ID: 969506454

View in Genome Browser
Species Human (GRCh38)
Location 4:7591184-7591206
Sequence GAGAAGAAGGAGAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2686
Summary {0: 1, 1: 0, 2: 22, 3: 323, 4: 2340}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969506454 Original CRISPR GAGAAGAAGGAGAAGGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr