ID: 969501343

View in Genome Browser
Species Human (GRCh38)
Location 4:7555352-7555374
Sequence TCCAAAGACACCCCCAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969501339_969501343 6 Left 969501339 4:7555323-7555345 CCTGAGGGCACTTTCTGGCAGGG 0: 1
1: 0
2: 1
3: 17
4: 169
Right 969501343 4:7555352-7555374 TCCAAAGACACCCCCAGCCATGG 0: 1
1: 0
2: 2
3: 23
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969501343 Original CRISPR TCCAAAGACACCCCCAGCCA TGG Intronic
900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG + Intronic
900626964 1:3612737-3612759 TCCCAAGCCCCTCCCAGCCAGGG - Intergenic
900797917 1:4720504-4720526 GCCAAGGACACCTGCAGCCATGG - Intronic
902768734 1:18633444-18633466 CCCAAAGTCACCCCCACCCGGGG + Intronic
903694526 1:25197239-25197261 TGCAAAGCCACCCCGGGCCAGGG + Intergenic
904960379 1:34327992-34328014 TTCACAGACACTCCCAGCCTAGG - Intergenic
907007384 1:50928927-50928949 TCCAAAGAAATACCCAGGCATGG + Intronic
907020340 1:51060565-51060587 TGCACAGGCTCCCCCAGCCAGGG + Intergenic
907516493 1:54996515-54996537 TCCCATGACACCCCGAGGCAGGG - Intergenic
908942683 1:69454780-69454802 CCCTTAGGCACCCCCAGCCATGG + Intergenic
910262809 1:85308097-85308119 TCTTAAAACACCCCCTGCCAAGG + Intergenic
911793271 1:102045945-102045967 TCCATAAACATCCCAAGCCAAGG + Intergenic
913449778 1:118985369-118985391 CCTAAAAACACCCCCAGCCCTGG + Intronic
915003282 1:152613268-152613290 TCCCCAGACACCCCCAGCTGAGG - Intergenic
916043861 1:160983321-160983343 CCCAAAGACACCCACAACCCTGG + Intergenic
920123419 1:203675465-203675487 TCCAAAGAAATCCTCATCCAGGG - Intronic
921392730 1:214633189-214633211 TCCAAAGACACCGTCAACCAGGG - Intronic
921598952 1:217086998-217087020 TCCAATGACACACTCATCCAAGG + Intronic
921937528 1:220808616-220808638 TCCAGAAGCAACCCCAGCCATGG - Intronic
922683328 1:227618911-227618933 TCCTGAGGCCCCCCCAGCCATGG - Intronic
923714498 1:236413357-236413379 TCCAAAGAAACTCCCAGGAAAGG + Intronic
1062967762 10:1623157-1623179 TCCAATCCCACCCCCAGCCCTGG - Intronic
1063116358 10:3074585-3074607 TCCACAGACACATCCCGCCAAGG + Intronic
1063589256 10:7379800-7379822 TGCATGGACTCCCCCAGCCAAGG + Intronic
1065521668 10:26579686-26579708 ACCAAAGCCAGCCCCAGGCAGGG + Intergenic
1065522263 10:26584404-26584426 ACCAAAGCCAGCCCCAGTCAGGG + Intergenic
1065527836 10:26640709-26640731 ACCAAAGCCAGCCCCAGTCAGGG + Intergenic
1065528530 10:26646152-26646174 ACCAAAGTCAGCCCCAGTCAGGG + Intergenic
1065528742 10:26647962-26647984 ACCAAAGCCAGCCCCAGTCAGGG + Intergenic
1065558482 10:26939585-26939607 ACCAAAGCCAGCCCCAGTCAGGG - Intergenic
1065558708 10:26941415-26941437 ACCAAAGCCAGCCCCAGTCAGGG - Intergenic
1065559063 10:26944232-26944254 ACCAAAGCCAGCCCCAGGCAGGG - Intergenic
1065559349 10:26946438-26946460 ACCAAAGCCAGCCCCAGGCAGGG - Intergenic
1065733137 10:28727615-28727637 TCCTAAGGCTTCCCCAGCCATGG + Intergenic
1065857830 10:29844450-29844472 TCCACAGACAACACCAGGCAAGG + Intergenic
1066325504 10:34354070-34354092 TCCAGAGTCACCCTCAGACAAGG - Intronic
1067008408 10:42687734-42687756 TCCAAACAAAACCCCATCCATGG + Intergenic
1068567173 10:58589018-58589040 TCCAAGGACACCGGCAGCCAAGG + Intronic
1071898477 10:90091481-90091503 TCTAAAGCCAACCCAAGCCATGG - Intergenic
1072726103 10:97815195-97815217 TCCCAGGACACACCCTGCCAAGG - Intergenic
1074195794 10:111183651-111183673 TCCAAAGAAACCCAAAGTCAAGG + Intergenic
1074400493 10:113137891-113137913 TGCACACACACCCCCAGCAATGG + Intronic
1074818446 10:117162546-117162568 TCCTCAGACACCCCCAGCCCGGG - Intergenic
1075330434 10:121570113-121570135 ATCAAAGACAACCCCGGCCAGGG + Intronic
1075744071 10:124714364-124714386 TTCAACGACTCCCACAGCCAGGG + Intronic
1076267569 10:129120605-129120627 TCCAGAAACACCTCCAGCCCAGG + Intergenic
1076721560 10:132395609-132395631 TCCAAAGTCAGCCCCACCCCTGG + Intergenic
1077174416 11:1182163-1182185 TCCACGCACACCCCCAGCAATGG + Intronic
1077529759 11:3089731-3089753 TCCGATGACAACCCCAGCCGCGG + Intronic
1077725923 11:4675003-4675025 TCCAAAGTCACCTCCTGTCAGGG + Intergenic
1082749444 11:57000967-57000989 TCCAGAGACACCCCTAGCAGAGG - Intergenic
1083961216 11:66016036-66016058 CCCACTGTCACCCCCAGCCATGG + Intergenic
1084784470 11:71434194-71434216 CCCAAAAACAGCCCCAGCAAAGG + Intronic
1085018886 11:73192628-73192650 TCCTAAGAAGCCCCCAGCCAAGG + Intergenic
1089122345 11:116146235-116146257 CCCAAAGGCACCCCCAGCAAAGG + Intergenic
1089398722 11:118152514-118152536 TCCAAAGCCCACCCCATCCAAGG + Intronic
1091914919 12:4264525-4264547 TCCACAGATACACCCAACCACGG + Intergenic
1092311310 12:7357468-7357490 TCAGATGACACCCCCAACCATGG - Exonic
1097967429 12:65595887-65595909 TCCAGAGACACCTGCAGCCTTGG + Intergenic
1098456652 12:70681751-70681773 TCCATAGAAAAGCCCAGCCAGGG - Intronic
1102723363 12:115036766-115036788 TCCTGAGACCTCCCCAGCCATGG - Intergenic
1103265040 12:119622663-119622685 GCCCGAGACCCCCCCAGCCATGG + Intronic
1103913458 12:124364145-124364167 CCCAAAGACATCTCCAGGCAAGG + Intronic
1105318616 13:19293460-19293482 TCCAAAGATACCCAGAGCTACGG - Intergenic
1108847875 13:54697678-54697700 TCCACAGGTACCTCCAGCCAGGG - Intergenic
1110837473 13:80101126-80101148 TGGAAAGAGACCCCAAGCCATGG - Intergenic
1112091593 13:96090032-96090054 GCCAAAGCCTCCCCCAGCCCCGG - Intergenic
1112149052 13:96736286-96736308 GGCAAAGACACCCCAAGCAAAGG + Intronic
1113292835 13:108925095-108925117 TCCAGAGGCACCCAGAGCCAAGG + Intronic
1115951047 14:38721919-38721941 TCCAGACACACTCTCAGCCATGG + Intergenic
1118444064 14:65836068-65836090 TCCAAATCCACCACCAGCCTTGG + Intergenic
1119852894 14:77878659-77878681 GCCAGAGACACCCAGAGCCAGGG - Intronic
1121052342 14:90827775-90827797 TCCACTGACACCCCCAGAGAGGG - Intergenic
1121664591 14:95662389-95662411 TCTAATGACACTCCCAACCAAGG + Intergenic
1122179457 14:99944623-99944645 AGCAAAGACAGCCCCTGCCAGGG - Intergenic
1122261297 14:100524599-100524621 TCCAAAGCAACCCTCAACCAGGG - Intronic
1122620025 14:103050877-103050899 TCCAAAGACTCTCCAATCCAAGG + Intronic
1122909239 14:104818906-104818928 TCCAAAGAGAGACCCAACCAAGG + Intergenic
1125922690 15:43534942-43534964 TCCACAGAGACCCCCTGGCATGG + Exonic
1126463283 15:48936600-48936622 TCCTGAGACCTCCCCAGCCATGG + Intronic
1127499755 15:59544916-59544938 CCCAAATATACCCCCAACCAAGG - Intergenic
1128328807 15:66742460-66742482 ACCAGACACACCCTCAGCCAGGG - Intronic
1132502086 16:288943-288965 TCCAAAGGGACCCCCGTCCAGGG - Intronic
1135422767 16:22316026-22316048 TCCAAAGACACCATGGGCCAGGG + Intronic
1136020016 16:27434300-27434322 TCCCAAGCCACCCCCCACCAAGG + Intronic
1136418661 16:30118550-30118572 TCCGCAGACCCCCCCAGGCAGGG + Intronic
1137488260 16:48909504-48909526 CCCAAAGACATGACCAGCCAGGG - Intergenic
1138583088 16:57954272-57954294 TCCAAAGGCCTGCCCAGCCAGGG + Intronic
1139621773 16:68150947-68150969 TCCTGAGGCCCCCCCAGCCATGG + Intronic
1140510192 16:75502005-75502027 TTCACAGACATCCTCAGCCACGG + Intergenic
1140885639 16:79240134-79240156 TCCACTTACACCCCCCGCCATGG - Intergenic
1143542857 17:7579956-7579978 ACCACAGGCACCACCAGCCACGG + Exonic
1145088053 17:19960729-19960751 TCATAAGAAACCACCAGCCAGGG + Intronic
1146886307 17:36473214-36473236 TCCAGAGGCACCTCCAGCAAGGG - Intergenic
1147184144 17:38704812-38704834 TCCAAAAAGACCCCCAGACACGG + Intergenic
1147491074 17:40866902-40866924 TCCAAAGCTACCTCCACCCAGGG + Exonic
1147758396 17:42782551-42782573 TCCAAGGACACACCCAACCTGGG - Intronic
1151164504 17:72192301-72192323 TCCAAAAAAACCACCAGCTAAGG - Intergenic
1151180206 17:72321846-72321868 TCCAAAGAGACTACCAGGCACGG - Intergenic
1151362470 17:73596820-73596842 TGCTCAGACACCGCCAGCCATGG - Intronic
1151388990 17:73772932-73772954 TCCAAAGGCACCCTCATCCTTGG + Intergenic
1151559789 17:74864110-74864132 CCCAAAGACACCCCCTTCCCAGG - Intronic
1153707479 18:7760897-7760919 TCCAAAGCCACACACAGGCAAGG + Intronic
1153765355 18:8369467-8369489 TTCAAAGACACTCCTAGCCTTGG + Intronic
1154023056 18:10682275-10682297 TGCAGAGATACCCTCAGCCACGG - Exonic
1157241122 18:46010298-46010320 TCCAAAGGGACCCCCGGGCAGGG + Intronic
1158677057 18:59529583-59529605 TCCCACCCCACCCCCAGCCAAGG - Intronic
1159088622 18:63821921-63821943 TCCAAAAAGCCCCACAGCCAAGG - Intergenic
1160185631 18:76674433-76674455 TCCTGAGACCTCCCCAGCCATGG + Intergenic
1160333768 18:78018505-78018527 TCCAAGGACAGCCCCAGCGCCGG - Intergenic
1160979383 19:1809952-1809974 GCCACCCACACCCCCAGCCAGGG + Intronic
1161572398 19:5037765-5037787 GCCACAGACATCCCCAGACATGG + Intronic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
1163189220 19:15664154-15664176 TGCAGATACTCCCCCAGCCAGGG - Intergenic
1163252787 19:16136193-16136215 TCAAAAGTCACCCCCTGCCACGG + Intronic
1164286459 19:23821638-23821660 AACAAAGAGGCCCCCAGCCAAGG - Intronic
1166302307 19:41918150-41918172 CACAAAGGCACCCCCAACCAGGG - Intronic
1166322192 19:42025378-42025400 ACCTCAGACACCCCCAGCCATGG - Intronic
1166366710 19:42281626-42281648 TCCTAATCCACCCCCACCCAGGG + Intronic
1167829506 19:52008067-52008089 TCCACGAACACGCCCAGCCACGG + Intronic
925071981 2:976894-976916 TCCAGAGGCAGCCTCAGCCAAGG + Intronic
925705948 2:6684833-6684855 TCTAAAGGCAGCCCCAGGCAGGG - Intergenic
925893107 2:8451977-8451999 TCCAAGCACAGCCTCAGCCATGG - Intergenic
926208830 2:10853783-10853805 CCCACAGACACCCACAGCCCTGG - Intronic
926626630 2:15095974-15095996 GCCAGAGCCACCCCCAGCCCAGG + Intergenic
931690963 2:64834492-64834514 TCCCATGAAATCCCCAGCCATGG - Intergenic
932751156 2:74372532-74372554 TCCTCAGACATCCCCACCCAAGG + Intronic
934026929 2:88008942-88008964 TCAAAAGATACCACCACCCAGGG - Intergenic
938471128 2:131563067-131563089 TTCAAAGCCAAGCCCAGCCATGG - Intergenic
941728754 2:168892240-168892262 TCCAGAAACACCTCCAGCCTGGG - Intronic
942299355 2:174547175-174547197 TCAACAAACAACCCCAGCCATGG + Intergenic
945065532 2:205944752-205944774 CTCACAGACACCCACAGCCAAGG + Intergenic
946874642 2:224115281-224115303 TCCTGAGACCTCCCCAGCCATGG + Intergenic
947603779 2:231470534-231470556 TCCAAAGACACTCGAAGCCCAGG - Intronic
947958129 2:234212691-234212713 TCCGAAGTCACGCCCACCCAGGG + Intergenic
1170963128 20:21043154-21043176 TCCAGAGGCCTCCCCAGCCATGG + Intergenic
1171790046 20:29514898-29514920 ACCAAAGCCAGCCCCAGGCAGGG + Intergenic
1173664940 20:44756798-44756820 TCCAGAGACACCCCCCGCCAGGG + Intronic
1174270846 20:49367283-49367305 TCCAAAAACTCCCCCAGGCGTGG + Exonic
1175130160 20:56782642-56782664 CCCAAGGCCATCCCCAGCCAAGG - Intergenic
1175520765 20:59601453-59601475 TCCAAATCCACCCCTTGCCAGGG + Intronic
1175786271 20:61713597-61713619 GCCAAAGACTCCCCCAGAAAAGG + Intronic
1175998334 20:62821205-62821227 TCCATACTCACCCCCAGCCCGGG - Exonic
1176012098 20:62903453-62903475 TCCAAACTCACCCCCTACCAGGG + Intronic
1178834321 21:36083673-36083695 TCCAAAGACCAGCCCTGCCAGGG - Intergenic
1179777643 21:43676750-43676772 TTCGAAGACACCCCGAGCTATGG - Exonic
1180223645 21:46376054-46376076 TCCACAGAGAACCCCAGCCAGGG - Intronic
1180622050 22:17168864-17168886 TCCAAATACAGCTCCTGCCATGG + Intergenic
1181161558 22:20962924-20962946 TCCCTAGGCACCCCCAGCCCTGG - Intergenic
1181430130 22:22875060-22875082 ACAAAAGACACCCCTAGACAGGG + Intronic
1181823025 22:25490504-25490526 TCCACCCCCACCCCCAGCCAAGG - Intergenic
1182097223 22:27634307-27634329 CACAAAGACACACCCAGACACGG - Intergenic
1182537944 22:31019915-31019937 ACCACAGACAGCCCCAACCAGGG - Intergenic
1182686040 22:32122297-32122319 CCCCAACCCACCCCCAGCCACGG - Intergenic
1183623082 22:38986161-38986183 CCCTGGGACACCCCCAGCCATGG - Intronic
1183633093 22:39045290-39045312 CCCTGGGACACCCCCAGCCATGG - Intronic
1185156403 22:49195842-49195864 CCCATAGCCACCCCCAGACAAGG - Intergenic
950338329 3:12218617-12218639 TCCACATCCAACCCCAGCCATGG - Intergenic
950350842 3:12350498-12350520 TTCAAAGACGCCCCCACACAGGG - Intronic
952882687 3:37994513-37994535 TCCCAAGACTGCCCCAGCCAAGG - Intronic
953909596 3:46884953-46884975 ACCAAAGACAGCCCCATACAAGG + Intronic
958609718 3:96410000-96410022 TCCTAAGGCCTCCCCAGCCATGG - Intergenic
961324511 3:126102335-126102357 TGCCAGGCCACCCCCAGCCAAGG + Intergenic
962367993 3:134798310-134798332 CCCTAAGACACCCCCTGCCTGGG + Intronic
962797258 3:138860074-138860096 TCCAAAGATACGCACAGCTACGG + Intergenic
963250556 3:143099232-143099254 TCCAAAGAAAGCCTCATCCAGGG - Intergenic
964689863 3:159438252-159438274 TCCAAAGAACCCCTCAGGCATGG - Intronic
966415099 3:179681169-179681191 TCCACAGACACCCACAGCGGTGG - Intronic
966526142 3:180921290-180921312 TCCACACACACCCCCACCCTGGG - Intronic
966767907 3:183479055-183479077 GCCATAGACACCCACAGCCTGGG - Intergenic
968607842 4:1543888-1543910 GCCTGAGACACCCACAGCCAGGG + Intergenic
969431102 4:7154745-7154767 TCCAAAGACCCCCCAAGCCCTGG - Intergenic
969501343 4:7555352-7555374 TCCAAAGACACCCCCAGCCATGG + Intronic
970487159 4:16536248-16536270 ACCACAGTCACACCCAGCCAGGG - Intronic
973825063 4:54696523-54696545 TTCAAAGACAGCCCCAGTCCAGG - Intronic
974410754 4:61538837-61538859 TCCCCAGCCACCCCCAGTCAGGG - Intronic
974606840 4:64163748-64163770 TTCAAAGACACCTCCAGAAAAGG - Intergenic
976049718 4:80997693-80997715 TCCAAAGACCCCCCCAGGGTCGG + Intergenic
977675863 4:99746138-99746160 TCCAAAGAGAAACCTAGCCATGG + Intergenic
979302099 4:119098310-119098332 CCCAAAGGCACACCCAACCATGG - Intergenic
979348347 4:119615888-119615910 TTCAAAGAAAGCCACAGCCATGG + Intronic
979939077 4:126737385-126737407 TACAAGGACACCCCCAGCCTGGG - Intergenic
981542387 4:145859464-145859486 TCCAACGACTCCCACAGGCATGG - Intronic
986963622 5:13244458-13244480 GCCCAAGCCTCCCCCAGCCATGG + Intergenic
991218536 5:64184717-64184739 TCCAAAGGCATCACCAGCCCAGG - Intronic
992139307 5:73780011-73780033 GCCCAAGACACCCCCAGCACAGG - Intronic
995225723 5:109698614-109698636 TCCAAAGGCACCACCTGCAAAGG - Intronic
997366853 5:133331195-133331217 TCCCAAGACACCCCCAGGCAGGG + Intronic
997466702 5:134092962-134092984 GCCAAAGACACCTGCAGCAAAGG + Intergenic
997985977 5:138501909-138501931 CCCAAAGACATGCCCAGCCTAGG - Intergenic
998936618 5:147235781-147235803 TCCAAAGACAGCCACAATCACGG - Intronic
1001308075 5:170590263-170590285 GCCAAAGATACTTCCAGCCAGGG + Intronic
1001934184 5:175693000-175693022 TGCAGAGAGAGCCCCAGCCATGG + Intergenic
1002704533 5:181151312-181151334 TCCCAACACACTCCCAGCAAGGG - Intergenic
1003374653 6:5564732-5564754 TCTAAAGCCAAGCCCAGCCATGG + Intronic
1003427945 6:6009656-6009678 TCCAAAGCCACCTCCAACCATGG - Intergenic
1005322366 6:24667583-24667605 TCCAAAGTCCCTCCCAGCCTTGG - Intronic
1006434688 6:34020073-34020095 CCCAAAGTCACACCCACCCAAGG + Intronic
1006439363 6:34043589-34043611 GCCAAGGACGCACCCAGCCATGG + Intronic
1007664174 6:43504945-43504967 CACAAAGACATCCTCAGCCAAGG - Exonic
1009449465 6:63784512-63784534 TCCTGAGACCTCCCCAGCCATGG - Intronic
1011087280 6:83556191-83556213 TCCCAAGAAACCTCCAGCAAAGG - Exonic
1011172155 6:84517069-84517091 TACAAATTCACCCCCAGCCATGG - Intergenic
1014198923 6:118587601-118587623 TCCAAACTCCCCCCCACCCATGG + Intronic
1017887784 6:158613432-158613454 TCCAAAGCCAAACCCAGCCATGG + Intronic
1018044360 6:159952684-159952706 TCCAAAGCCGCCCCCAGGCCAGG - Intergenic
1018078375 6:160236845-160236867 TTCAAAGCCAAGCCCAGCCATGG - Intronic
1019496078 7:1341258-1341280 CCCAAAGAAGTCCCCAGCCATGG - Intergenic
1020107587 7:5429278-5429300 TCCAAGGACGCCCTCAGCCAAGG + Intergenic
1020268514 7:6577724-6577746 CCCGAAGCCACCCCCATCCAAGG - Intronic
1021840622 7:24718975-24718997 CCCAAAGAGGCCCCCAACCAAGG + Intronic
1024491369 7:49989382-49989404 TCTAAAGCCAAGCCCAGCCATGG - Intronic
1025157673 7:56623947-56623969 TCTAAAGTCAAGCCCAGCCAGGG - Intergenic
1025746267 7:64245714-64245736 TCCAAAGACAGGGCCAGGCATGG + Intronic
1026909739 7:74084758-74084780 TTCAAGGACTCCCCCAGCCTAGG + Intronic
1031488550 7:122359800-122359822 TCCAAAGAAACCCCATGCAAAGG + Intronic
1034427835 7:151023918-151023940 TCCCAAGACTCACCCATCCACGG - Exonic
1034445112 7:151110137-151110159 TCAAAAGACTGGCCCAGCCAGGG + Intronic
1035368714 7:158364801-158364823 TCTAAATACACACCCTGCCAAGG + Intronic
1035904891 8:3499291-3499313 TCCACAAACACCTGCAGCCAAGG - Intronic
1036619393 8:10414484-10414506 TCCTGAGACACCCCCAGCCCTGG + Intronic
1037966049 8:23134916-23134938 AACAAAGACAACCCCTGCCATGG + Intergenic
1038248287 8:25879533-25879555 TTCAAAGACACCCCTGGACATGG - Intronic
1038901207 8:31846019-31846041 TCCAAAGACATCCCCATGAAAGG + Intronic
1040465351 8:47689733-47689755 TCCCATGCCACCCCCAGTCACGG - Intronic
1041066543 8:54087571-54087593 TGCAAAGACACCCCACGCAATGG + Intronic
1044273411 8:90273074-90273096 TCCACTGACACCCCCAGAAAGGG + Intergenic
1045271989 8:100670044-100670066 CCCAAAGTCACACACAGCCAGGG + Intergenic
1045664140 8:104467327-104467349 TACAAACACACCCCCAACCAAGG - Intergenic
1048056825 8:130874859-130874881 CCCACCCACACCCCCAGCCATGG + Intronic
1049450556 8:142659260-142659282 TCCTAAGCCACCCCAAGCCAAGG - Intronic
1049615146 8:143572694-143572716 GCCCCACACACCCCCAGCCATGG + Exonic
1051962193 9:22780273-22780295 CCCAAAGAGAGCCCTAGCCAAGG - Intergenic
1053002080 9:34582623-34582645 TGCAGAGACACCACCACCCAGGG + Intronic
1055993674 9:82134293-82134315 GCCACAGACACAACCAGCCATGG - Intergenic
1056367977 9:85925007-85925029 TCCAAAGACAACCCAAGGAATGG - Intergenic
1056690321 9:88802784-88802806 TCCAAATGAACTCCCAGCCATGG + Intergenic
1056938508 9:90936282-90936304 ACCAAAGGCATCCTCAGCCAAGG - Intergenic
1059529588 9:115023608-115023630 TCCAAAGATGCCCCAGGCCAGGG + Intronic
1059686264 9:116639629-116639651 ATCAAAGACTGCCCCAGCCAGGG - Intronic
1060343060 9:122793588-122793610 TCCCAAGACACCCTCAGTCCTGG + Intergenic
1060580429 9:124740853-124740875 CCCAAAGATAACCCCAGCCCTGG + Intronic
1061393012 9:130328034-130328056 GCCACAGAACCCCCCAGCCAGGG - Intronic
1061940946 9:133883524-133883546 TCCCAAGTCATCCCCAGCCACGG + Intronic
1061940956 9:133883570-133883592 TCCCAAGTCATCCCCAGCCACGG + Intronic
1062026560 9:134343322-134343344 TTCAGAGGCAACCCCAGCCAGGG - Intronic
1062424539 9:136500025-136500047 TGCAAAGGCAGCCCCTGCCAGGG + Intronic
1186274393 X:7923825-7923847 TCCACAGACAGCCCCTGCCCCGG + Intronic
1186966643 X:14794149-14794171 GTCAAAGACAGCCCCAGCCAAGG + Intergenic
1187095214 X:16140803-16140825 TCCAAACAGACCCCGAGGCAAGG - Intronic
1187698759 X:21945112-21945134 TCAAAAGATACGCCCAGCCCAGG - Intronic
1188101076 X:26088816-26088838 TCCAAACACACCCCTAGGAAAGG + Intergenic
1190106536 X:47564929-47564951 GTCAAGGACACCCCCAACCATGG - Intronic
1190214142 X:48468892-48468914 TGCAGAGACACCCCCACCCCAGG - Intronic
1193647800 X:84089690-84089712 GACAAAGGAACCCCCAGCCAAGG - Intronic
1196439420 X:115704638-115704660 TTAAAAGACAGCCCCAGCCTGGG + Intergenic
1199257361 X:145732141-145732163 TACAAATACACACCCTGCCACGG + Intergenic
1200039577 X:153355600-153355622 TCCAAAGACATCTTCATCCAGGG - Intronic
1200860075 Y:7981905-7981927 TCTAAAGTCAACCCCAGCCATGG - Intergenic
1202259177 Y:22951691-22951713 TCTAAAGTCAAGCCCAGCCACGG + Intergenic
1202412163 Y:24585435-24585457 TCTAAAGTCAAGCCCAGCCACGG + Intergenic
1202458617 Y:25084633-25084655 TCTAAAGTCAAGCCCAGCCACGG - Intergenic