ID: 969506631

View in Genome Browser
Species Human (GRCh38)
Location 4:7591998-7592020
Sequence AAAAAAATCCCCCTTTAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 475}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969506626_969506631 16 Left 969506626 4:7591959-7591981 CCGACCAACAGAAAATCCCAGCA 0: 1
1: 0
2: 1
3: 41
4: 310
Right 969506631 4:7591998-7592020 AAAAAAATCCCCCTTTAAATTGG 0: 1
1: 0
2: 1
3: 53
4: 475
969506628_969506631 12 Left 969506628 4:7591963-7591985 CCAACAGAAAATCCCAGCAGGTT 0: 1
1: 0
2: 4
3: 42
4: 388
Right 969506631 4:7591998-7592020 AAAAAAATCCCCCTTTAAATTGG 0: 1
1: 0
2: 1
3: 53
4: 475
969506625_969506631 25 Left 969506625 4:7591950-7591972 CCATTTCAGCCGACCAACAGAAA 0: 1
1: 0
2: 0
3: 5
4: 86
Right 969506631 4:7591998-7592020 AAAAAAATCCCCCTTTAAATTGG 0: 1
1: 0
2: 1
3: 53
4: 475
969506629_969506631 0 Left 969506629 4:7591975-7591997 CCCAGCAGGTTGCAGATGAGAAA 0: 1
1: 0
2: 2
3: 33
4: 255
Right 969506631 4:7591998-7592020 AAAAAAATCCCCCTTTAAATTGG 0: 1
1: 0
2: 1
3: 53
4: 475
969506630_969506631 -1 Left 969506630 4:7591976-7591998 CCAGCAGGTTGCAGATGAGAAAA 0: 1
1: 0
2: 7
3: 88
4: 636
Right 969506631 4:7591998-7592020 AAAAAAATCCCCCTTTAAATTGG 0: 1
1: 0
2: 1
3: 53
4: 475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969506631 Original CRISPR AAAAAAATCCCCCTTTAAAT TGG Intronic
901723902 1:11224464-11224486 ACAAAAATCTCCCTTTACATTGG - Intronic
902489220 1:16768766-16768788 AAAAAATTCCCAATATAAATGGG - Intronic
903075270 1:20759865-20759887 AAAAAAATCGGTCTTTAAAATGG - Intronic
903418952 1:23204589-23204611 AAAAAAATACTCCTTTTGATGGG - Intergenic
904149003 1:28420955-28420977 AACAAACTCCCCTTTTTAATGGG + Intronic
904780544 1:32943622-32943644 AAAGAAATTCCCATTTAAATGGG + Intronic
904821260 1:33246187-33246209 AATCAAATCCCCCTTTGAGTAGG - Intergenic
906027608 1:42687278-42687300 AGAAAAATCACCCTTTAAAAAGG - Intronic
906849960 1:49237276-49237298 AAAAAAACCCCCCAAAAAATGGG + Intronic
907311225 1:53540241-53540263 AAAAGAATCCCCCAGCAAATGGG - Intronic
908590657 1:65629489-65629511 AAAAAATTCCCCTTTGACATCGG - Intronic
908963051 1:69725309-69725331 AAGAAAATCCACGTTTAAGTGGG + Intronic
909199717 1:72675447-72675469 AAAAAAATCCTCATTTTAATAGG - Intergenic
909390405 1:75113697-75113719 AAAAAAAAGCCCCTTTACAATGG + Intergenic
909517221 1:76524947-76524969 AAAAAAATCCCACATGAAAAGGG + Intronic
910106511 1:83636714-83636736 AAGAAAATTCTCCATTAAATAGG - Intergenic
910253676 1:85224677-85224699 AAAAAAAACCTCCTTAAAATTGG - Intergenic
910897280 1:92081959-92081981 AAAAAAAAATCCCTTTAATTTGG + Intronic
911281437 1:95934330-95934352 AAAAAAATCCCCCTTTTCCCTGG - Intergenic
911467934 1:98278078-98278100 AACAAAATCCCACTATTAATAGG - Intergenic
912195890 1:107396444-107396466 AAAAAAATCCCTCTTTGTAAGGG + Intronic
912260002 1:108101431-108101453 AAAAAGATCCCCCTTAAGATGGG + Intergenic
913275658 1:117135570-117135592 ATTAAAATCACCCTTAAAATGGG - Intergenic
913673421 1:121118889-121118911 AAAAAAATCTCTGTTAAAATGGG - Intergenic
914025199 1:143906245-143906267 AAAAAAATCTCTGTTAAAATGGG - Intergenic
914402255 1:147333031-147333053 AAAAAAAACCCACTATACATAGG + Intergenic
914663636 1:149813960-149813982 AAAAAAATCTCTGTTAAAATGGG - Intergenic
915711121 1:157898943-157898965 AAAACAATCCAACTTAAAATTGG - Intergenic
915742185 1:158127108-158127130 AAAAAACTGCCTCTTTAATTTGG + Intergenic
915845890 1:159264609-159264631 AAAAAAATCCAATTTTAAAATGG - Intergenic
916812673 1:168319168-168319190 AATGAATTTCCCCTTTAAATAGG - Intergenic
917091517 1:171358252-171358274 AAAAAAATATACCTTTAGATAGG - Intergenic
917423646 1:174891112-174891134 AAAAGTTTCCACCTTTAAATAGG - Intronic
917810203 1:178651113-178651135 AAAAAATTCCACATTTAAAGGGG - Intergenic
918605856 1:186424979-186425001 AAAAAAAACCCCTTTTTGATGGG + Intergenic
919584002 1:199413415-199413437 AAAAAAATTAACATTTAAATTGG + Intergenic
920726527 1:208440568-208440590 AAAAAAATCCCATCTAAAATTGG - Intergenic
921069288 1:211645303-211645325 AAAAAAATCCCTATTAAATTTGG + Intergenic
921828303 1:219699098-219699120 AAAAAAATTCACCCTCAAATTGG + Intronic
923330463 1:232918840-232918862 CAAAAAATTCACATTTAAATAGG + Intergenic
923531217 1:234813759-234813781 AAAAAATTCCCAATATAAATGGG + Intergenic
923951439 1:238959940-238959962 AAAAAAATACCCTTTGAATTGGG + Intergenic
924492704 1:244554705-244554727 AAAAAAATCCCATTTAAAAGTGG - Intronic
1063234208 10:4095836-4095858 TAAGAAATCTCCCTATAAATAGG + Intergenic
1064280689 10:13948633-13948655 AAAAAAATCCTCTTTTCCATGGG - Intronic
1065277838 10:24103959-24103981 AAAAATATCACCCATTATATTGG - Intronic
1065990891 10:31009088-31009110 ACAAAAATACCCCATTAAAATGG - Intronic
1066084892 10:31966655-31966677 AAAAAACACCCCCTTTGAAATGG - Intergenic
1066125162 10:32334467-32334489 AAAAAAATCACACTTTATACAGG + Intronic
1066318701 10:34277477-34277499 ATTAAAATCCCACTTAAAATTGG - Intronic
1066450027 10:35520595-35520617 AAAATAATCCACCTGTAAAGTGG + Intronic
1067677335 10:48393631-48393653 AAAAAAATCTTACTTTACATGGG - Intronic
1068098997 10:52528634-52528656 AAAAAAACCCTCCTAGAAATTGG - Intergenic
1068114197 10:52719011-52719033 AAAAAATTACCCCATTAAAAAGG + Intergenic
1068318186 10:55374580-55374602 AAAAAAGTGCAGCTTTAAATCGG + Intronic
1068401500 10:56533920-56533942 AATAAAAGCCCCTTATAAATTGG - Intergenic
1068565683 10:58572159-58572181 AAAAAAATCCCACTTAAAAGTGG - Intronic
1068643422 10:59437114-59437136 ATAAAAATCCCCCATTGAACTGG - Intergenic
1069088665 10:64172918-64172940 AAAAAAAAAGACCTTTAAATTGG - Intergenic
1070063685 10:73012350-73012372 AAACATATCCCACTTAAAATTGG + Intronic
1070079735 10:73173856-73173878 AAAAAAATCTGCATATAAATGGG + Intronic
1071877408 10:89856127-89856149 AAAAAAAGCCTCCTTTTTATTGG + Intergenic
1071951566 10:90709097-90709119 ACAATAATTCCTCTTTAAATGGG + Intergenic
1072045886 10:91654538-91654560 ACAAAAATCTTCCTTTTAATTGG + Intergenic
1072080825 10:92029592-92029614 AAAAAAACCACCCTCTAAATAGG - Exonic
1073201936 10:101742413-101742435 ACAAAAAACCCACCTTAAATGGG + Intergenic
1073713310 10:106071251-106071273 AATAAAATCCACCTTGAACTTGG - Intergenic
1074743930 10:116512228-116512250 AAAAAAAACCCCATTTCAACAGG + Intergenic
1074871273 10:117577966-117577988 AAAAAAATCCACTCTTAACTGGG + Intergenic
1075043042 10:119123773-119123795 ACAAAAAACCCTCTTTAAAGTGG - Intronic
1075268516 10:121027222-121027244 AAAAAAATCTCACTTGAATTTGG + Intergenic
1077202006 11:1313210-1313232 CAAAAAATCCCACTTAAAAGTGG - Intergenic
1078701019 11:13682918-13682940 AAATAAATGTCCCTTTAAAAGGG - Intronic
1080714149 11:34782052-34782074 AAAAAAATCCAATTTTAAAATGG - Intergenic
1080747650 11:35123064-35123086 AAAAAAATCTCAATTCAAATTGG - Intergenic
1080944984 11:36961664-36961686 AAAAAAATCCCACTTACAATAGG + Intergenic
1081034840 11:38131067-38131089 AAATATATCCCCCTTTACTTTGG - Intergenic
1081161153 11:39750478-39750500 AAAAACAACCCTGTTTAAATTGG - Intergenic
1081318049 11:41655772-41655794 AAAAATACCCCCTTGTAAATTGG + Intergenic
1082967720 11:58984777-58984799 AAAAAAAACCCCATCAAAATTGG - Intronic
1084985878 11:72870919-72870941 AAAGAATTCCCCCTTTGACTTGG + Intronic
1085109129 11:73872266-73872288 TAATAACTCCCCCTTTAAGTAGG - Intergenic
1085673102 11:78487705-78487727 AGAAAAATGACCCTTTACATTGG + Intronic
1086088495 11:82981389-82981411 CCAAAAATCCACCTTTAAAAAGG + Exonic
1086599037 11:88609567-88609589 AAAAACAACCCCATTTAAAATGG - Intronic
1087142107 11:94774771-94774793 AAAACATAGCCCCTTTAAATTGG + Intronic
1087310870 11:96541547-96541569 AAAAAAATCCAATTTAAAATGGG - Intergenic
1087541370 11:99525132-99525154 AAAAAAGCCTCCCTTTAAATTGG - Intronic
1087837735 11:102891579-102891601 CAAAAAATCAACCTTTAAAAGGG - Intergenic
1087851314 11:103033404-103033426 AAAAATTTTCTCCTTTAAATAGG - Intergenic
1089187141 11:116626080-116626102 AAAAAAATCCTCCATGAACTAGG + Intergenic
1089989700 11:122847705-122847727 AAAAATATGCCCCTTTGCATGGG - Intronic
1090031717 11:123212060-123212082 AAGAAAATACCTCTTTAAATAGG - Intergenic
1090542052 11:127717259-127717281 ATAAAAATCCACCTTTTAAAAGG + Intergenic
1091168010 11:133497706-133497728 AAAGGAAGGCCCCTTTAAATAGG + Intronic
1092354684 12:7784811-7784833 AAAGAAATCCCTTTTTACATTGG + Intergenic
1092367024 12:7884843-7884865 AAATAAATCCCTTTTTACATTGG + Intronic
1092667399 12:10817910-10817932 CAAAAAATCCAATTTTAAATTGG + Intergenic
1093052256 12:14517043-14517065 AAAAAAAAAGTCCTTTAAATAGG + Intronic
1093068977 12:14688667-14688689 CAAAAGTTCCCCCTTTCAATAGG + Intronic
1093854229 12:24079476-24079498 AAAAACATCCCCCTTAATTTAGG - Intergenic
1093973874 12:25400364-25400386 AAAAAAATTCATCTTTAAAAGGG + Intergenic
1095362950 12:41366195-41366217 AAATAAATCCTCCTTTTAAAAGG + Intronic
1095435132 12:42178890-42178912 AAAAAAATACCCCTTTAGCCAGG + Intronic
1095663661 12:44768301-44768323 AAAAAAAAAACCCTTTAAAAAGG - Intronic
1095795466 12:46214620-46214642 ACAAACCTCACCCTTTAAATTGG + Intronic
1096161561 12:49382676-49382698 AAAAATATACACTTTTAAATAGG - Intronic
1097545219 12:60990873-60990895 AAAAAAATACCACTTTATTTTGG + Intergenic
1097599762 12:61676206-61676228 AAAAAAATCACCCTTTTCCTTGG - Intergenic
1098418430 12:70264146-70264168 AAAAAAATGCCCCTACAAAGGGG - Intronic
1099074680 12:78091807-78091829 AAAAAAATTCACCTGTTAATTGG + Intronic
1099805666 12:87515605-87515627 AAATAAATTCCCTTTTAAAAAGG - Intergenic
1099862623 12:88239057-88239079 AAGAAAAGACCCCTTTAAAAGGG - Intergenic
1100825521 12:98471265-98471287 AAAAAAATCCCTATCTAAGTGGG - Intergenic
1101254235 12:102961922-102961944 AAAAAAATCCCCCTTTGTGGGGG - Intergenic
1101723459 12:107370742-107370764 AAAAAAATCCCTTTTTTGATAGG - Intronic
1102114289 12:110390059-110390081 AAAAAAATCTAATTTTAAATTGG - Intronic
1102714291 12:114956596-114956618 AAAAAAACTCCTTTTTAAATGGG + Intergenic
1103484316 12:121272885-121272907 AAAAAAAAGCCCCTTTAGAAAGG + Intronic
1104026253 12:125028740-125028762 AAAAAAATCCCCAATTATTTTGG - Exonic
1104205484 12:126634612-126634634 AAAGGAATTCCCTTTTAAATAGG - Intergenic
1105674140 13:22651842-22651864 AAATAAATGCCATTTTAAATTGG - Intergenic
1105684818 13:22770514-22770536 AAAAACATCAAACTTTAAATGGG - Intergenic
1106846512 13:33743272-33743294 AATAAAATCCAGCTTTAAACTGG - Intergenic
1106930299 13:34656345-34656367 AACAAATTCCAGCTTTAAATAGG - Intergenic
1107865579 13:44700132-44700154 AAAAAATGCTTCCTTTAAATGGG + Intergenic
1108199608 13:48030022-48030044 AAAAAAATCCCCATGAAAACTGG - Intergenic
1109079772 13:57884159-57884181 AAATAAATCCCCTTTCAAAAAGG - Intergenic
1111788593 13:92823579-92823601 AGCAAAATCCCCTTTAAAATAGG + Intronic
1111847730 13:93532855-93532877 AAAAAATAGCTCCTTTAAATGGG - Intronic
1112066058 13:95794280-95794302 GAAAAATTTCACCTTTAAATGGG + Exonic
1112818899 13:103307917-103307939 AAAATATTCCCTCGTTAAATGGG + Intergenic
1113387263 13:109860185-109860207 AAAAAAATGCCATTTTAAACAGG - Intergenic
1114732220 14:25005156-25005178 AAATAAATCCCCTTTTAAAAAGG - Intronic
1115776774 14:36724216-36724238 AAAAAAATTCCCCCTGAATTAGG + Intronic
1115982342 14:39067538-39067560 AAAAAAATTCTTCTTTAAATAGG + Intronic
1116321029 14:43463059-43463081 AAAAAAATCCAGCTTAAAAATGG - Intergenic
1116616051 14:47140956-47140978 AAAAAAATCTCATTTTAAAATGG + Intronic
1116721057 14:48496238-48496260 TAAATAATTACCCTTTAAATTGG - Intergenic
1116762730 14:49034221-49034243 AAAATAATCCCACTAAAAATGGG + Intergenic
1116785149 14:49280212-49280234 AAAAACATCCACCTTTAAAGAGG + Intergenic
1117086274 14:52205095-52205117 AAAAAAAAACCCCATTAAAAAGG + Intergenic
1117170866 14:53094233-53094255 AAAAAAATTTACCTTTAAACTGG + Intronic
1117495770 14:56301835-56301857 AAAAAAATGCACATTTATATAGG + Intergenic
1117659990 14:57993349-57993371 AAAACAATCCCCCATAGAATTGG + Intergenic
1118125767 14:62902050-62902072 AAAAAAAAACCCATTAAAATGGG - Intronic
1118311910 14:64699945-64699967 AAAAAAAAAAACCTTTAAATGGG - Intergenic
1118523457 14:66614668-66614690 AAAAACTTTCCCTTTTAAATTGG - Intronic
1118628719 14:67683268-67683290 AAAAAAATAACCCTTTATCTTGG - Intronic
1118653234 14:67920262-67920284 AAAAAAATCCATTATTAAATTGG - Intronic
1119130154 14:72164547-72164569 AAAATAATCCCCATATCAATGGG - Intronic
1119362478 14:74062812-74062834 AAAAAAATCAACCTATAAAAGGG + Intronic
1119606792 14:76026102-76026124 AAAAAAATCCCACTAAAAAATGG + Intronic
1119863701 14:77955863-77955885 AAAAAGATCCCCCCTGGAATAGG + Intergenic
1120791589 14:88588982-88589004 AAAAAAAAATCCCTTTAATTAGG - Intronic
1122434191 14:101681700-101681722 AAAAAAATGTCCTTTTAAAAAGG - Intergenic
1123575654 15:21665280-21665302 AAAAAAATCCACTTAAAAATGGG + Intergenic
1123612274 15:22107753-22107775 AAAAAAATCCACTTAAAAATGGG + Intergenic
1123789698 15:23708632-23708654 AAAAAATTCACCCTTCTAATGGG - Intergenic
1125033187 15:35093268-35093290 AAAAAAATCCCCTTATGAACTGG - Intergenic
1125207001 15:37164899-37164921 AAAACAATTCCAATTTAAATTGG - Intergenic
1125910621 15:43435286-43435308 AAAAAAATCCAAATTGAAATAGG + Intronic
1126277308 15:46899001-46899023 AAAATAATCAACCTTTTAATGGG - Intergenic
1126725472 15:51627077-51627099 AAACAAATCCACCTTTCAATGGG + Intergenic
1127516136 15:59695063-59695085 AAAAAAATCCCTTTTTAATCTGG - Intergenic
1128169727 15:65500426-65500448 AAAAAAATCGCTCTTAAAATTGG + Intronic
1128587464 15:68862113-68862135 AAAAAAAATCACCTTTACATTGG - Intronic
1128748036 15:70128561-70128583 AAAAAAATCCCCATTTATGGTGG + Intergenic
1130806031 15:87323818-87323840 AAAAAAATCCAATTTTAAATGGG + Intergenic
1130929924 15:88416968-88416990 AAAAAAATCCCAGTTCACATGGG + Intergenic
1131543410 15:93294837-93294859 AAAAAAATTCCAATTCAAATTGG - Intergenic
1131568054 15:93504610-93504632 AAAAAAATCACCCTTGACAGTGG - Intergenic
1202984522 15_KI270727v1_random:399525-399547 AAAAAAATCCACTTAAAAATGGG + Intergenic
1134570512 16:15286764-15286786 AAAAAAATTCTCTTTTGAATAGG - Intergenic
1134824128 16:17270896-17270918 AAATGAATGCCCCTTCAAATGGG + Intronic
1134935580 16:18242706-18242728 AAAAAAATTCTCTTTTGAATAGG - Intergenic
1135566483 16:23515107-23515129 AAAAAAAAACCCCATGAAATAGG - Intronic
1137297114 16:47105472-47105494 AAAAAAAACCCACATTAATTTGG + Intronic
1137349760 16:47703330-47703352 AAAAACAACCCCATTAAAATGGG + Intergenic
1138393076 16:56684088-56684110 AAAAAAATCCAGGTTTATATAGG - Exonic
1138731557 16:59200947-59200969 CAAAAAATCCCTCTTTTCATGGG + Intergenic
1138809703 16:60134475-60134497 AAAAAAATCCCATTTAAAAGTGG - Intergenic
1138867168 16:60835837-60835859 AAAAAGATTCACCTCTAAATCGG - Intergenic
1138948514 16:61881937-61881959 AAGCATTTCCCCCTTTAAATTGG + Intronic
1139064651 16:63297953-63297975 AAAAAAAACCCCATGTAAATGGG + Intergenic
1140576506 16:76176085-76176107 AAAAAAATCACTTGTTAAATTGG - Intergenic
1141320380 16:83002994-83003016 ACAAAATTCCCACTTTAAAGAGG + Intronic
1141562950 16:84881966-84881988 AAAAAAAGACCCATTTAAAGAGG - Intronic
1142392490 16:89811173-89811195 AAAAAAATTGCCTTTTAAACGGG + Intronic
1144010413 17:11143061-11143083 AAAAAAAGCCCCATTAAAAATGG + Intergenic
1144195096 17:12885694-12885716 AAAAAAATCCTATTTAAAATGGG - Intronic
1144534880 17:16078564-16078586 AAAAAAGTCTCCATTTATATTGG - Intronic
1146378208 17:32309072-32309094 AAAAAAATTGCCCTTTCTATGGG + Intronic
1146551961 17:33788217-33788239 AAAAAAAACCCCATTAAAAGTGG + Intronic
1147127545 17:38382455-38382477 AAAAAAATCATGCTTTGAATTGG + Intronic
1148898273 17:50853761-50853783 ATAAAAATCATCCTTCAAATAGG + Intergenic
1149106908 17:52979967-52979989 AAAAAAAAAACCCTTTAAAGAGG + Intergenic
1149249562 17:54752787-54752809 AAAAAGAACCCCGTTTAAGTGGG - Intergenic
1150057835 17:62035451-62035473 AAAATAATCTACCTTGAAATGGG + Exonic
1150554208 17:66238953-66238975 AAACAAATCCCCCTTCAAATGGG + Intronic
1150601748 17:66657122-66657144 TAAAATATCCCCATTTGAATAGG + Intronic
1151010589 17:70490027-70490049 AAAAAAATCACACCTCAAATTGG - Intergenic
1151485948 17:74400221-74400243 AAAGAAATCCAACTTTAAAAGGG - Intergenic
1151504502 17:74518011-74518033 AAAAAAAGGCCCGATTAAATGGG + Intergenic
1153324241 18:3801910-3801932 AAAAAAATCTCTCTTGTAATTGG + Intronic
1153761752 18:8338374-8338396 AAAAAAAAACACCTTTAAAGAGG + Intronic
1155798447 18:30070131-30070153 AAAAAAATCACTCATTAATTAGG - Intergenic
1156512456 18:37650855-37650877 AAAAAAATCAGCCTTTGAAAAGG + Intergenic
1157090971 18:44636652-44636674 GAAAAATTCCCACTTTCAATGGG - Intergenic
1157363546 18:47042029-47042051 AAAAAAATCCACTTAAAAATGGG - Intronic
1158794252 18:60823458-60823480 AAAATAATCCCCTTAAAAATGGG + Intergenic
1158825928 18:61219178-61219200 AAAAAAATACCCCTTTTTAAGGG + Intergenic
1159720193 18:71880369-71880391 AAAAAAATCCCCATTTTTAGTGG - Intergenic
1160288488 18:77568818-77568840 AAAAAAATCCATCTGTGAATTGG - Intergenic
1163903861 19:20133888-20133910 AAAAAAATGCTTATTTAAATGGG - Intergenic
1163940454 19:20487726-20487748 AAAAAAAACCTCATTAAAATTGG + Intergenic
1164253572 19:23507329-23507351 AAGAAAATGCTCATTTAAATAGG - Intergenic
1164974158 19:32559375-32559397 AAAAAACTCTACCTTTCAATGGG - Intergenic
1165410298 19:35656145-35656167 AAAAAAATTACCCTTTAACTTGG + Intronic
1167789554 19:51665032-51665054 AAAATCACCCCCATTTAAATTGG + Intergenic
926100065 2:10109699-10109721 ATATAAATCTCCCTTCAAATAGG - Intergenic
926655468 2:15399806-15399828 AAAAAAATCCATATTTAAATAGG + Intronic
926708251 2:15852595-15852617 AAAAAAATCCCATTTAAAAATGG - Intergenic
927305228 2:21563665-21563687 AAAAAAATTTCTTTTTAAATTGG - Intergenic
928660210 2:33494165-33494187 AAAAAAATCCCCTTGAAAAGTGG + Intronic
928997810 2:37313587-37313609 AAAAAAATCCTACTTTACATAGG + Intronic
929137195 2:38636570-38636592 AAAAAAATCCTCCTATAATTGGG - Intergenic
929152691 2:38761501-38761523 AAAAAAATTTCCCTTCTAATTGG + Intronic
929188446 2:39119759-39119781 AAACAAAACCCCCCTGAAATTGG + Intronic
929216796 2:39423083-39423105 AAAAAAATCCTATTTTAAAAAGG + Intronic
930276753 2:49320000-49320022 AAAAAAATCCACCATGAAAGTGG + Intergenic
930677464 2:54218951-54218973 AAAAAAATCCCAATTTAATGTGG - Intronic
931913040 2:66923066-66923088 TAAAAAATCCCACATTACATTGG - Intergenic
932120851 2:69098672-69098694 ATAAAAATCACCCTTTTAAAAGG + Intronic
932270850 2:70408130-70408152 AAAAAAATCCCCCCAGAAAGTGG + Intergenic
932641758 2:73454925-73454947 ACAAAAAAGCCACTTTAAATCGG - Intronic
933133162 2:78698648-78698670 GAAAATATGCCCCTTTAAATAGG + Intergenic
933841672 2:86291831-86291853 ATAAAAATCCAACTTAAAATGGG - Intronic
934289914 2:91683379-91683401 AAAGAAATCCATTTTTAAATAGG - Intergenic
935089549 2:99881594-99881616 AAAAAAATCGCATTTTAAAATGG + Intronic
937020482 2:118646661-118646683 AAATAAATCTCCTTTTACATAGG - Intergenic
937820546 2:126305691-126305713 AAAAAAATTCCCTGTTAAAAAGG - Intergenic
939271151 2:139941243-139941265 AAAAAAGTCCTCTTTTAGATTGG + Intergenic
939472380 2:142640002-142640024 AAAAAAATACCTTTTAAAATAGG - Intergenic
940238485 2:151536807-151536829 AAAATAATCCCACTTTATATTGG + Intronic
940625886 2:156174662-156174684 AGAAAAACAACCCTTTAAATTGG - Intergenic
941044328 2:160655345-160655367 AAAAATATCTGTCTTTAAATAGG + Intergenic
941651452 2:168096909-168096931 AAAAAAACCTGCCTTTCAATGGG + Intronic
942613610 2:177766765-177766787 AGAAAAATCCCATTTTAAAATGG + Intronic
943453734 2:188077048-188077070 AAAAAAATCCTTCTCTAATTTGG - Intergenic
943694107 2:190904982-190905004 TTAAAAATCTCCTTTTAAATAGG + Exonic
944016722 2:195049256-195049278 AAAAAAAGCTCCCTTGACATAGG + Intergenic
944119223 2:196223053-196223075 AAAAAAATGACCCTTAAAATTGG - Intronic
944184474 2:196931649-196931671 AAAAAAATCCCCATTTTAACTGG - Intergenic
944244854 2:197520760-197520782 AAAAATATCCCCCTTAAGCTGGG + Intronic
945211099 2:207382881-207382903 AAAAAAAACCCTCATAAAATGGG + Intergenic
946754089 2:222925358-222925380 AAAAAAATCCATCTTGACATGGG + Intronic
947304321 2:228726604-228726626 AAAAAAGTCTTCCTTTAAAGAGG - Intergenic
947447372 2:230174368-230174390 AAAATAAGCCCACTTTGAATGGG + Intronic
949084637 2:242141459-242141481 AAAAACAACCCCATTAAAATTGG - Intergenic
1168733497 20:108773-108795 AAAAAAATCCCATTAAAAATGGG + Intergenic
1168955006 20:1828566-1828588 AATAAAAACTCCCTTTGAATGGG + Intergenic
1170577748 20:17677078-17677100 AAAAAAATTCCACTTTTAAAAGG + Intronic
1171218852 20:23375289-23375311 AAAAAAATACCCCTTCAGACGGG + Exonic
1172058704 20:32173840-32173862 AAAAAAATCCCCCAATATTTGGG - Intergenic
1173532681 20:43782502-43782524 AAAAAAATCGCCTTGTAAAATGG - Intergenic
1173679302 20:44865963-44865985 AAAAAAATCACACTTAAAAAGGG - Intergenic
1174592374 20:51656570-51656592 AAAAAAGTCATACTTTAAATAGG + Intronic
1174899020 20:54479111-54479133 AAAAACATTCCCATTCAAATGGG + Intronic
1175117850 20:56695623-56695645 AAAGAAATTCACATTTAAATGGG - Intergenic
1175590562 20:60187749-60187771 AAAAAAAGACACCTTTAAAGTGG - Intergenic
1177252239 21:18608744-18608766 AAAAAAATTACACTTTAAAATGG - Intergenic
1177454097 21:21312601-21312623 AAAAAAATCTAGCTGTAAATAGG - Intronic
1178209865 21:30517310-30517332 AAAAAAATCCCACTCCAAATGGG + Intergenic
1178403220 21:32304934-32304956 AAACAAATCCCCCTCAAAACAGG - Intronic
1178707141 21:34885715-34885737 AAATTAATCTCCCTTTAAAGGGG + Intronic
1179058588 21:37958481-37958503 AACACAATCCCCATTTGAATAGG - Intronic
1179386230 21:40945273-40945295 AAAAAAATCCCATTAAAAATTGG + Intergenic
1181526005 22:23488123-23488145 AAAAACAGCCCCATTTAAAAAGG - Intergenic
1182000829 22:26918356-26918378 AACAAAGTCCTCCTTTAATTGGG + Intergenic
1182828673 22:33286855-33286877 AAAATAATTCCCCTTTCTATGGG + Intronic
1182873384 22:33668562-33668584 AAAATAATACTCCTTTAGATCGG + Intronic
1184084429 22:42251163-42251185 AAATAAATCCCCTTTAAAAAAGG + Intronic
1184278389 22:43423459-43423481 AAAAAAATCTCCCTTTTCCTGGG - Intronic
1185083860 22:48725287-48725309 AAAAAAATGCCCTTTTAAACCGG - Intronic
949667655 3:6358982-6359004 AAAAAAAAAGCACTTTAAATAGG + Intergenic
951398175 3:22197128-22197150 AAAAAATTCCACCTTTAAAAGGG - Intronic
952127251 3:30315447-30315469 AAAAAAATCCCCTTTAAAAGTGG + Intergenic
952690235 3:36196852-36196874 ACAAAGATCCTCCTTAAAATAGG - Intergenic
954010700 3:47634989-47635011 AAAAAAGTCACCCTTTAGACTGG + Intronic
954487253 3:50864281-50864303 AAAAAAATCCAATTTTAAAATGG - Intronic
955560799 3:60187906-60187928 ATAAAAATCCCCACATAAATAGG - Intronic
956322395 3:68011467-68011489 AAAAATATCCTACTTTAAAATGG - Intronic
956542937 3:70363446-70363468 AAAAAAAACCCTCTTAAAACTGG + Intergenic
956572026 3:70707006-70707028 AAAAAAATATGCCTTGAAATAGG + Intergenic
956596499 3:70973042-70973064 AAAAAATACCCCCTTTTTATGGG - Intronic
956733898 3:72221731-72221753 AAAAAAGTACTCCTTTAAATGGG + Intergenic
957554966 3:81755127-81755149 AAAAAAATCTGACTTTAAAATGG + Intronic
957766985 3:84638291-84638313 TAAAAATTCCACCTTTAGATTGG + Intergenic
958008798 3:87848352-87848374 AAAAAAATCCCACTAAAAAATGG - Intergenic
958030809 3:88106792-88106814 AAAAAAATCCTCATATAACTTGG - Intronic
959822014 3:110746740-110746762 AAAAAAAACCCCGTTAAAAATGG + Intergenic
961337777 3:126193449-126193471 AAAAAAATCCCCCTTTTTGCTGG + Intronic
962032891 3:131620020-131620042 AACAAAATCCTCCTCTAATTGGG + Intronic
962187504 3:133275196-133275218 AAAAAACTCCCATTTTCAATTGG - Intronic
963803739 3:149701995-149702017 ATGAAAATCTCCCTTAAAATTGG + Intronic
965158551 3:165098665-165098687 AAAAAAATTCCACTTTTAAAAGG - Intergenic
965593012 3:170379998-170380020 ACAAATATCCCCCATTAAATAGG - Intronic
967175652 3:186861576-186861598 AAATAAATCCCCATTAAAATTGG + Intergenic
967688725 3:192448447-192448469 AAAAACATCCCCCTGAAAATTGG + Intronic
968011245 3:195279093-195279115 ACAGAAATAGCCCTTTAAATAGG + Exonic
968561018 4:1282395-1282417 AAAAAAATCCCACTAGAAAGTGG + Intergenic
969506631 4:7591998-7592020 AAAAAAATCCCCCTTTAAATTGG + Intronic
970492697 4:16591089-16591111 AATAATCTCCCCCTTTAAAAAGG - Intronic
971192658 4:24442359-24442381 AAAAAAATCTTCATTTAAAGAGG + Intergenic
971846106 4:31920467-31920489 AAAAAAATCCCACTTCATTTTGG - Intergenic
972620788 4:40746496-40746518 AAAAAAATTCTCCCTTAATTTGG - Intergenic
973949931 4:56001745-56001767 AAAAAAATCCTCAAATAAATTGG - Intronic
974343440 4:60645116-60645138 AAATAAATCCACCATTATATTGG - Intergenic
974522574 4:63003187-63003209 AATAAAATGCTCCTTTAATTGGG + Intergenic
974982901 4:68982792-68982814 ATAAAAATTCCATTTTAAATTGG - Intergenic
975226174 4:71875383-71875405 AAAAAAATCCCATTAAAAATAGG - Intergenic
975972426 4:80057035-80057057 AAAAAAATGCCTTTTTAAACTGG + Intronic
976524281 4:86068739-86068761 AAATTAATACCCTTTTAAATTGG + Intronic
976723859 4:88196795-88196817 AAAAAAATCCCCTTTAGCATCGG + Intronic
976882892 4:89950866-89950888 AAAAAATTCTCCCTTAAAAATGG - Intronic
977244801 4:94618858-94618880 AAAAAAGTACCCCTTTTAACAGG + Intronic
977328473 4:95606661-95606683 AAAAAAATGCTCTTTTAAAATGG + Intergenic
977876727 4:102158372-102158394 AAAAAAATCCCTCTTGATAGTGG - Intergenic
978136128 4:105262890-105262912 AAAAAAATTCATCTTTAACTGGG + Intronic
979214273 4:118144170-118144192 AAAAAAGTAGCCCATTAAATAGG - Intronic
979679507 4:123444314-123444336 AGAGAAAGCCCCCTTTAAAGGGG - Intergenic
980300868 4:130991648-130991670 AAAAGAATCCAACTTAAAATAGG - Intergenic
980713287 4:136598461-136598483 AAAAAAATCCCCCAAAAAACTGG + Intergenic
980796712 4:137694251-137694273 AAAAAAATCCTGCTGGAAATAGG - Intergenic
982637484 4:157915277-157915299 AAAAAGCTCCGCCATTAAATAGG + Intergenic
982977897 4:162090247-162090269 AAAAACAACCCCATTTTAATTGG - Intronic
984089540 4:175354931-175354953 AAAATAATCCCACTAAAAATTGG + Intergenic
986441305 5:7784782-7784804 AAAAAAATCTCCCCTTGACTAGG + Intronic
986572042 5:9175747-9175769 AACAATTTCTCCCTTTAAATAGG + Intronic
987439417 5:17938055-17938077 AAAAAAATCCCATTTAAAAGTGG + Intergenic
987548570 5:19346851-19346873 AGAAAATACCCCCTTTATATTGG - Intergenic
987772173 5:22319743-22319765 AAAAATATCACCCTTTCCATTGG + Intronic
987784206 5:22478087-22478109 AATAAAATTTCCATTTAAATAGG - Intronic
987902257 5:24028019-24028041 CAAAAAATCCTTCTTTACATTGG + Intronic
988039974 5:25876495-25876517 TAAAAAATTCCCCTGTAACTAGG + Intergenic
988151013 5:27380048-27380070 AAATAAATAACCCTTTACATTGG - Intergenic
988572194 5:32379320-32379342 AAAACAATCACACTTAAAATTGG + Intronic
988634914 5:32972299-32972321 AAAAAAATTCCTTTTGAAATAGG - Intergenic
988678348 5:33457882-33457904 AAAACATTCCCCCTTAAAATAGG + Intronic
989010400 5:36865279-36865301 AAAATAACCCCACTTAAAATGGG - Intergenic
989480213 5:41922321-41922343 TAAAAAATCCAGTTTTAAATAGG - Intergenic
989783588 5:45300321-45300343 AAGAAAATCCACCTATAAATGGG - Intronic
990071994 5:51793908-51793930 AAAAAAATCCCATTAAAAATGGG + Intergenic
990143949 5:52737387-52737409 ATAAAAAGCCCCTTTTCAATGGG + Intergenic
991550247 5:67827542-67827564 GAAAACATTCCCCTTTCAATGGG + Intergenic
991904463 5:71495856-71495878 ATAAAAATCTCCCTTTGAAGAGG + Intronic
992224189 5:74603412-74603434 AAAAAAATCTAACTTTAAAATGG + Intergenic
992356503 5:75989968-75989990 AAAAAAAACCCCATTAAAAAGGG - Intergenic
992356504 5:75989969-75989991 AAAAAAAAACCCCATTAAAAAGG - Intergenic
993138609 5:84001770-84001792 AAAAAAATCTCCCATCAAAGGGG + Intronic
993904192 5:93604670-93604692 AAAAATATCCCTCTTTAAAAGGG - Intergenic
994104782 5:95935465-95935487 AAAAAAATTACTCTTTAAATAGG + Intronic
994388949 5:99166605-99166627 AGAAAAATCCCCTTCTAAAAAGG - Intergenic
994903697 5:105808233-105808255 TAAAAAATCCTTCTTAAAATTGG + Intergenic
995057981 5:107782574-107782596 AAAAAAATCTCTTTTAAAATGGG - Intergenic
995359186 5:111274654-111274676 AAAAAAATAGCCCTTCAAAGAGG + Intronic
995382839 5:111554015-111554037 AAAAAACACTCCCTTTAGATGGG - Intergenic
995401689 5:111749435-111749457 AAAAAAATCCCTCTTGGACTTGG + Intronic
996204317 5:120712624-120712646 AAAAAAATCCAATTTTAAAATGG + Intergenic
997009550 5:129860483-129860505 TGAAAAATCAGCCTTTAAATGGG + Intergenic
997311243 5:132885445-132885467 AAAAAACTCCCTCTTAAAAAAGG + Intronic
997707422 5:135970202-135970224 AAAAAAATCTGCCTTTAGGTGGG + Intergenic
998727523 5:145034775-145034797 AAAAAAATCCAGCTTTAATAAGG + Intergenic
999933461 5:156458906-156458928 AAAAAAATCCCTGTTAAAATTGG - Intronic
999946414 5:156600990-156601012 AAAATAATCCAATTTTAAATAGG - Intronic
999961283 5:156758484-156758506 ATAAAAGTCCCCCTTTTGATTGG + Intronic
1000108692 5:158086157-158086179 AAAAAAATTTAACTTTAAATGGG - Intergenic
1000226810 5:159269488-159269510 AAAAAAAATCCCTTTTAAACTGG - Intronic
1000936806 5:167311956-167311978 TAAAAAATTCCCCCTTAACTAGG - Intronic
1001360176 5:171075966-171075988 TAAAAAAACACACTTTAAATGGG + Intronic
1002993370 6:2258549-2258571 AAAAATTTCCCTCTTTTAATAGG + Intergenic
1003177036 6:3759375-3759397 AAAAAAAACCATCTTCAAATGGG + Intergenic
1003178203 6:3769525-3769547 AAGAAAGTTTCCCTTTAAATGGG - Intergenic
1003415578 6:5905061-5905083 AAACAATTTCCCCTTTAAATAGG + Intergenic
1004943165 6:20583046-20583068 AAAAAAATCCCTCAGAAAATAGG - Intronic
1005265346 6:24106694-24106716 TATAAATTCCCCCTGTAAATTGG + Intergenic
1005880270 6:30052461-30052483 AAAAAAAATCCCCTTAAAAATGG - Intergenic
1005965072 6:30721318-30721340 AAAAAAATCCCCCTTGGCCTCGG - Intronic
1006042278 6:31266511-31266533 AGAAAAATCCTCTTTTAAACAGG + Intergenic
1006051864 6:31351598-31351620 AGAAAAATCCTCTTTTAAACAGG + Intronic
1007868689 6:45006766-45006788 AAAATAATACCCCTTTTCATCGG - Intronic
1008590273 6:52986956-52986978 ATAAATATCCCCATTTACATGGG - Intronic
1009333796 6:62459567-62459589 AATAAAATGCTCCATTAAATAGG + Intergenic
1009425904 6:63513402-63513424 AAAAAAATCCCCATTTTATCTGG - Intergenic
1010823246 6:80441241-80441263 ATAAAACTCCCACTTAAAATTGG - Intergenic
1011389664 6:86838141-86838163 AAAAAAATTCGCCTTTAACTTGG + Intergenic
1012472044 6:99583010-99583032 AAAAAAATCGCAATTGAAATTGG + Intergenic
1012817518 6:104042792-104042814 AAAAAAAAACCTCTTTAAAAAGG + Intergenic
1012850088 6:104436279-104436301 AAAAAAATCCCATTAAAAATGGG - Intergenic
1012876277 6:104731876-104731898 AAAAAAATCCCGATTAAAAATGG + Intronic
1012903126 6:105031051-105031073 AAAAAGAAGCCACTTTAAATAGG - Intronic
1012939002 6:105397971-105397993 AAAAAAATACCAGTTTTAATTGG - Intronic
1013006114 6:106075100-106075122 AAAAAAATTCCCCCCTAATTTGG - Intergenic
1013298703 6:108782626-108782648 AAAAAAAGTGTCCTTTAAATTGG - Intergenic
1013771658 6:113634637-113634659 AAACAAATACACTTTTAAATGGG - Intergenic
1013840198 6:114382584-114382606 AAAAATTTCCCCCTTTACCTAGG + Intergenic
1014037091 6:116779211-116779233 AAAAAAATACAACTTTTAATTGG - Intergenic
1014162886 6:118190447-118190469 AAAAAAATCCCCCTTTGGTCAGG + Intronic
1014643819 6:123948582-123948604 AAAAAAATCCCATTTAAGATGGG - Intronic
1014988686 6:128046667-128046689 AAAAAAATCTATATTTAAATGGG - Intronic
1017300352 6:152850340-152850362 AAAAAAATTACCTTTTTAATTGG + Intergenic
1017628943 6:156377232-156377254 AAAAAAAAATCCCTTAAAATAGG - Intergenic
1017806366 6:157949386-157949408 AAAAAAAAAACCCTTTAAAAAGG + Intergenic
1017832050 6:158139495-158139517 AAAAAAGTCCATTTTTAAATTGG + Intronic
1018182747 6:161238336-161238358 AGAAAAATCCCCCATTACTTGGG - Intronic
1019216875 6:170449588-170449610 AAAAAAATCCCACTAAAAAGTGG - Intergenic
1020555930 7:9670278-9670300 AAAAAAATCCCCGTATAAGTAGG + Intergenic
1020842099 7:13231327-13231349 AAAGACAATCCCCTTTAAATTGG + Intergenic
1021764593 7:23934407-23934429 AAAAAAATCCAATTTTAAAATGG - Intergenic
1022322581 7:29300806-29300828 AAATAAATCACATTTTAAATGGG - Intronic
1023264125 7:38388262-38388284 ACAAAAATCCCATTATAAATGGG + Intronic
1023530287 7:41146322-41146344 AAAAATATCCCTCTTTACAGAGG - Intergenic
1023926896 7:44675887-44675909 AAAAAAATTCCCGTATAAAAGGG + Intronic
1024179241 7:46873022-46873044 AACCAAATGCCCCTTTAGATTGG - Intergenic
1024778193 7:52813271-52813293 AAAAAAAACACACTTAAAATAGG - Intergenic
1024894258 7:54239131-54239153 AAAAAAAAATCCCTTTCAATTGG + Intergenic
1026011614 7:66640587-66640609 AAAAAAATCTCCCTTTACCCAGG - Exonic
1026021987 7:66715458-66715480 ACATAAATTCCCCTTTAATTTGG + Intronic
1026780662 7:73264715-73264737 AAAAAAATCCCTCTTCAATGGGG - Intergenic
1026886343 7:73949748-73949770 ACATAAATTCCCCTTTAATTTGG + Intergenic
1026930887 7:74222408-74222430 AAAAAAATCCCCCCAAAAAAGGG + Intronic
1027021521 7:74818157-74818179 AAAAAAATCCCTCTTCAATGGGG - Intronic
1027066505 7:75127778-75127800 AAAAAAATCCCTCTTCAATGGGG + Intronic
1027521864 7:79219282-79219304 AAAAAAATCTACCTTTATTTAGG - Intronic
1027973735 7:85121393-85121415 AAAAAAAATCCCCTCTAACTAGG + Intronic
1028123923 7:87089528-87089550 AAAAAAATACACCTTTGAAAAGG + Intergenic
1028398526 7:90399094-90399116 AAAAAAAACCCTCATCAAATTGG + Intronic
1028473249 7:91227118-91227140 AAACAAATCACCCTCAAAATTGG + Intergenic
1029318239 7:99734074-99734096 AAAAAAATCTGGCTTTAAAAAGG + Intronic
1030703784 7:112669671-112669693 GAAAAAATTCCCATTTGAATGGG + Intergenic
1031097645 7:117440513-117440535 AAATAAATCCACTTTTTAATAGG - Intergenic
1031666141 7:124484467-124484489 AATTAAATCCCACTTCAAATTGG + Intergenic
1032751757 7:134848163-134848185 AAAAAAATCCAGATTTAATTTGG - Intronic
1033507249 7:142017270-142017292 CACAAAATGCCCCTTTAAGTTGG - Intronic
1033902865 7:146164090-146164112 AAAAAATTCTTCCTTAAAATTGG + Intronic
1034187971 7:149194002-149194024 AAATAAATAAACCTTTAAATCGG - Intergenic
1034193179 7:149226240-149226262 AAAAAAATACCCCATTGAATTGG - Exonic
1034706709 7:153152268-153152290 AAAAAAAAGCCAGTTTAAATTGG + Intergenic
1035056049 7:156037514-156037536 TAAAAAATTCCACTTCAAATAGG - Intergenic
1035141549 7:156767478-156767500 GAAAAAATTCCATTTTAAATAGG + Intronic
1035875939 8:3189785-3189807 AAACAAACTGCCCTTTAAATGGG + Intronic
1035876218 8:3192533-3192555 AAACAAGTTGCCCTTTAAATAGG + Intronic
1036410817 8:8498732-8498754 AGAAACATCTCACTTTAAATTGG + Intergenic
1036459330 8:8937965-8937987 AAAAAAATCCACATATAAATAGG + Intergenic
1036998367 8:13687271-13687293 AAAAAAAACTCCCTCTGAATGGG + Intergenic
1037170581 8:15886957-15886979 AAAAAAATACCACTGTAGATGGG + Intergenic
1037914152 8:22762096-22762118 AAAAAAATCACAATTTAAATCGG + Intronic
1037955315 8:23052269-23052291 AAAAAAGTTACCCTTTAAAAAGG - Intronic
1038859004 8:31365239-31365261 AAAAAAATCCCACCAAAAATGGG - Intergenic
1039012758 8:33112858-33112880 GATAAAGTTCCCCTTTAAATGGG - Intergenic
1039657984 8:39431112-39431134 AAAAATAACCCCATTTAAATTGG - Intergenic
1040433801 8:47369939-47369961 AAAAGACTCTCCCTTAAAATGGG - Intronic
1040951621 8:52942632-52942654 AAAAAACTCCCCCTTGGAATGGG + Intergenic
1041079193 8:54200360-54200382 AAAAAGATCCTCCTTTAATGAGG - Intergenic
1041142765 8:54840794-54840816 AGAAATTACCCCCTTTAAATGGG - Intergenic
1041824477 8:62078085-62078107 AAAAAAATTCCCCTTTTTGTAGG + Intergenic
1041970680 8:63738731-63738753 ACAAAAATCCTTCTTTAAACTGG + Intergenic
1046339500 8:112834071-112834093 AATAAAATCTACCATTAAATGGG - Intronic
1046463520 8:114572180-114572202 AAAAAAAGAACTCTTTAAATTGG - Intergenic
1047981681 8:130189982-130190004 AAAAAAATCCAGTTTTAAACTGG - Intronic
1048430194 8:134363224-134363246 AAAAACATCCCCGATGAAATAGG + Intergenic
1048700538 8:137083748-137083770 ACAAAAATAACCCTTTGAATTGG - Intergenic
1048849799 8:138634266-138634288 AAAAGGATCCCCCTTCAAATAGG - Intronic
1050053743 9:1630506-1630528 AAGAAGATACCCATTTAAATGGG + Intergenic
1050842152 9:10164479-10164501 AAAAAAATCTCCTTTTACAAGGG + Intronic
1050966312 9:11807813-11807835 AAGAAAATCCCCACTTAAATTGG + Intergenic
1051031800 9:12689686-12689708 AAAAAAATTTTCCTTAAAATAGG + Intronic
1051204802 9:14675121-14675143 AAAAAAAGCCTCATTTAAACAGG - Intronic
1051643225 9:19243014-19243036 CAAGATACCCCCCTTTAAATTGG - Intronic
1051933247 9:22412248-22412270 AAAAAAATCCCATTAAAAATGGG + Intergenic
1052049957 9:23834281-23834303 AAAAAATTACTCCTTTATATAGG + Intergenic
1052053703 9:23880227-23880249 AAAAAAATCTGACTTTAAACGGG - Intergenic
1052152508 9:25134841-25134863 AAAAAATTACCCCTTTGTATGGG + Intergenic
1052751979 9:32501213-32501235 AAAAAAATCTCCCTGCAAAAAGG + Intronic
1052873269 9:33529471-33529493 AAAAAAATTGCCCTGGAAATAGG + Intronic
1053454596 9:38224046-38224068 CAAAAAATCCCACTTAAAAGTGG + Intergenic
1055329063 9:75162969-75162991 AAAAACAACCCAATTTAAATGGG - Intergenic
1055495426 9:76849852-76849874 ACAAAAAACCCCCTATAATTTGG + Intronic
1055556382 9:77478015-77478037 AAAAAAAGACACCTTTAAAAAGG - Intronic
1055884284 9:81040985-81041007 AAATAAAACTCACTTTAAATGGG + Intergenic
1056552260 9:87661649-87661671 AAAATAATCCCACTTAAAAGTGG - Intronic
1057174119 9:92983091-92983113 AAAAAATTCACCTTTTAAAAAGG + Intronic
1057664449 9:97033630-97033652 AAAAAAACCCCCATAAAAATTGG + Intronic
1057682654 9:97204543-97204565 AAAAAAATTGCCCTGGAAATAGG - Intergenic
1057942266 9:99295735-99295757 AAAAAAATCCACCTTTCCTTAGG - Intergenic
1058241100 9:102561113-102561135 AAAAAAATCTTCCTATTAATTGG + Intergenic
1058603524 9:106696756-106696778 AAAAAATTCTCCCTTTCTATTGG - Intergenic
1060034918 9:120246961-120246983 ACAAAAATCCCCTTTAATATGGG - Intergenic
1060401362 9:123351397-123351419 AAAAAAATCCCTCTGGCAATTGG + Intergenic
1060717796 9:125950417-125950439 GAAAACATCCCACTTTTAATGGG - Intronic
1185455490 X:308250-308272 AAAAAAAGCATCCTTTAAAGAGG - Intronic
1186075039 X:5869168-5869190 AAAAAAATCTCCCTTTAGTTAGG - Intronic
1186750559 X:12617568-12617590 AAAATAATCCCCTTTTTACTGGG + Intronic
1186921392 X:14285184-14285206 AAAAAAAAACCCCTTAAAAATGG - Intergenic
1187116462 X:16357138-16357160 AAAAGAAGCCCTCTGTAAATTGG - Intergenic
1187355417 X:18565844-18565866 AAAAAAATCTTGCTTCAAATGGG + Intronic
1188154870 X:26729172-26729194 AAAAAAATGCACTGTTAAATAGG - Intergenic
1188723102 X:33547119-33547141 AAAAAAAACCCCATTAAAAATGG - Intergenic
1190312505 X:49126940-49126962 AAAGAAATACGCCTTTACATTGG + Intergenic
1190462723 X:50694528-50694550 AAAAAAATCCAACTTAAAAATGG - Intronic
1190822033 X:53982635-53982657 AAACAAATCCCCATATATATGGG + Intronic
1191051756 X:56200774-56200796 AATAATATCCCACTTTAAAAAGG + Intergenic
1191645772 X:63479218-63479240 AAAAAAATCCTCCTTTAGCTTGG - Intergenic
1191760133 X:64637816-64637838 AAACAAATCCCATTTTAAAATGG - Intergenic
1192096398 X:68216794-68216816 AAAAAAATCCCATTTAAAAGTGG + Intronic
1193349021 X:80436111-80436133 AATAATATCTCCCTTTAAATGGG + Intronic
1193462058 X:81802669-81802691 AAAAAAATACCCCTTAAATTGGG + Intergenic
1193868364 X:86765057-86765079 AAAAAAATCCACTTAAAAATGGG - Intronic
1193889156 X:87021819-87021841 AAAAAAAACCCCATTAAAAATGG + Intergenic
1195389008 X:104341564-104341586 AAAAAAAGCCACGTTTCAATAGG - Intergenic
1195879971 X:109582760-109582782 AAAAACATCTCCCATTAATTTGG + Intergenic
1196091779 X:111751768-111751790 TAGAAAATCCCTCTTTAAGTTGG - Intronic
1196821534 X:119705141-119705163 AAAAATATCCCCCTTAATGTTGG - Intergenic
1197022362 X:121706512-121706534 AAAAAAATCCACATCAAAATGGG - Intergenic
1197771678 X:130093316-130093338 AAAAAAATCCACATATAAAGTGG + Intronic
1198869789 X:141164967-141164989 AAAAAAATACCCCATAAACTAGG + Intergenic
1198971677 X:142288457-142288479 ACAAAAATCCCAATTTAAAGTGG + Intergenic
1199058196 X:143322459-143322481 ACAAAAATCCTCATTTAGATTGG - Intergenic
1199924243 X:152445866-152445888 TTAAAAATCCCTCTTAAAATGGG - Intronic