ID: 969507176

View in Genome Browser
Species Human (GRCh38)
Location 4:7595353-7595375
Sequence GCTTCATTACGTAGGCACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 57}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969507158_969507176 23 Left 969507158 4:7595307-7595329 CCAACCCAGAAGCTCTCCAACCC 0: 3
1: 8
2: 30
3: 93
4: 349
Right 969507176 4:7595353-7595375 GCTTCATTACGTAGGCACGGTGG 0: 1
1: 0
2: 2
3: 12
4: 57
969507171_969507176 0 Left 969507171 4:7595330-7595352 CCTCATCTAGGGGGTTTGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 93
Right 969507176 4:7595353-7595375 GCTTCATTACGTAGGCACGGTGG 0: 1
1: 0
2: 2
3: 12
4: 57
969507169_969507176 1 Left 969507169 4:7595329-7595351 CCCTCATCTAGGGGGTTTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 969507176 4:7595353-7595375 GCTTCATTACGTAGGCACGGTGG 0: 1
1: 0
2: 2
3: 12
4: 57
969507159_969507176 19 Left 969507159 4:7595311-7595333 CCCAGAAGCTCTCCAACCCCCTC 0: 1
1: 0
2: 2
3: 44
4: 334
Right 969507176 4:7595353-7595375 GCTTCATTACGTAGGCACGGTGG 0: 1
1: 0
2: 2
3: 12
4: 57
969507160_969507176 18 Left 969507160 4:7595312-7595334 CCAGAAGCTCTCCAACCCCCTCA 0: 1
1: 0
2: 2
3: 32
4: 442
Right 969507176 4:7595353-7595375 GCTTCATTACGTAGGCACGGTGG 0: 1
1: 0
2: 2
3: 12
4: 57
969507166_969507176 3 Left 969507166 4:7595327-7595349 CCCCCTCATCTAGGGGGTTTGTG 0: 1
1: 0
2: 0
3: 6
4: 110
Right 969507176 4:7595353-7595375 GCTTCATTACGTAGGCACGGTGG 0: 1
1: 0
2: 2
3: 12
4: 57
969507165_969507176 7 Left 969507165 4:7595323-7595345 CCAACCCCCTCATCTAGGGGGTT 0: 1
1: 0
2: 1
3: 11
4: 118
Right 969507176 4:7595353-7595375 GCTTCATTACGTAGGCACGGTGG 0: 1
1: 0
2: 2
3: 12
4: 57
969507167_969507176 2 Left 969507167 4:7595328-7595350 CCCCTCATCTAGGGGGTTTGTGG 0: 1
1: 0
2: 0
3: 10
4: 82
Right 969507176 4:7595353-7595375 GCTTCATTACGTAGGCACGGTGG 0: 1
1: 0
2: 2
3: 12
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969507176 Original CRISPR GCTTCATTACGTAGGCACGG TGG Intronic
910582886 1:88847880-88847902 GCTTCATTATGGAGGCAAGATGG - Intergenic
913190529 1:116409253-116409275 GCCTCATGAGGTAGGAACGGGGG - Intronic
917518837 1:175731624-175731646 ATTTCATTAAGGAGGCACGGCGG + Intronic
919018901 1:192077733-192077755 GCTTCATTACATTGGCATGATGG + Intergenic
919818716 1:201459281-201459303 GCTTCTTTCCGTAGGCAATGGGG - Intergenic
1070832414 10:79426264-79426286 GCTTCAGGACCTAGGCAGGGTGG + Intronic
1074666802 10:115737136-115737158 ACTTCATTGGGTAGGCACGGTGG + Intronic
1079742889 11:24086040-24086062 GCTGCATAATGTAGGCAGGGAGG + Intergenic
1081193289 11:40130549-40130571 GCTTAATTCTGTAGGCACTGGGG - Intronic
1085056418 11:73406814-73406836 GCTTCACTAGGAAGGCACAGCGG - Intronic
1092902671 12:13074658-13074680 GCTTCATTCTGTAGGCAGTGAGG + Intronic
1100711170 12:97258430-97258452 ACTTCATTCAGTAGGCACTGGGG + Intergenic
1106526394 13:30544500-30544522 GCGTCATTACATAGGCATGATGG - Intronic
1107924615 13:45246748-45246770 GCTTCATTGGCTGGGCACGGTGG + Intronic
1109599658 13:64608204-64608226 AATTAATTACGTAGGCACTGGGG - Intergenic
1121624479 14:95374295-95374317 ACTTCATTAGGTAGGCATGATGG + Intergenic
1129778671 15:78254409-78254431 GCTTCATTACATAGGTATGATGG - Intergenic
1130371228 15:83286123-83286145 GCCTCAATACGGGGGCACGGAGG - Intergenic
1133209807 16:4257213-4257235 GTTTCTTTACAAAGGCACGGTGG + Exonic
1133636726 16:7673417-7673439 GCTTTATTAGCTAGGCACAGTGG + Intronic
1138592688 16:58010894-58010916 GCTTCATCACATAGGCATGATGG + Intronic
1140223338 16:73059105-73059127 GCTTCATTACCCAGGCACGACGG + Intronic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1149170093 17:53799406-53799428 GCTTTATTACTTAGGCATGCTGG - Intergenic
1150176571 17:63063295-63063317 GCTTCGTCACGTAGGCATGTTGG + Intronic
1161209332 19:3058010-3058032 GCTTCATTGACCAGGCACGGTGG - Intronic
1161411185 19:4118424-4118446 GCTGCATCAGGTAGGCACGGTGG + Intronic
1166632396 19:44418576-44418598 GCTTCATTACATAGGCATGATGG + Intronic
937436596 2:121886686-121886708 GCTTCATCACATAGGCATGATGG + Intergenic
939575175 2:143886992-143887014 GCTTCATTACCTAGGCATGATGG - Intergenic
941531313 2:166674897-166674919 GCTTAATTAGCCAGGCACGGTGG - Intergenic
942227565 2:173830593-173830615 GCTTCATTGCACAGGCAGGGTGG - Intergenic
945273200 2:207962266-207962288 GCTTCATTATGTAGGTATGATGG - Intronic
1169187360 20:3629956-3629978 GTTTCATTACATAGGCATGATGG + Intronic
1169301662 20:4446685-4446707 GTTCCATTACTTAGGCATGGTGG + Intergenic
1169512912 20:6284312-6284334 GCTCCATTACATAGGCATGGTGG + Intergenic
1173868294 20:46326901-46326923 GCCCCATAAGGTAGGCACGGTGG + Intergenic
1175274034 20:57755133-57755155 GCTTCATGACCTCGGCACTGCGG - Intergenic
1178858063 21:36266650-36266672 GCTTCATTACATAGGCATGATGG + Intronic
951196495 3:19828711-19828733 GCTTCATTACATGGGCACGATGG + Intergenic
958164560 3:89862902-89862924 TCTTCATTACATAGGCATGATGG - Intergenic
960193684 3:114739068-114739090 ACTTCAATACGTTGGCACGATGG - Intronic
969507176 4:7595353-7595375 GCTTCATTACGTAGGCACGGTGG + Intronic
982849437 4:160294118-160294140 GCTTCATTGAGCAGGCACAGGGG + Intergenic
991612322 5:68462298-68462320 GCTTAATTATGTGGGCAAGGGGG + Intergenic
992295544 5:75323212-75323234 GTTTCATTAAGTAGGCACAATGG + Intergenic
995588839 5:113677111-113677133 GCTTCATTTCATAGGCAATGGGG + Intergenic
998223993 5:140312178-140312200 GCTTCATTTGGTAGGCACGGTGG - Intergenic
1004875398 6:19946181-19946203 GCTGCATTATGCAGGCACAGAGG - Intergenic
1010155888 6:72792089-72792111 GCTTCATTTCATAGCCATGGTGG + Intronic
1010191898 6:73204310-73204332 GCTTCATTACATAGACGCGATGG + Intergenic
1011497637 6:87952254-87952276 ACTTCATAATGTAGGCACTGAGG + Intergenic
1011580831 6:88862333-88862355 GCTTCATTATGTAGGCGTGAGGG - Intronic
1014277909 6:119407446-119407468 GCTTCATTATGTAGACATGATGG - Intergenic
1017757105 6:157538996-157539018 GCTTCATTTGGTAGGAACGGCGG + Intronic
1029105409 7:98171125-98171147 GCTTCATCACGAAGGCGCCGTGG - Intronic
1036044335 8:5122875-5122897 GCTTCGTTACATAGGTACGCAGG + Intergenic
1036044350 8:5122971-5122993 GCTTCGTTACATAGGTACGCGGG + Intergenic
1036044359 8:5123035-5123057 GCTTCGTTACATAGGTACGCGGG + Intergenic
1036044368 8:5123099-5123121 GCTTCGTTACATAGGTACGCGGG + Intergenic
1036044377 8:5123163-5123185 GCTTCGTTACATAGGTACGCGGG + Intergenic
1036044395 8:5123291-5123313 GCTTCGTTACATAGGTACGCGGG + Intergenic
1036044418 8:5123451-5123473 GGTTCATTACATAGGTACGTGGG + Intergenic
1036516692 8:9450858-9450880 GCTTCACTTGGTAGGCAGGGTGG + Intergenic
1040510372 8:48088030-48088052 GCTTCATTACATAGGCATGATGG - Intergenic
1046883116 8:119332026-119332048 GCTTCACTAAGTAGGCATGACGG + Intergenic
1047282655 8:123459413-123459435 GCTTCATCAGGTAGGCATGATGG + Intronic
1048265912 8:132985748-132985770 GCTTCCTTCTGTAGGCACTGGGG + Intronic
1049467952 8:142761739-142761761 GCTTCATTACGTAGGCATGATGG - Intergenic
1059637864 9:116188070-116188092 GCTTCTTCACGAAGGCAGGGTGG - Exonic
1192105476 X:68311718-68311740 GCTTCACCAGCTAGGCACGGTGG - Intronic
1202133563 Y:21636538-21636560 GCTTCATTACATAGGCATGATGG - Intergenic