCGGATGG + Intronic
935494667 2:103765419-103765441 GTGTGTGGGCAGAAGGATGAGGG - Intergenic
935673685 2:105576288-105576310 CTCTGTGAGCAGGGGGAGGAGGG + Intergenic
935687846 2:105699913-105699935 GTGTTTGAGGAGGAGAAGGAAGG - Intergenic
936448698 2:112617218-112617240 GTTTGTCAGCAGGGTCAGGAGGG + Intergenic
937122002 2:119446931-119446953 GTGTGCCTACAGGAGGAGAAAGG - Intronic
937214916 2:120306389-120306411 AGGTGGCAGCAGGTGGAGGACGG - Intergenic
937249198 2:120512549-120512571 GGGTGTCAGAGGGAGGAGGAAGG + Intergenic
937335217 2:121058409-121058431 GTCTGGCAGCAGGATGAGGGTGG + Intergenic
938099283 2:128487151-128487173 GTCTGTCAGCCCCAGGAGGACGG + Intergenic
938178942 2:129162513-129162535 GAGGGGCAGAAGGAGGAGGAAGG + Intergenic
938407180 2:131039173-131039195 GTGGCTCTCCAGGAGGAGGAAGG - Intronic
940154699 2:150643201-150643223 GTGTGTGTGCTGGGGGAGGATGG - Intergenic
940660916 2:156544188-156544210 GTCTGTCAGCTGAAGTAGGATGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942278944 2:174342258-174342280 GGGTGTCCGCCGGAGGACGAAGG - Intergenic
942306393 2:174611499-174611521 TGGTATCAGGAGGAGGAGGAGGG + Intronic
942447154 2:176085657-176085679 GTGTGTCGGCAGAAAGAAGAGGG - Intergenic
944163034 2:196686764-196686786 GTGTGTCAGAGGGTGGAGGGTGG - Intronic
944485355 2:200199756-200199778 GTGTGGCAGCAGGGTGAGGCCGG + Intergenic
946281384 2:218668202-218668224 GTGTGGCAGCAAAGGGAGGAAGG - Intronic
947612539 2:231532857-231532879 GGGACTCAGCAGGATGAGGAGGG - Intergenic
948753276 2:240144585-240144607 GTGAGTCAGCAGCAGGAGCCTGG - Intergenic
948803206 2:240442076-240442098 GTGGGTCAGCAGGAGCTGGCGGG - Intronic
948928885 2:241117506-241117528 GAGTGTCAGGAGGAGGGAGAAGG + Intronic
949012268 2:241687386-241687408 GTTTGACAGCAGGGGCAGGATGG + Intergenic
1169247965 20:4038771-4038793 GTAAGTCAGCAAGAGGATGATGG + Intergenic
1169340962 20:4795839-4795861 GAGTGCCAGGAGGAGGAGGATGG + Exonic
1170974301 20:21147991-21148013 GTGTGGCAGCAGATGAAGGAAGG + Intronic
1171266010 20:23772973-23772995 GGGTCTCAGCAGGAGCAGGTGGG - Intergenic
1171275741 20:23855507-23855529 GGGTCTCAGCAGGAGCAGGTAGG - Intergenic
1171953395 20:31440999-31441021 GTGTGTGAGGAGGAGTGGGAGGG + Intronic
1172033304 20:31996071-31996093 GTGGGCCACCAGGAGGAGGCCGG - Intronic
1172328639 20:34057976-34057998 GTGTCTCAGCTGCAGGAGAAAGG - Intronic
1172673059 20:36647620-36647642 GTATGGCAGCAGGAGTGGGAAGG - Intergenic
1172793449 20:37521574-37521596 GAGGGTCAGCGCGAGGAGGACGG - Intronic
1173280297 20:41620923-41620945 GTGTGAGAGCAAGAGGAAGATGG + Intergenic
1174067823 20:47878481-47878503 GTGTGTCTTTAGGAGCAGGAAGG - Intergenic
1174399825 20:50270009-50270031 GTGTTCTAGCAGGAGGAGGGAGG - Intergenic
1175394096 20:58646911-58646933 CTGTGGCTGCAGGATGAGGAGGG + Intergenic
1175399074 20:58689778-58689800 GTGTGTGGCCAGGAGGAGGAAGG - Intronic
1175454388 20:59099986-59100008 GTCTATCAGAAGGTGGAGGAAGG - Intergenic
1175709110 20:61205169-61205191 CTGTTTCATCAGGAGGATGAGGG + Intergenic
1175970691 20:62685234-62685256 GTGTGGGGGCAGGAGGAGGGGGG + Intronic
1175992821 20:62797853-62797875 CTGTGGCAGCAGGAGGTGGTGGG + Intronic
1176233775 20:64044905-64044927 CTGACTCAGCAGGAGGAGGGTGG + Intronic
1176296640 21:5076660-5076682 GTGAGTGACCAGGAGGAGGAGGG + Intergenic
1176622042 21:9067270-9067292 GTGTGTGAGCAGGAAGTGCAGGG - Intergenic
1176912444 21:14582402-14582424 TAGTGTTAGCACGAGGAGGAAGG - Exonic
1177758288 21:25373643-25373665 GAGTGGGAGGAGGAGGAGGAGGG - Intergenic
1178756004 21:35350310-35350332 GAAAGTCAGCAGGAGGTGGAGGG - Intronic
1178802351 21:35807870-35807892 GTGAGCCAGCAAGAGGGGGAAGG + Intronic
1179078831 21:38150959-38150981 GTGTGATAGTGGGAGGAGGATGG + Intronic
1179150564 21:38805591-38805613 GAGTGACAGCAGGAGGCGGAGGG + Exonic
1179272984 21:39865914-39865936 GTGGGAGAGAAGGAGGAGGAGGG - Intergenic
1179421235 21:41238387-41238409 GTCTGTATGCAGGAGGAGGGAGG + Intronic
1179440723 21:41391977-41391999 ATCTGTCAGAAGGTGGAGGAGGG - Intronic
1179860409 21:44185461-44185483 GTGAGTGACCAGGAGGAGGAGGG - Intergenic
1180128574 21:45809450-45809472 GTGTGCGAGCAAGAGGAGGAAGG + Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180729765 22:17972644-17972666 TTGGGGCAGCAGGAGAAGGAAGG + Intronic
1180922053 22:19526047-19526069 ATGGGTCTGCAGCAGGAGGAAGG - Intronic
1181438996 22:22926281-22926303 GGGGGTCAGCAGGGGGAGAAGGG - Intergenic
1181959941 22:26615882-26615904 GTGTCCCAGAAGGAGGAGGGAGG + Intronic
1182244268 22:28943174-28943196 GGGAGACAGAAGGAGGAGGAGGG - Intronic
1182505926 22:30782308-30782330 GGTTGTCTGCAGGAGGTGGAAGG - Intronic
1184907253 22:47497228-47497250 GTGTGTCAGCACGAAGACAAAGG - Intergenic
1185375263 22:50479912-50479934 GTGTGTCAGCAGGAGGGTTACGG + Intergenic
1185427581 22:50781998-50782020 GTGTGTCAGGTGGAGGGGGCAGG - Intronic
949538868 3:5016784-5016806 GTGAGTCAGGAGGCAGAGGAGGG + Intergenic
950312393 3:11969999-11970021 AGGTGTCAGAAGGAGGTGGATGG + Intergenic
950346687 3:12301727-12301749 GTGTGGTGGCAGGAGGAGAATGG - Intronic
950406296 3:12807213-12807235 GTGTGGCCGCAGGAGCATGAGGG + Intronic
950963827 3:17132196-17132218 CAGTGTCAGCAGGAAGCGGAGGG - Intergenic
953413497 3:42702735-42702757 TGGTGACAGCGGGAGGAGGAGGG + Exonic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
953741820 3:45545015-45545037 GTGTGTGAGCAGGAGAGAGAGGG + Intronic
954366836 3:50150980-50151002 GGGTGGCACCAGGAGGAGGCAGG - Intergenic
954968364 3:54630484-54630506 GTGAGTCTGCAAGAGGAGGATGG - Intronic
955837729 3:63076008-63076030 GTGTGTGTGTAGGAGGTGGAGGG + Intergenic
955911344 3:63863127-63863149 GTGGGTGAGAAGGAGGAGCAGGG - Intronic
957959167 3:87227393-87227415 GAGAGACAGCAGGAGGAGGTCGG - Exonic
958883483 3:99699416-99699438 ATGTGAGAGCAGGAAGAGGAAGG - Intronic
959163868 3:102752139-102752161 GTGTCTCAGCAGGAAAAAGATGG - Intergenic
959894949 3:111594943-111594965 CTGTTTCAGCAGGAGGAGCTGGG + Exonic
960066155 3:113375221-113375243 GTGTTACAGGATGAGGAGGACGG + Intronic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960810695 3:121624583-121624605 GCGTGTCAGCAGGAGATGGGAGG + Intronic
960970854 3:123139234-123139256 GTGGGACAGTTGGAGGAGGAGGG - Intronic
961034788 3:123634779-123634801 GGGAGACAGCAGGGGGAGGAGGG + Intronic
961225530 3:125241957-125241979 TTATCTCAGCAGGAGGTGGATGG + Intronic
961485390 3:127212350-127212372 GTGTGTCTGGAGGTGGGGGATGG - Intergenic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961660333 3:128465271-128465293 ATGTGTCAGCAGGTGTAGGTGGG - Exonic
961697433 3:128715275-128715297 GTGTGGCACAAGGAAGAGGAAGG + Intergenic
962950124 3:140210756-140210778 GTGGGTTTGAAGGAGGAGGAGGG + Intronic
963942079 3:151105425-151105447 GTGTCTCAGCAGAAAGATGAGGG - Intronic
965342311 3:167504897-167504919 GGGTGACAGCAGGAGCAAGAGGG - Intronic
965697153 3:171421254-171421276 GTGTGTCTGCAGGGAGTGGAAGG - Intronic
966061624 3:175763815-175763837 GTGTGTTAGAATGGGGAGGAAGG - Intronic
966214817 3:177491307-177491329 GTGTGTCTGGAGGCGGGGGATGG + Intergenic
967144938 3:186598511-186598533 ATGTGTGTGAAGGAGGAGGAAGG - Intergenic
967419846 3:189260802-189260824 TAGTGTCAGCAGGTGGAGGGAGG + Intronic
967787587 3:193514236-193514258 GTCTGTCAGAAGGTGGAGGCTGG - Intronic
967980107 3:195060615-195060637 GTGGCTCGGCAGGAGGAGGCAGG - Intergenic
968218428 3:196914710-196914732 GTGTTCCTGCAGGAGGACGATGG - Intronic
968433278 4:572044-572066 GTGTGCCCGCAGGAATAGGAGGG + Intergenic
968571567 4:1344944-1344966 GTGTGGCAGCAAGAGCAGGCTGG + Intergenic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
968750627 4:2387133-2387155 GTTTGCCTGCAGGAGGAGGCTGG + Intronic
969060656 4:4431730-4431752 GTGGGTCATCAGGAGGAGGGAGG - Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
970010574 4:11454576-11454598 GTGTATCAGAAGAAGGAGGCTGG + Intergenic
970536881 4:17038977-17038999 GTGTGGCAGAAGGGGAAGGAGGG - Intergenic
971124322 4:23736090-23736112 GTGTGACAGCAGGAGTAGCTAGG - Intergenic
972247275 4:37258662-37258684 GAGTGTCAGCAGGTGGAGGAAGG + Intronic
972807150 4:42540776-42540798 GTGAGACAGAGGGAGGAGGATGG + Intronic
973219842 4:47712633-47712655 GTGTGGCAGCCAGGGGAGGAAGG - Intronic
973229315 4:47823857-47823879 GGGTCTGAGTAGGAGGAGGAAGG - Intronic
974813579 4:66977108-66977130 GGGTGTCATGAGGAGGAGCAAGG + Intergenic
975473349 4:74794554-74794576 GGGTGTGTGCAGGAGGAGGGGGG - Exonic
976408740 4:84688423-84688445 GGTAGTCAGCAGGAGGAGAAAGG - Intronic
979230621 4:118345324-118345346 ATTTGTAAGAAGGAGGAGGAGGG + Intronic
980169090 4:129265334-129265356 GTGTGTCAGGAGCTGGAAGACGG - Intergenic
981033730 4:140151182-140151204 GAGTGGCTGGAGGAGGAGGAAGG + Intronic
981486662 4:145294165-145294187 GTCTGAGAGCAGGAGTAGGAAGG - Intergenic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982206993 4:153004295-153004317 GTGTGTGGGGAGGAGGAGGAAGG + Intergenic
983095619 4:163558113-163558135 GTGTCTGAGCATGAGGTGGAAGG + Intronic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
984704376 4:182837017-182837039 GCGTGTCAGGAGCAGGAGCATGG - Intergenic
985026459 4:185743979-185744001 GGGGGACAGGAGGAGGAGGAGGG - Intronic
985190837 4:187370926-187370948 ATGTGTCAGCTGGAGGGGAATGG + Intergenic
985257896 4:188087679-188087701 GTGTGTCAGATGGAGAAAGAGGG + Intergenic
985364788 4:189216878-189216900 GTGGGTGAGCAGGAGGAGTGAGG + Intergenic
986796926 5:11221831-11221853 AAGTGTCACCAGGAGGAGAAAGG + Intronic
987377665 5:17251545-17251567 GTCTAGCAGCAGGAGGAGGTAGG + Intronic
987536529 5:19196396-19196418 GTGTGTGAGTGGGAGGAGGCGGG + Intergenic
987589477 5:19904823-19904845 TTGTGGGAACAGGAGGAGGAAGG + Intronic
989095411 5:37777139-37777161 GTGTGTCAGCTCCAGGAGGCTGG + Intergenic
989630038 5:43472806-43472828 GGGGGTCAGCAGGGGGAGGTGGG + Intronic
990174050 5:53087380-53087402 TTGTGTAAGCAGGAGGAGAAAGG - Intronic
990896406 5:60704442-60704464 GTGAGGCGGCAGGAGGTGGAGGG - Intergenic
991504301 5:67308162-67308184 TTCTGTCAACAGTAGGAGGAAGG - Intergenic
992448654 5:76856051-76856073 ATGTGGCCGGAGGAGGAGGAAGG - Intronic
992822122 5:80507869-80507891 GTGTGACAGCCCAAGGAGGAGGG - Intronic
993354755 5:86892235-86892257 TTGTGTGAGAAGGAGAAGGAAGG - Intergenic
993492474 5:88568931-88568953 GTGGGTCGGCAGAAGGGGGAGGG + Intergenic
997823889 5:137089422-137089444 GTGTGGGAGGAGGAGGAGGGTGG - Intronic
998170577 5:139870050-139870072 GTATGTCACAGGGAGGAGGAGGG + Intronic
998565795 5:143214805-143214827 CTGGGTCAGCAGGAGTGGGAGGG + Intronic
998733121 5:145103823-145103845 GCGTGACAGCATGAGGAGGTGGG + Intergenic
998885708 5:146691740-146691762 GTGAGTGAGCAGGGAGAGGATGG - Intronic
999334190 5:150700905-150700927 GTGTGCCTGCCGGAGGAGGATGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999820508 5:155223176-155223198 GTGAGTCAGCAGCAGTAGTAGGG + Intergenic
1000041250 5:157486682-157486704 GAGTGCCAGCAGAGGGAGGAGGG - Intronic
1000056207 5:157608822-157608844 GTGAGTCTGGAGGAGGAGAAAGG - Intergenic
1002805684 6:571996-572018 GTGTGACTGCAGAAGGTGGACGG + Intronic
1002961364 6:1917844-1917866 GTGAGTCAGAAGCTGGAGGACGG + Intronic
1003567675 6:7234367-7234389 GGGTGACAGCAGGGGGAGGTGGG - Intronic
1004097369 6:12570809-12570831 GTGTGAGAGCAGGAGGAGGAAGG + Intergenic
1004327530 6:14689204-14689226 GTGTCACAGGAGGAAGAGGAAGG + Intergenic
1006160679 6:32039077-32039099 GCTTGTCTGCAGGAGGAGGTGGG - Exonic
1007222759 6:40292118-40292140 GTGTGGAGGCAGGAGAAGGAAGG + Intergenic
1007520381 6:42447557-42447579 GTGTGGCTGAGGGAGGAGGAAGG - Intronic
1009325829 6:62346542-62346564 GTGTGACAGCAGCAGAAGAAAGG - Intergenic
1010133643 6:72524300-72524322 CTGTGCCAGCAGGAGCAGGTGGG - Intergenic
1010403963 6:75481500-75481522 GCTTGTCAGCAGGAGCAGGAAGG - Intronic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1011586659 6:88933403-88933425 GTGTGTGGGCAGGAGGAGCATGG - Intronic
1011622156 6:89253094-89253116 GTTTCTCAACAGGAGGAGGGTGG - Intergenic
1011625328 6:89278858-89278880 GTGTGGGAGGAAGAGGAGGACGG + Intronic
1012619679 6:101327056-101327078 TTGTTTCAGCATGAGGAGAATGG + Intergenic
1013367769 6:109448081-109448103 GTGTGTCAGAAAGAGGAAGAAGG - Intronic
1013972687 6:116039805-116039827 GGGTGTAAGAAGGAAGAGGATGG - Intronic
1014441623 6:121480229-121480251 GTGTTTCCGCAGGAGGAAGTCGG - Intergenic
1015213356 6:130722051-130722073 GTGTGTCAGCTGGAGGAAACAGG + Intergenic
1015413894 6:132926736-132926758 GTGTGTGAGCGGGAGGGGTAGGG - Intergenic
1015588015 6:134795940-134795962 GTATGTCAGGAGGAGGAGGCTGG - Intergenic
1015718475 6:136216088-136216110 GATAGGCAGCAGGAGGAGGAAGG + Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1017554254 6:155545904-155545926 GTTTGCCAGCAGGAGCAGTAGGG + Intergenic
1017671496 6:156773621-156773643 TTGTGTCAGCGGGAGGATTAGGG + Intergenic
1018220205 6:161570501-161570523 GTGGCTGAGGAGGAGGAGGAGGG - Intronic
1018376706 6:163219732-163219754 GGGAGGCAGCAGGAGGAGGCAGG - Intronic
1018706305 6:166465779-166465801 GTCTGTGAGCAGCTGGAGGACGG + Intronic
1018742663 6:166742513-166742535 TTGTGTCAGGAGGAGGCAGAAGG - Intronic
1018863431 6:167729903-167729925 GTGTGAGGGCAGGAGGTGGATGG + Intergenic
1019166754 6:170102299-170102321 GGGTGACCGCAGCAGGAGGAGGG + Intergenic
1019347861 7:539426-539448 GTGTGTGGGCAGGTAGAGGAGGG - Intergenic
1019773714 7:2899621-2899643 CTCTGGCTGCAGGAGGAGGAAGG - Intergenic
1019861889 7:3666473-3666495 GTGTGTCGGCAGCAGGGTGAGGG - Intronic
1020180033 7:5915104-5915126 CCGTGACAGCAGGAGGAGGGAGG + Intronic
1020302901 7:6809778-6809800 CCGTGACAGCAGGAGGAGGGAGG - Intronic
1020451316 7:8323430-8323452 GTGTGTCAGTAGGGAGAGGTGGG + Intergenic
1021904927 7:25323826-25323848 GTGTGGCTGGAAGAGGAGGAAGG - Intergenic
1022232003 7:28423391-28423413 GTGTTTCAGGAGGAGGGTGAGGG + Intronic
1023662226 7:42481536-42481558 GTGTGTGCACAGCAGGAGGAGGG + Intergenic
1023847208 7:44129082-44129104 GTGTGTTGGCAGCAGGAGGGAGG + Intergenic
1023878683 7:44306727-44306749 GGGTGTGGGCAGGAGGAGGAGGG + Intronic
1023878719 7:44306845-44306867 GGGTGTGAGCAGGGGAAGGAAGG + Intronic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878735 7:44306922-44306944 GGGTGTGAGCAGGAAGAGAAGGG + Intronic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878757 7:44307002-44307024 GGGTGTGAGCAGGAAGAAGAGGG + Intronic
1023878776 7:44307062-44307084 GGGTCTGAGCAGGGGGAGGAGGG + Intronic
1023878793 7:44307119-44307141 GGGTGTGAGCAGGGGGAGGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878826 7:44307256-44307278 GGGTGTGAGCAAGGGGAGGAGGG + Intronic
1023878835 7:44307296-44307318 GGGTGTGAGCAGGCGGAGGAGGG + Intronic
1023878852 7:44307356-44307378 AGTTGTCAGCAGGGGGAGGAGGG + Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1023878869 7:44307416-44307438 GGGTGTGATCAGGGGGAGGAGGG + Intronic
1023879318 7:44309391-44309413 CTGAGCCAGCAGGAGCAGGAGGG + Intronic
1024014953 7:45305230-45305252 GTGAGTGAGCAGGATGTGGAAGG + Intergenic
1026523928 7:71138421-71138443 GTAGGTGAGGAGGAGGAGGAAGG + Intronic
1026789873 7:73324603-73324625 GTGTGCCGGCAGGCGGTGGACGG - Exonic
1026934025 7:74241656-74241678 CTGTGTCAGAAAGAGAAGGATGG + Intronic
1029012042 7:97272475-97272497 GGGTGTCAACAGGAGGCTGACGG + Intergenic
1029262776 7:99314625-99314647 GTGGGAGAGCAGGAGGAGGTAGG + Intergenic
1030014619 7:105206205-105206227 GTGTGTGTGCTGGGGGAGGAGGG + Intronic
1030052009 7:105546316-105546338 GTCTGTCAGGAGGAGTAGGAAGG + Intronic
1032438126 7:131919251-131919273 GTCTGTCTGCATGAGAAGGATGG + Intergenic
1032505426 7:132430934-132430956 GTGGGCCAGCGGGAGGAGGTGGG + Intronic
1032838336 7:135694092-135694114 GTGTTTCTGCTGGAGAAGGAGGG + Intronic
1033637648 7:143226871-143226893 GTATGGCAGCAGTAGCAGGAGGG + Intergenic
1034536294 7:151727926-151727948 GCATGACTGCAGGAGGAGGAAGG - Intronic
1034564028 7:151899332-151899354 GTGTGGCATCAGGAAGCGGAGGG - Intergenic
1034597332 7:152210099-152210121 GTCTGGCAGCGGGAGCAGGATGG - Intronic
1034672867 7:152871079-152871101 GGGTCTCTGCAGGAGGAGGGAGG + Intergenic
1034886941 7:154805347-154805369 GTGGGTCAGCACGAGGAGGCCGG + Intronic
1035141462 7:156766698-156766720 GTGGGCAAGCAGGAGGAGCAGGG + Intronic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035238086 7:157513189-157513211 CTGTGTCATCAGGCTGAGGAGGG + Intergenic
1035259514 7:157652693-157652715 GGGTGTCACCAGGAAGAGGCTGG - Intronic
1036066356 8:5385337-5385359 GTGTGAGTGCTGGAGGAGGAGGG - Intergenic
1037801751 8:22039823-22039845 GTTTTTCAGCAGGAAGAGGGTGG + Intergenic
1037908095 8:22727298-22727320 CTCTCTCTGCAGGAGGAGGATGG + Intronic
1038214737 8:25551149-25551171 CTGTGACAGCAGTAGGAGGTGGG - Intergenic
1039097952 8:33907205-33907227 ACATGGCAGCAGGAGGAGGAGGG - Intergenic
1039195352 8:35024898-35024920 GTGTGCCAGGTGGAGGAGGTTGG - Intergenic
1039213325 8:35239749-35239771 AGGTATCAGAAGGAGGAGGAAGG - Intronic
1039339467 8:36631072-36631094 GTATTTCAACAGGAGGATGATGG - Intergenic
1039347047 8:36716668-36716690 GTGATTCAGGAGGAGGAGGAAGG - Intergenic
1039410626 8:37352286-37352308 ATGTGGCTCCAGGAGGAGGAGGG + Intergenic
1040443900 8:47473804-47473826 GTGAGGAACCAGGAGGAGGATGG + Intronic
1040493529 8:47946613-47946635 GAGTGTGAGCAAGATGAGGAGGG - Intronic
1041021650 8:53644085-53644107 CTGTCTCAGCAGGTGAAGGAAGG - Intergenic
1042194587 8:66221486-66221508 CCCTGTCAGCAGGAGGAGGTAGG - Intergenic
1042488835 8:69376521-69376543 GTGAGACAGCATGAAGAGGATGG - Intergenic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1043245903 8:78000727-78000749 GTGTGTCACCATGCGGTGGAAGG + Intergenic
1043375226 8:79641589-79641611 GTGTGTGAGAGGGAGGAGCAGGG - Intronic
1044470811 8:92564596-92564618 GTGTGTGAGCAGGACCATGAAGG + Intergenic
1044794685 8:95885011-95885033 GTCTGTGACCAGGAAGAGGATGG - Intergenic
1045334357 8:101185554-101185576 GTGTGTCAATAGCAGGAAGAAGG - Intronic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1046131781 8:109975062-109975084 GGGTGTGAGCAGGTGGGGGAGGG + Exonic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1048000733 8:130377617-130377639 GCAGGTCAGCAGGAGAAGGAGGG - Intronic
1048173715 8:132132642-132132664 GTGTGTGTGCAGGTGGAGAAGGG + Intronic
1048679919 8:136829881-136829903 GGGTTTTAGCAGGAGGAGGAGGG + Intergenic
1049159404 8:141087634-141087656 GTGTGGCAGCAGGAGGTGGGTGG + Intergenic
1049215590 8:141406412-141406434 GGGTGGCAGCAGAAAGAGGACGG - Intronic
1049219799 8:141423999-141424021 GTGTGTGACCAGGATCAGGAAGG + Intronic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049410110 8:142470139-142470161 GTGGGGCAGCACGAGGTGGAGGG - Intronic
1049454842 8:142681594-142681616 GAGTGGCAGATGGAGGAGGATGG - Intronic
1049558182 8:143294084-143294106 GAGGGGCAGCAGGAGGAGGGGGG - Intronic
1049566991 8:143345472-143345494 GCGTGGCAGCAGGAGCTGGAGGG - Intronic
1049592682 8:143469691-143469713 GGGTGCCATCTGGAGGAGGAGGG + Intronic
1050090843 9:2015871-2015893 GGGTGGCCGCAGGAGGGGGAAGG + Intronic
1050176870 9:2877326-2877348 TTGTGTCAGAAGGTGGAGGGTGG + Intergenic
1050751054 9:8937702-8937724 TTTTGTAAGAAGGAGGAGGAAGG - Intronic
1051528792 9:18077077-18077099 GTCTGGGAGGAGGAGGAGGAGGG + Intergenic
1051979200 9:22993366-22993388 GTGTGAGAGAAGGAAGAGGAAGG + Intergenic
1054778062 9:69140463-69140485 GTGTGTCAGCAGGTGCAGCGTGG + Intronic
1056422892 9:86446874-86446896 GTGTGTATGAAGGAGAAGGATGG + Intergenic
1056564835 9:87761908-87761930 GTGTTTCAGGAGGAGGAGGTAGG + Intergenic
1056647791 9:88429919-88429941 GTAAGTCAAGAGGAGGAGGAAGG + Intronic
1056655576 9:88505989-88506011 CTAGGTCAGCAAGAGGAGGAGGG - Intergenic
1056684998 9:88752113-88752135 GAGTTCCAGCAGGAGGAGGTGGG - Intergenic
1056992843 9:91426525-91426547 GGTTCTCAGGAGGAGGAGGAAGG + Intergenic
1057007445 9:91573122-91573144 GTGAGACAGGAGAAGGAGGAAGG + Intronic
1057956797 9:99416237-99416259 GTGTGTCTGCAGGGGTTGGATGG - Intergenic
1059417374 9:114170238-114170260 GTGGGCCAGAAGGAAGAGGAAGG + Intronic
1059658347 9:116377141-116377163 GTGTGACTGCAGCAGGCGGATGG - Intronic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1060445208 9:123681091-123681113 GCGTCTGAGCAGGATGAGGAGGG + Intronic
1061670559 9:132185872-132185894 GAGTGGGAGGAGGAGGAGGAGGG + Intronic
1062068500 9:134541633-134541655 CTGTGTCATGAGGATGAGGAGGG + Intergenic
1062295564 9:135823706-135823728 GTGTGGCAGCAGGTGGAGTCAGG - Intronic
1062403878 9:136384352-136384374 GTGGGGCAGCAGGAGGAGCACGG + Intronic
1062672913 9:137722500-137722522 GGGAGTCTGCAGGAGAAGGAGGG + Intronic
1186410397 X:9341131-9341153 ATGTGTCTGTAGGAGGGGGAAGG - Intergenic
1187946601 X:24432231-24432253 ATGTGACAGCAGTGGGAGGAAGG + Intergenic
1187956690 X:24525520-24525542 TTGGGTCATGAGGAGGAGGAAGG + Intronic
1188003806 X:25004307-25004329 GGGTGTCAGGAGGAAGAGGTTGG + Exonic
1191119660 X:56890468-56890490 GAGTGTAAGCAGAAGCAGGATGG + Intergenic
1191851318 X:65588250-65588272 GGGTGGCGGCGGGAGGAGGAAGG + Intergenic
1192133140 X:68571696-68571718 GTGTGTGAGCAGGGAGGGGATGG + Intergenic
1192555218 X:72083915-72083937 GTGTGTGGGCAGGGGGAGTAAGG - Intergenic
1193851368 X:86541819-86541841 GTGTGTGTGCATGAGGAGGAAGG + Intronic
1194318474 X:92411949-92411971 GAGTGGGAGGAGGAGGAGGAGGG + Intronic
1195759403 X:108229764-108229786 GTGTGTCATAATGAGGAAGAAGG - Intronic
1197702528 X:129610078-129610100 GAATTTCAGCAGGAGTAGGAGGG - Intergenic
1198084455 X:133269111-133269133 GGCTGGGAGCAGGAGGAGGAGGG - Intergenic
1198098202 X:133400899-133400921 GTGTGTCTGCAGGGGGTGGGGGG + Intronic
1198393932 X:136204674-136204696 GTGTGTCAGCAGGAGGCAGAAGG + Intronic
1198542317 X:137652916-137652938 GTGTGTGTGTAGGAAGAGGAGGG + Intergenic
1200124399 X:153806444-153806466 GTGTATCCCCAGGAGGGGGATGG - Intronic
1200153928 X:153965270-153965292 GTGTGGCAGCAGGGGCAGGGAGG - Intronic
1201158563 Y:11152727-11152749 GTGTGTGAGCAGGAAGTGCAGGG - Intergenic
1202085426 Y:21131844-21131866 GTGTGGCTGGAGGAGGAGGGAGG + Intergenic