ID: 969509284

View in Genome Browser
Species Human (GRCh38)
Location 4:7608469-7608491
Sequence TACATGCCAGGTGTTGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 624
Summary {0: 1, 1: 1, 2: 9, 3: 67, 4: 546}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969509284 Original CRISPR TACATGCCAGGTGTTGTCCT GGG (reversed) Intronic
900116052 1:1028377-1028399 TCCACGCCAGCTGTTTTCCTTGG + Intronic
901132110 1:6968504-6968526 TGCGTGCCAGGTGCTGTGCTGGG + Intronic
901342669 1:8509479-8509501 TATAAGCCAGGAATTGTCCTAGG + Intronic
901430404 1:9210681-9210703 TTGATGCCAGGTGCTCTCCTGGG - Intergenic
902559516 1:17268147-17268169 CTCAGGCCAGGTGTTGTGCTGGG - Intronic
902661715 1:17908931-17908953 TTTATGCCAGGTATTGTACTAGG - Intergenic
902679695 1:18034269-18034291 TACAGGCCAGGTACTTTCCTAGG + Intergenic
902760552 1:18578009-18578031 TATATGCCAGGTGTTTTTCTGGG + Intergenic
903042015 1:20537868-20537890 TACGTGCCAGGTGTTGTGCGAGG - Intergenic
903303774 1:22398031-22398053 TACATGTCAGGTGTTGTTTTAGG + Intergenic
903882215 1:26518777-26518799 TACATGCCAGGCACTGTTCTAGG - Intergenic
903989543 1:27256744-27256766 TACATGCCAGGTGCTGTTCCTGG - Intronic
904405666 1:30286504-30286526 TGCATGCCTGGAGTTTTCCTGGG - Intergenic
904990629 1:34589920-34589942 TATATGCCAGGTGTTGTGCTGGG + Intergenic
905026999 1:34857448-34857470 TACATGCCAGGCCTTGGGCTAGG + Intronic
905275993 1:36818655-36818677 TACATGCCAGGCTCTGTGCTGGG - Intronic
905290064 1:36915363-36915385 TATGTGCCAGGTCTTGTTCTAGG - Intronic
906087777 1:43150628-43150650 TACATGCCAGGTATTATCCTGGG - Intronic
906276668 1:44521819-44521841 TACATGCTAGGTACTGTACTAGG - Intronic
906668015 1:47635323-47635345 CACATCTCAGGTGCTGTCCTGGG + Intergenic
906929796 1:50158152-50158174 TATATGCCAGGTGTTGTTCTGGG - Intronic
907101988 1:51845806-51845828 TATATGCCTGGTGTTGTCCCAGG - Intronic
907192780 1:52662758-52662780 TGTGTGCCAGGTCTTGTCCTGGG + Intronic
907246261 1:53110975-53110997 TCGGTGCCAGGTGCTGTCCTAGG + Intronic
907637349 1:56149265-56149287 TACATGCCAGGTGCTGTGATGGG + Intergenic
907701282 1:56790606-56790628 TATATTCCAGGTATTGTTCTAGG + Intronic
907709063 1:56861156-56861178 TATATGCCAGGTACTGTTCTGGG + Intronic
907793263 1:57689264-57689286 AATATTCCAGCTGTTGTCCTAGG - Intronic
907829491 1:58050942-58050964 TACATGCTACATGTTGTTCTAGG + Intronic
908154919 1:61342984-61343006 TACATGCCAGGCAATGTGCTAGG - Intronic
908501260 1:64745402-64745424 TACCTGGCAGTTGCTGTCCTGGG - Exonic
909408833 1:75324974-75324996 TATATACCAGGTCTTGTACTAGG + Intronic
909427069 1:75537574-75537596 GACAAGCCTGCTGTTGTCCTTGG - Intronic
909822163 1:80079497-80079519 TATATTCCAGGTATTGTTCTAGG + Intergenic
909834434 1:80235820-80235842 TACATTCCAGGTTTTGAGCTAGG + Intergenic
910241173 1:85087645-85087667 TATATGCCAGGAACTGTCCTAGG - Intronic
910278132 1:85469765-85469787 CATATGCCAGGTATTGTGCTAGG + Intronic
910683616 1:89893010-89893032 TATATGACAGGTACTGTCCTAGG + Intronic
910693403 1:89987615-89987637 CACATGCCAGGTATGGTGCTAGG + Intergenic
910825175 1:91399122-91399144 TATGTGCCAGGTATTGTTCTAGG + Intronic
911152365 1:94607957-94607979 TACATGCCAGGAGTTGTGCTAGG - Intergenic
913044304 1:115060860-115060882 TAGGTGCCAGGTGGTGTTCTAGG - Intronic
913303429 1:117398069-117398091 TATATGCCAGGTAGTGTCCTAGG + Intronic
914449288 1:147776332-147776354 TACATGCCAGGCATTGTACTAGG + Intergenic
914672757 1:149884139-149884161 TACGTGCCAGGTAGTGTCCTAGG - Intronic
915160665 1:153917715-153917737 TACATGCCAGGCACTGTACTAGG + Intronic
915181317 1:154063030-154063052 TACATGCCAGGTGCTATGTTAGG + Intronic
915245599 1:154554061-154554083 TACATGCCAGGTTCTGTCCTAGG + Intronic
915632728 1:157164376-157164398 TGCAAGACAGGTGTTTTCCTGGG + Intergenic
918125831 1:181582698-181582720 TACATGCCAAGCACTGTCCTAGG + Intronic
918235126 1:182572840-182572862 TACATGCCAGGCACTGTACTAGG + Intergenic
918277209 1:182964857-182964879 TATATGCCAGGTTCTGTTCTGGG + Intergenic
918437107 1:184526852-184526874 TACCTGCCAGCTACTGTCCTTGG + Intronic
918480983 1:184976165-184976187 TACATGCTAGGTGCTCTTCTAGG - Intergenic
918653615 1:186997206-186997228 TATTTGCCAGGTATTGTCCTAGG + Intergenic
919579723 1:199356455-199356477 TCCATGCCAGGCATTGTGCTAGG - Intergenic
919911900 1:202116454-202116476 TATGTGCCAGGCATTGTCCTAGG - Intergenic
920368899 1:205464832-205464854 TACATGCCAGGCACTGTACTAGG + Intergenic
920833839 1:209489182-209489204 TACATACCAGGTGTTTTCCTGGG - Intergenic
921080022 1:211731825-211731847 TACATGCCAGCCATTGTTCTAGG + Intergenic
921277761 1:213536507-213536529 TATACCCCAGGTGTTGTCCTAGG - Intergenic
921353704 1:214264168-214264190 TATATGCCAGGTGCTGTTTTAGG - Intergenic
921371480 1:214427557-214427579 TACATGCCAGGAGTTATTCTAGG + Intronic
921556857 1:216609304-216609326 AATATGCCAGGTATTGTGCTAGG - Intronic
922019378 1:221688310-221688332 TAAATGTCAGGTGCTTTCCTGGG - Intergenic
922115948 1:222615014-222615036 TACATTTCAGGTTCTGTCCTTGG + Intergenic
922383027 1:225052534-225052556 TATATGCCAGGCATTGTACTAGG + Intronic
923002517 1:230019367-230019389 TATATGCCAGGTGCTGAACTAGG + Intergenic
923117819 1:230960114-230960136 TACATGCCAGGCATTGCACTAGG - Intronic
923999499 1:239534970-239534992 TACATGCCAGGCACTGTGCTAGG + Intronic
1063083675 10:2793095-2793117 TACATACCATGTCTTGTACTAGG + Intergenic
1063552282 10:7044520-7044542 TCCATGCCAGGCACTGTCCTAGG - Intergenic
1063945961 10:11176609-11176631 CATATGCCAGGCGCTGTCCTAGG - Intronic
1064164245 10:12973096-12973118 TACGTGCCAGGTGCTCTGCTGGG + Intronic
1064763815 10:18650732-18650754 TAAATGCCAGCAGTTGTGCTAGG - Intronic
1065823051 10:29544021-29544043 TAAAGGCCAGGGGTTGCCCTTGG + Intronic
1066205829 10:33188446-33188468 TACATGGCAGGTGCTGTGTTGGG - Intronic
1067193113 10:44089236-44089258 TACATGCCAGGTTCTGGGCTAGG + Intergenic
1067204279 10:44200105-44200127 AACATGCCAGGTCTTGTCCTTGG + Intergenic
1068203490 10:53815308-53815330 TACATTCCAGTTGTTGAGCTAGG + Intronic
1069345316 10:67462783-67462805 TAATTGCCAGCTGTTGACCTAGG + Intronic
1069978831 10:72238019-72238041 TACATGCCAAGTAGTATCCTAGG - Intergenic
1069999908 10:72368581-72368603 TATATGCCAGGTCTTGTGCCAGG + Intronic
1070006553 10:72429806-72429828 TACTTGCCAGGTGCCATCCTAGG + Intronic
1070511734 10:77167496-77167518 AATGTGCCAGCTGTTGTCCTAGG - Intronic
1071068629 10:81666783-81666805 GAGAAGCCAGGTGCTGTCCTTGG + Intergenic
1072074450 10:91955308-91955330 TATTTGCCAGGTATTGTTCTAGG + Intronic
1072430268 10:95365043-95365065 TACGTGCCAGGTCCTGTGCTTGG - Intronic
1073043760 10:100624146-100624168 AGCATGCCAGGTGCTGTGCTAGG + Intergenic
1073201419 10:101738871-101738893 TACATGCCAGGTACTCTACTGGG - Intergenic
1073589970 10:104747728-104747750 TACATGCCAGGAACTGTGCTAGG - Intronic
1073786289 10:106893475-106893497 TATATGCCAGGCATTGTGCTAGG - Intronic
1074045776 10:109837852-109837874 CACATGCCAAGTATTGTGCTAGG + Intergenic
1074479227 10:113803465-113803487 TCCATGCTAGGTCTTGTGCTAGG - Intergenic
1074794616 10:116929771-116929793 TATATGCCAGGTTTTGTACTAGG + Intronic
1074947666 10:118296920-118296942 TACATGCCAGGCACTGTACTAGG - Intergenic
1075283490 10:121161899-121161921 TAAGTGCCAGATATTGTCCTAGG - Intergenic
1075391480 10:122095694-122095716 TACTAGCCAGGTGGAGTCCTGGG + Intronic
1075895923 10:125994345-125994367 TACATGCCAAGTCCTGTGCTAGG - Intronic
1075980940 10:126738641-126738663 ACCATGCCAGGTGTGGTTCTTGG - Intergenic
1076218371 10:128713628-128713650 TTCATGAAAGGTGTAGTCCTGGG + Intergenic
1076924199 10:133473588-133473610 TACATACCTGGAATTGTCCTAGG - Intergenic
1078094323 11:8287353-8287375 TACATGCCAAGCACTGTCCTAGG - Intergenic
1078491293 11:11771516-11771538 TATGTGCCAGGTGCTGTTCTAGG + Intergenic
1078922548 11:15844041-15844063 TAAAGGCCAGTTGTGGTCCTTGG + Intergenic
1079154241 11:17929628-17929650 TATATGCCAGGCGCTGTGCTAGG + Intronic
1079158193 11:17968371-17968393 TATACACCAGGTGCTGTCCTAGG + Intronic
1079734873 11:23984491-23984513 TTCTTGCCAAGTGTTGGCCTGGG - Intergenic
1079921565 11:26439983-26440005 TACATGTCAGGTTTTGTGGTTGG - Intronic
1080262261 11:30362094-30362116 TACATGCCAGGAATTGTTCCAGG - Intergenic
1080318652 11:30980168-30980190 TATATGCCAGATGCTGTGCTAGG - Intronic
1080849123 11:36052812-36052834 TACATGCAACTGGTTGTCCTTGG + Intronic
1081541414 11:44037157-44037179 GCCATGCCAGATGTTGTACTTGG + Intergenic
1082090308 11:48083709-48083731 TACATGCCAGACACTGTCCTGGG - Intronic
1084409476 11:68998067-68998089 TACATGCCAGGCAATGTTCTAGG - Intergenic
1084764893 11:71301811-71301833 AGCATGCCAGGTGTTGTGATGGG - Intergenic
1085184808 11:74566539-74566561 TACATGCCAGCTGCTGCTCTGGG + Intronic
1085318204 11:75558787-75558809 GACATGCAAGTTTTTGTCCTAGG + Intergenic
1085344771 11:75761562-75761584 TATATGCCAGGCCCTGTCCTGGG + Intronic
1085526944 11:77169680-77169702 TATATGCCAGGCATTGTCATGGG + Intronic
1085603335 11:77875235-77875257 TATGTGCCAGGAGTTGTGCTGGG + Intronic
1085862057 11:80245787-80245809 TCCATGCCAGGTCTGGTTCTTGG - Intergenic
1087192487 11:95269530-95269552 TACATGCCAGGTACTATTCTAGG - Intergenic
1087611890 11:100444658-100444680 TATATGCCAGGCATTGTGCTAGG + Intergenic
1088231629 11:107679015-107679037 TACATGCCAGGCATTCTGCTAGG + Intergenic
1088531098 11:110810506-110810528 TATATGCCAGGTACTGTTCTAGG - Intergenic
1088743985 11:112789277-112789299 CCCCTGCCAGGTGTTGTCTTAGG + Intergenic
1088746492 11:112808681-112808703 TACGAGCCAGGTGCTGTCCAGGG - Intergenic
1089175071 11:116542602-116542624 TGCATGCCAGGTGGTGAGCTAGG - Intergenic
1089298440 11:117483447-117483469 TATGTGCCAGGTCTTGTCCCGGG + Intronic
1089413800 11:118269878-118269900 GACATGCCAGGCATTTTCCTGGG + Intergenic
1089654324 11:119935835-119935857 TAAGTGCCAGGTGCTGTGCTGGG + Intergenic
1089661924 11:119991604-119991626 TACCTGCCAGGCCTTGTGCTGGG - Intergenic
1089811646 11:121136910-121136932 GACATGCCAGGCACTGTCCTAGG - Intronic
1089886713 11:121831923-121831945 TACATGCCAGGCTCTGTGCTTGG - Intergenic
1090253930 11:125269945-125269967 TATGTGCCAGGTGTTGTTGTGGG + Intronic
1090927641 11:131263024-131263046 GACATGCAAGGAGTTCTCCTAGG - Intergenic
1091443152 12:527309-527331 CCCATGCCAGGTGTTTGCCTGGG - Intronic
1091995908 12:4993938-4993960 TACATGCCAAGTGCTCTGCTGGG + Intergenic
1092480638 12:8856160-8856182 TACATGCTAGATATTGTGCTGGG - Intronic
1092830992 12:12444086-12444108 TACATGCCAGGCATTGTTCTAGG - Intronic
1093223762 12:16455457-16455479 TACCTGCCAAGTGCTGTGCTAGG - Intronic
1093819079 12:23589859-23589881 TACAAGCCAAGTATTGTGCTTGG + Intronic
1094094250 12:26686056-26686078 TACATTCCAGGCATTGCCCTTGG - Intronic
1094268103 12:28581337-28581359 TACAAGCCAGGTGTTGCTCCAGG - Intergenic
1094384381 12:29878171-29878193 TACATGTCAGGCATTGTTCTTGG - Intergenic
1094385858 12:29892740-29892762 TACGTGCCAAGTATTGTGCTAGG - Intergenic
1094643064 12:32295418-32295440 TATGTGCCAGGTGCTGTGCTAGG + Intronic
1095214213 12:39529001-39529023 TGTGTGCCAGGTTTTGTCCTAGG + Intergenic
1096253633 12:50050059-50050081 TACATGCCAGGCCTTGGGCTGGG - Intergenic
1097678780 12:62630184-62630206 TACATGCTGGGTGCTGTACTGGG - Intergenic
1098784337 12:74731222-74731244 TATATGCCAGGTGCTGTTCTAGG + Intergenic
1099140869 12:78973801-78973823 TATATGCCAAGTGATGTTCTAGG + Intronic
1099362153 12:81717661-81717683 TATATGCCAGGCACTGTCCTGGG + Intronic
1099783439 12:87230141-87230163 TAGATGCCAGGTACTGTACTAGG - Intergenic
1100675554 12:96863118-96863140 TATGTGCCAGGTATTGTTCTAGG - Intronic
1101268706 12:103119684-103119706 TATATGCCAGGTGTTGGGCTAGG - Intergenic
1101422250 12:104559266-104559288 TACATGCCAAGTACTGTGCTAGG - Intronic
1101521519 12:105486554-105486576 TATGTGCCAGGTGTTGTGTTTGG + Intergenic
1101861340 12:108484877-108484899 TATATGCCAGGTACTGTTCTAGG - Intergenic
1102307339 12:111815157-111815179 TACATGCCAGGAACTGTACTTGG + Intergenic
1102361572 12:112292534-112292556 TACATGCCAGGTAGTATCCTAGG - Intronic
1103039603 12:117684344-117684366 TATATGCCAGGCTTTGTGCTGGG - Intronic
1103176329 12:118866546-118866568 TAGATGCAAGGTGCTGTCCGAGG - Intergenic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1104514135 12:129408112-129408134 TGCATGTCAGGTGCTATCCTGGG - Intronic
1104548648 12:129735291-129735313 TAAATGCCAGGTGGTGTGATAGG - Intronic
1104646090 12:130498377-130498399 TATATGCCAGATTTTGTGCTGGG + Intronic
1104761156 12:131298421-131298443 TACGGGCCAGGTGCTGTCCTGGG + Intergenic
1104818619 12:131662371-131662393 TACGGGCCAGGTGCTGTCCTGGG - Intergenic
1105427197 13:20304102-20304124 CACATGCCAGGTACTGTGCTAGG + Intergenic
1105534020 13:21247522-21247544 TACCTGCCAAGTGCTGTCTTGGG + Intergenic
1106186134 13:27411676-27411698 TACATTCCAGGCATTGTTCTAGG - Intergenic
1106826623 13:33529522-33529544 CATATGCCAAGTGTTGTCCCAGG + Intergenic
1106871621 13:34028146-34028168 TAAATGCAATGTGGTGTCCTGGG - Intergenic
1107536209 13:41336213-41336235 TACATGCCAGGTACTGTTCTAGG - Intronic
1107732782 13:43365408-43365430 TGCATTACAGGTGTAGTCCTGGG + Intronic
1107826953 13:44337421-44337443 TACATGCCCAGGATTGTCCTTGG + Intergenic
1107979877 13:45724541-45724563 TATATGCCAGGTACTGTGCTGGG - Intergenic
1108224154 13:48270398-48270420 TACGTGCCAGGTGCTTTACTAGG - Intergenic
1108598000 13:51966167-51966189 AACATGGCTGGTGCTGTCCTAGG + Intronic
1109761436 13:66835076-66835098 GACATACCAGGCCTTGTCCTTGG - Intronic
1109997791 13:70152608-70152630 TACATGCCAGGTGCTACACTAGG - Intergenic
1110169878 13:72487866-72487888 TATGTGCCAGGTATTGTGCTAGG + Intergenic
1110717200 13:78719846-78719868 TAGATGCCAGTTGTGGTGCTAGG + Intergenic
1111066330 13:83097383-83097405 TACATGCCAGGCATTGTTTTAGG - Intergenic
1111666085 13:91270255-91270277 TACATTCCAGGAATTGTTCTTGG + Intergenic
1115146607 14:30233890-30233912 TACATGCCAAGTTTCTTCCTTGG - Intergenic
1115420730 14:33192050-33192072 CACCTGCCAGGTGTTGTCCATGG + Intronic
1115573103 14:34685685-34685707 TACATGCCAGCTGAGGTGCTAGG + Intergenic
1116509853 14:45731360-45731382 TACATGCCCGGTGTTGCGCTGGG + Intergenic
1116770435 14:49121111-49121133 TACAGTCAAGGTGTTGGCCTGGG - Intergenic
1117118583 14:52543618-52543640 TCTGTGCCAGGTGTTGTCTTAGG - Exonic
1118851719 14:69588901-69588923 TAAATGTCAGGTCTTGTGCTTGG + Intergenic
1119475804 14:74927134-74927156 TATATGCCAGATGCTGCCCTAGG - Intergenic
1119691169 14:76673891-76673913 TGCATGCCAGGTGCTGATCTTGG - Intergenic
1119862424 14:77946073-77946095 TACCTGCCTGGTGTAGTCCTTGG + Intergenic
1121787798 14:96675530-96675552 GCCATACCAGGTGTTGCCCTTGG - Intergenic
1122165157 14:99817704-99817726 TCTGTGCCAGGTGTTGTGCTAGG + Intronic
1124421644 15:29528048-29528070 TACCTTCCAGGTGCTGTGCTAGG + Intronic
1125057629 15:35380846-35380868 TACATCCAAAGTGTTCTCCTGGG - Intronic
1125721450 15:41847050-41847072 GACCTGCGAGGTGTGGTCCTGGG + Intronic
1126164386 15:45642066-45642088 TAAATGCCAGGGATTGTGCTAGG - Intronic
1126491946 15:49246869-49246891 TATATGCCATGCGTTGTTCTAGG + Intronic
1127615955 15:60685766-60685788 TGCCTTCCACGTGTTGTCCTTGG - Intronic
1127641824 15:60923375-60923397 TATGTGCCAGGTGCTGTGCTGGG - Intronic
1127732675 15:61815078-61815100 TACATGCCAGGCACTGTTCTAGG + Intergenic
1128306913 15:66604756-66604778 TACATGCCAGGTTCTGTTCTAGG - Intronic
1128360792 15:66960200-66960222 CACCTGCCAGGGGCTGTCCTGGG - Intergenic
1128619550 15:69137314-69137336 CCCATGCCAGGTGTTGGACTCGG + Intergenic
1128848387 15:70923510-70923532 TATATGCCAGGCATTGTTCTAGG + Intronic
1129411001 15:75350250-75350272 TTCATGCCAGGCCTTGTTCTAGG + Intronic
1129778598 15:78253871-78253893 TACATCCCAGGGAATGTCCTGGG + Intergenic
1130795996 15:87209985-87210007 TTCAAGCCAGGTGTTTTTCTTGG + Intergenic
1130980410 15:88808394-88808416 TACATGCCAGGCACTGTGCTAGG + Intronic
1131272878 15:90957471-90957493 TGCTGGCCAGGTGTTCTCCTGGG + Exonic
1131286746 15:91065693-91065715 TATCTGCCAGGTATTGTGCTAGG - Intergenic
1131775742 15:95796429-95796451 TATGTGCCAGATGTTCTCCTGGG + Intergenic
1131801712 15:96076048-96076070 TATAGGACAGGTGTTGTCCTGGG - Intergenic
1132200611 15:99952120-99952142 TGAGTGCCAGGTGCTGTCCTAGG + Intergenic
1132237676 15:100234347-100234369 CATATGCCAGGCGGTGTCCTGGG - Intronic
1132860037 16:2065917-2065939 TACTTCCCAGGTGCTGTGCTGGG - Intronic
1133365748 16:5208090-5208112 TGCAGGGCAGGTGTTCTCCTTGG + Intergenic
1133752993 16:8739110-8739132 TGCATGCCAAGTGCTGTGCTGGG + Intronic
1133867405 16:9657151-9657173 TACATACCAGGTTGTGTACTAGG - Intergenic
1134044651 16:11092399-11092421 CACATGCCAGGTGTGGTGGTGGG + Intronic
1134364214 16:13561717-13561739 TACGTGCCAGGTGATGGACTAGG + Intergenic
1135161690 16:20102225-20102247 TGCATGCCATCTGATGTCCTGGG + Intergenic
1135485601 16:22862111-22862133 TAAGTGCCAGGTGCTGTACTTGG - Intronic
1137256606 16:46780162-46780184 TAAATGTCAGGTGTTCTGCTAGG - Intronic
1137469631 16:48742969-48742991 TACCTGCCAGGTGGTCTCCTTGG - Intergenic
1137568257 16:49547717-49547739 TAAATGCTGGGCGTTGTCCTGGG + Intronic
1137641814 16:50038843-50038865 TACATGGCAAGTGTTTTGCTGGG + Intergenic
1137731034 16:50690662-50690684 TGCATGCCAGGTCCTGTTCTAGG + Intergenic
1139223137 16:65205286-65205308 TACATGCCAGGAAATGTTCTGGG + Intergenic
1139769061 16:69257904-69257926 TACATGCCAAATATTGTGCTAGG - Intronic
1141136896 16:81472532-81472554 TACATGCCATGCCCTGTCCTAGG + Intronic
1141275561 16:82584739-82584761 TACGTGCCAGGTGCTATCTTGGG + Intergenic
1142577928 17:921643-921665 GGCCTGCCAGGTGTTGTCCAGGG - Intronic
1142577975 17:921815-921837 GGCCTGCCAGGTGTTGTCCAGGG - Intronic
1143301590 17:5914656-5914678 TACATACCAGGCATTGTTCTAGG - Intronic
1145205608 17:20983641-20983663 TATGTGCCAGGTGCTGTGCTGGG + Intergenic
1145800483 17:27680495-27680517 TAAGTGCCAGGTGCTGTACTAGG + Intergenic
1145967486 17:28930374-28930396 TACATGCCAGGCATTGTACAGGG - Intronic
1146173171 17:30648357-30648379 TTCATGCCAGGTGCCGTGCTGGG + Intergenic
1146442800 17:32911846-32911868 TTCATGCCAGGTACTGTGCTAGG - Intergenic
1146482349 17:33214802-33214824 TGCATGCCAGCTGCTGTGCTAGG + Intronic
1146545191 17:33732316-33732338 TTCATGTCAGGCGCTGTCCTAGG + Intronic
1146604106 17:34243545-34243567 TAAATGCCAGGCCCTGTCCTAGG + Intergenic
1146926140 17:36747002-36747024 TAGATGCCATGTGCTGTACTTGG + Intergenic
1147322021 17:39652316-39652338 TGCATGCCAGGCATTGTGCTGGG + Intronic
1147457723 17:40548787-40548809 GACAGGACAGGTGTAGTCCTTGG + Intergenic
1148843617 17:50515356-50515378 TACATGCCAGGCACTGTGCTAGG - Intronic
1148964375 17:51422399-51422421 GACATGCCAGGTGTGGCCATAGG - Intergenic
1149418723 17:56487600-56487622 TATATGCCAGGTACTGTGCTGGG + Intronic
1150526356 17:65926849-65926871 TATGTGCCAGGTGCTGTCCCTGG - Intronic
1151396032 17:73823633-73823655 TCCTTGGCAGGTCTTGTCCTGGG - Intergenic
1151431987 17:74069946-74069968 AAAAGGCCAGGTGTTGCCCTTGG - Intergenic
1151777033 17:76211921-76211943 TACGTGCCAGGCTTTGTTCTAGG + Intronic
1153017361 18:596312-596334 CCCATGCCAGGTGCTGTCCTTGG - Intergenic
1153381895 18:4449587-4449609 TAAGTGCCAGGTGCTGTGCTAGG + Intronic
1154142690 18:11839126-11839148 TATATGCCAGGCATTGTTCTAGG - Intronic
1155188442 18:23408336-23408358 TATATGCCAGGCATTGTTCTTGG - Intronic
1155389688 18:25321424-25321446 TATAGGCCAGGTATTGTGCTAGG + Intronic
1156023431 18:32625205-32625227 AATATGCCAGGTGTCCTCCTAGG + Intergenic
1157029417 18:43887332-43887354 TAGATGCCAGGTACTGTTCTAGG - Intergenic
1157478720 18:48039454-48039476 TGCATGCCAGGGGCCGTCCTCGG - Intronic
1157889807 18:51404823-51404845 TATATGCCAGGGCCTGTCCTAGG - Intergenic
1158109048 18:53919681-53919703 TGTGTGCCAGGTGTTCTCCTAGG - Intergenic
1158553203 18:58454578-58454600 TATGTGCCAGGTGTTCTACTGGG + Intergenic
1158556282 18:58477371-58477393 TACACCAAAGGTGTTGTCCTAGG - Intergenic
1159135880 18:64336415-64336437 AACATGCCAGGTGCTTTACTAGG - Intergenic
1159669383 18:71204138-71204160 TATAAGCCAGGTATTCTCCTAGG - Intergenic
1160048989 18:75414339-75414361 TACATGCCAAGTACTGTGCTAGG + Intronic
1160301436 18:77684321-77684343 TATATGCCAGGTATTGTTCTAGG + Intergenic
1160624835 18:80196561-80196583 TACATACAAGGTGTTTTGCTGGG + Intronic
1161499157 19:4603832-4603854 TGCATGCCAGGTGCTCTTCTAGG + Intergenic
1161541998 19:4857612-4857634 TACAAGCCATGTGCTGTTCTGGG + Intronic
1162839022 19:13341904-13341926 TGTGTGCCAGATGTTGTCCTAGG - Intronic
1162989247 19:14291704-14291726 TTCATGCCAGGTGCCGTGCTGGG - Intergenic
1164798681 19:31057826-31057848 TACATGCCATGTACTGTTCTTGG + Intergenic
1165831366 19:38732132-38732154 TACATGCCAGGAGTTATTCCAGG - Intronic
1165958003 19:39514169-39514191 TACATGCCAGATCTTATTCTGGG + Intergenic
1166719419 19:44988636-44988658 CACATGCCAGGCACTGTCCTGGG + Intronic
1167011164 19:46809123-46809145 TATATGCCAGGTGCTTTTCTAGG - Intergenic
1167292114 19:48630116-48630138 TACATTCCAGGTCCTGTCATTGG - Exonic
1167397978 19:49244008-49244030 TACATGCCAGGTTCGGTTCTGGG + Intergenic
1168073493 19:53965524-53965546 TAGATGCCACGTGCTGTCCTAGG - Intronic
1168096960 19:54121470-54121492 TGTGTGCCAGGTGCTGTCCTGGG + Intronic
925003660 2:425977-425999 GCCATGCCAGGTGTAGTCCTGGG - Intergenic
925856932 2:8138132-8138154 TAAGTGTCAGGTGCTGTCCTAGG - Intergenic
926513013 2:13806019-13806041 TATGTGACAGGTATTGTCCTAGG - Intergenic
926602862 2:14864847-14864869 TACATGGCAGGTTCTGTTCTAGG - Intergenic
926729043 2:16020831-16020853 TATGTGCCAGTTATTGTCCTGGG - Intergenic
926946666 2:18195449-18195471 TACATGCGAAGTTTTTTCCTTGG - Intronic
927180746 2:20445306-20445328 TAAATGCCAGGCATTGTGCTGGG + Intergenic
927709108 2:25314226-25314248 CACAGGCCAGGTGTGGCCCTGGG - Intronic
927800135 2:26091146-26091168 TAAATGTCAGGTATTGTTCTAGG + Intronic
927861712 2:26564040-26564062 GACATGCCAGGTGTTATGTTAGG + Intronic
928389741 2:30899962-30899984 TATGTGCCAGATGCTGTCCTGGG + Intergenic
928448429 2:31354099-31354121 TACATTCCACGTGTTGTCCATGG - Intronic
928657866 2:33472171-33472193 TACATGCCAGGCATTGTATTAGG + Intronic
928705540 2:33945900-33945922 TCCATCCCAGGTGTTGTTCTAGG + Intergenic
929870929 2:45758756-45758778 TACATTCCAGGCAGTGTCCTAGG - Intronic
930745136 2:54874970-54874992 GGCATGCCAGGAGTTCTCCTAGG + Intronic
930886694 2:56334275-56334297 TATGTGCCAGGTATTGTTCTAGG - Intronic
931101224 2:59003203-59003225 TGCAAACCAGGTGTTGTTCTAGG - Intergenic
931563850 2:63592794-63592816 TACAGGACAGGTGTTGTTCTAGG + Intronic
931608082 2:64071661-64071683 TATAAGCCAGGTGTTGTGGTGGG - Intergenic
931704841 2:64938660-64938682 TAGATGCCAGGTGCTGCTCTAGG + Intergenic
933218640 2:79661773-79661795 TAAATGCCTGGTGCTGACCTAGG + Intronic
935865433 2:107382433-107382455 TATGTGCCAGATGTTGTTCTGGG - Intergenic
936077450 2:109410693-109410715 TACCTGCCAGGATTTGGCCTAGG - Intronic
936948438 2:117952614-117952636 TACATGTCAGCTGATGTACTAGG + Intronic
938896935 2:135761337-135761359 TACAGGCCAGGTTTGATCCTGGG - Intronic
939956619 2:148532810-148532832 TTCATGCCAGGACTTGTGCTGGG + Intergenic
941369249 2:164643819-164643841 TGAATGCCAGGTGCTGTTCTAGG - Intergenic
941733587 2:168947371-168947393 TACATCCCAAGTGCTGTGCTTGG + Intronic
942079640 2:172387878-172387900 TACATACCAGGTGTTGTATTTGG + Intergenic
942230071 2:173852715-173852737 TATATGCCAGGCACTGTCCTGGG + Intergenic
942296959 2:174527261-174527283 TACATGCTAGGTACTGTTCTAGG + Intergenic
942299285 2:174546811-174546833 AACATGCCAGGCTTTTTCCTTGG - Intergenic
943072602 2:183158980-183159002 TACATTCCAGGCATTGTGCTTGG + Intronic
945132271 2:206585668-206585690 CACATGCCTGGTGTTGTTGTAGG + Intronic
945308787 2:208286184-208286206 TACATGCCATGCGCTGTTCTTGG - Intronic
945834336 2:214821257-214821279 TACATCCCTGGTGCTGTCCTAGG - Intergenic
946372306 2:219288260-219288282 TGCATGTCAGGAGGTGTCCTTGG - Intergenic
947043446 2:225949922-225949944 TACATGCCACTTGTGGGCCTGGG + Intergenic
947199557 2:227602220-227602242 TCTTTGCCAGGTGTTGTGCTGGG - Intergenic
948202916 2:236142668-236142690 TATATGCAAGGTGTTGTTTTGGG - Intergenic
948505557 2:238425102-238425124 TCCCTGCCACGTGTTGCCCTTGG - Intergenic
948555050 2:238803826-238803848 TTGATGACAGGTTTTGTCCTAGG + Intergenic
948903870 2:240968757-240968779 TACATGCCAGGCTTTGTGCTGGG + Intronic
948929422 2:241122598-241122620 CACATGCCAGGTTGTGTGCTTGG + Intronic
1169274352 20:4223458-4223480 TCCCTGCCAGGTGCTGTGCTGGG + Intronic
1170416210 20:16145301-16145323 TCCACTCCAGGTGATGTCCTAGG + Intergenic
1170434074 20:16306211-16306233 TACATCCCAGATGTATTCCTGGG + Intronic
1170457133 20:16543802-16543824 TACATGTGAGGTGATGTCATGGG - Intronic
1172052997 20:32133630-32133652 TACATGCCAGGCATTGTGCATGG + Intronic
1172119016 20:32586705-32586727 TGTGTGCCAGGTGTTGTGCTAGG - Intronic
1172639670 20:36433119-36433141 TGCATGCCAGATCCTGTCCTGGG - Intronic
1172744078 20:37193247-37193269 CACATGCCAGGTGCTGTTCTAGG - Intronic
1172777706 20:37417068-37417090 TACATGCCAGGCGCTGTTCTAGG - Intergenic
1172908099 20:38384552-38384574 TATGTGCCAGGTGCTGTTCTAGG - Intergenic
1173982431 20:47235214-47235236 TACATGCCAGGCATTGTTCTAGG + Intronic
1174294103 20:49531954-49531976 TAAAGGCCAAGTGTTGTTCTGGG + Intronic
1174506112 20:51018634-51018656 TAAGTGCCAGGTGCTGTGCTAGG + Intronic
1174703099 20:52629144-52629166 TACTTGCCAGGTGCTGTGCTAGG + Intergenic
1174737830 20:52982566-52982588 TATGTGCCAGGTATTGTTCTAGG + Intronic
1174748633 20:53089507-53089529 TACATGCCAGGCACTGTACTTGG + Intronic
1174896803 20:54457965-54457987 GCAATGCCAGGGGTTGTCCTAGG + Intergenic
1175164373 20:57032970-57032992 TACATCCCAGGCATTGTCCTAGG + Intergenic
1175201431 20:57280496-57280518 TACCTGCCAGGTGTTGAACCAGG - Intergenic
1175335902 20:58196169-58196191 TACGTGCCAGGTGCTGTTCTGGG - Intergenic
1175458669 20:59134374-59134396 TACATGTCAGGCACTGTCCTTGG - Intergenic
1175657059 20:60780153-60780175 TATGTGCCAAGTATTGTCCTGGG + Intergenic
1176222787 20:63978061-63978083 CACATGGCCGGTGTTGTCCCGGG - Intronic
1176359924 21:5986645-5986667 TACGTGCCAGGTCCTGTTCTAGG + Intergenic
1178226081 21:30720261-30720283 TAAATGCCAGGTATTGTAGTAGG + Intergenic
1179113882 21:38472141-38472163 TATGTGCCAGGAGTTGTTCTAGG - Intronic
1179344801 21:40546555-40546577 TCCATGCCAGGAGCTGTGCTTGG - Intronic
1179489405 21:41730447-41730469 TACATGCCAGCTGCTGGACTAGG - Intergenic
1179763594 21:43551905-43551927 TACGTGCCAGGTCCTGTTCTAGG - Intronic
1180683643 22:17647579-17647601 TATATGCCAGGTAATGTACTAGG - Intronic
1180798966 22:18622817-18622839 TAAATGCCACCTGGTGTCCTGGG - Intergenic
1181134288 22:20753469-20753491 TAAATGCCACCTGGTGTCCTGGG - Intronic
1181222752 22:21372449-21372471 TAAATGCCACCTGGTGTCCTGGG + Intergenic
1182022033 22:27089514-27089536 TCCATGCCAGGCACTGTCCTAGG + Intergenic
1182352424 22:29706340-29706362 TACGTGCCAGGTGCTGTGCTGGG - Intergenic
1182963612 22:34501307-34501329 TAAATGCTAGCTGTTGTCATTGG + Intergenic
1183008135 22:34920580-34920602 TACAGTCTAGCTGTTGTCCTAGG - Intergenic
1183154534 22:36065152-36065174 TACATGCTAGGTTCTGTGCTAGG + Intergenic
1183244975 22:36686460-36686482 TACATGCCAGCTGATACCCTTGG - Intronic
1183370467 22:37428889-37428911 CACAGGCCACTTGTTGTCCTGGG + Intergenic
1185308285 22:50135813-50135835 TACATGCCAGGTATTGTCCTGGG + Intronic
1185414478 22:50702316-50702338 GACGTGCCAGGTGCTGTGCTGGG + Intergenic
949164983 3:929149-929171 TATATGCCAGGCATTATCCTAGG - Intergenic
950251775 3:11471443-11471465 TACATGCCAGGTGTTATGCTAGG - Intronic
950315925 3:12002353-12002375 TACATGCCAGGTCCTGTGTTTGG + Intergenic
950688066 3:14633210-14633232 TACATGCAAGGAACTGTCCTAGG - Intergenic
951546985 3:23836384-23836406 CACATGCCATGTGCTGTACTGGG + Intronic
951589175 3:24244645-24244667 AACATGCCTGGAGTTTTCCTTGG - Intronic
952911240 3:38188956-38188978 TACGTGCCAGGTATAGTGCTAGG - Intronic
953904926 3:46863801-46863823 TACATGCTACGTGTTGTGTTGGG + Intronic
955533432 3:59898861-59898883 GACATGCCAGGTATTATACTAGG + Intronic
955689029 3:61572607-61572629 AGCATGCCAGGTGCTGTTCTAGG + Intronic
955763193 3:62311429-62311451 TACATGGCAGCTGATGCCCTGGG - Intergenic
955944996 3:64185083-64185105 TACATGTTAGATATTGTCCTTGG + Intronic
956012312 3:64844777-64844799 TACATGTCTGGTGCTGTTCTAGG - Intergenic
956197106 3:66664001-66664023 CACATGCCAGGTGCTGTGCTAGG + Intergenic
956437390 3:69247157-69247179 TATAAGCCAGATGTTGCCCTGGG + Intronic
956499262 3:69864372-69864394 TACATGCCAGGTACTGTACCAGG - Intronic
956887001 3:73570180-73570202 TACATGCCCATTGTTGTCCTTGG - Intronic
956898300 3:73686339-73686361 TACATGCCAGGTACTGTGCTAGG - Intergenic
956994939 3:74815321-74815343 TATATGCCAGCTGCTGTGCTAGG - Intergenic
957143081 3:76386403-76386425 TATATGTCAGGTATTGTTCTAGG + Intronic
958094243 3:88921661-88921683 TATGTGCCAGATGTTGTTCTGGG + Intergenic
959084338 3:101835075-101835097 TATGTGCCAGGAGTTGTGCTAGG + Intronic
959400667 3:105898253-105898275 TACATGCCAGGCAATGTGCTTGG + Intergenic
959621896 3:108407804-108407826 TACATGCCAGGCAATGTTCTAGG + Intronic
960260303 3:115560314-115560336 TACATCCCAGGTGATGCCCCAGG - Intergenic
961752317 3:129104056-129104078 TACATGCCAGGCACTGTGCTAGG - Intronic
961786540 3:129350445-129350467 TATGTGCCAGGAATTGTCCTAGG - Intergenic
962255005 3:133864571-133864593 CACATACCAGGTGAGGTCCTGGG - Exonic
962296875 3:134198388-134198410 TACATGTCAGGTACTGTACTGGG + Intronic
962829258 3:139125569-139125591 TACATGGCAGGCGCTGTGCTAGG - Intronic
962930340 3:140030179-140030201 AATGTGCCAGGTGCTGTCCTGGG + Intronic
963018581 3:140849563-140849585 TCCATGCCAGTTGGAGTCCTGGG - Intergenic
963807956 3:149745379-149745401 TATATGCCAGGTATTGTGCTGGG + Intronic
964105265 3:153032553-153032575 TACATGTCAGGTGCTGGTCTTGG - Intergenic
964559617 3:157979669-157979691 TACATACCAGGTGCTGTGATAGG + Intergenic
965137501 3:164790596-164790618 TACTTGCCATGTGTTTTCTTGGG - Intergenic
965437085 3:168665778-168665800 TACATGCCAGGTCTTGTGCAAGG - Intergenic
966330065 3:178801922-178801944 TACATTCCAGGCACTGTCCTAGG - Intronic
966729888 3:183141965-183141987 TCCATGCCAGGGATTGTTCTTGG + Intronic
967943823 3:194786775-194786797 TATATGCCAGATGCTGTGCTAGG + Intergenic
968007146 3:195250856-195250878 TATGTGCCAGGTGCTGTCCTGGG - Intronic
969065009 4:4472310-4472332 TACATGCCAGGTACTGTGCATGG + Intronic
969509284 4:7608469-7608491 TACATGCCAGGTGTTGTCCTGGG - Intronic
969795251 4:9522872-9522894 TGCAGGGCAGGTGTTCTCCTTGG + Intergenic
970203998 4:13637943-13637965 TATGTGCCAGGTGTTGTACTAGG + Intergenic
970493559 4:16602164-16602186 TACAGGCCAGATATTGTTCTAGG + Intronic
970508366 4:16755809-16755831 TACCTTCCTGGTGTTGTCCAGGG + Intronic
971110553 4:23580602-23580624 TTTGTGCCAGGTGTTGTGCTGGG + Intergenic
971354255 4:25880064-25880086 TATATGCCAAGTGTTGTGCTTGG - Intronic
971371062 4:26019329-26019351 TACATGCCAGGCATTGTACCAGG + Intergenic
973549887 4:52023250-52023272 TACATCCTAGGCATTGTCCTAGG - Exonic
973570108 4:52230014-52230036 TATATTCCAGGTATTGTTCTAGG - Intergenic
973735634 4:53868999-53869021 TGTGTGCCAGGTGCTGTCCTGGG - Intronic
973849162 4:54944440-54944462 TAGATGCCTGGTGTTGCACTGGG - Intergenic
974922381 4:68257864-68257886 TAGCTGCCAGGAGTTGTACTAGG + Intergenic
975712815 4:77177246-77177268 TACCTGCCAGCTGTTGTCGCAGG + Intronic
975893403 4:79056392-79056414 TATATGCCAGGTATTTTTCTAGG - Intergenic
978133201 4:105225275-105225297 AACATGCCATGTATTTTCCTAGG + Intronic
978259904 4:106743021-106743043 TACATGCCAGACATTGTCCTAGG + Intergenic
979316707 4:119273520-119273542 TATATGCCATGTGCTGTTCTAGG - Intronic
979467192 4:121054369-121054391 TACATGCCAGGTACTCTTCTAGG + Intronic
981678747 4:147370110-147370132 TGCATGCCATCTGTAGTCCTAGG - Intergenic
982357362 4:154485594-154485616 TACATGCCAGGAACTGTTCTTGG - Intronic
982358565 4:154494130-154494152 TACATGCTAGGTACTGTTCTAGG - Intergenic
982550756 4:156796432-156796454 TTCATGCAAGATGTTATCCTTGG + Intronic
983184435 4:164685362-164685384 TACATGCAATGTCTTTTCCTAGG - Intergenic
983972636 4:173893387-173893409 TACATACCAGAGGTTGTTCTTGG - Intergenic
986451574 5:7869924-7869946 TTCATGCCAGGTGCCGTTCTGGG + Intronic
986787397 5:11127065-11127087 TCCCTGCCAGGTCCTGTCCTTGG - Intronic
987038316 5:14039263-14039285 TACGTGCCAGGCATTGTTCTAGG - Intergenic
987206556 5:15633642-15633664 TAAATGTCAGGTATTGTACTTGG + Intronic
987277138 5:16374112-16374134 TTTATGTCAGGTATTGTCCTGGG - Intergenic
989106937 5:37871712-37871734 TACATGCCTGGTGCTATGCTAGG - Intergenic
989142133 5:38211960-38211982 TAAATGCCAGGTTTTGCTCTTGG + Intergenic
989430838 5:41353569-41353591 TATATGCCAGGAATTGTTCTAGG + Intronic
990227050 5:53666579-53666601 TATATGTCAGGTTTTGTGCTAGG - Intronic
990299033 5:54432316-54432338 TACAGTCAAGGTGTTGTCCAGGG + Intergenic
990314532 5:54571610-54571632 TACTTGGGAGGTGGTGTCCTTGG + Intergenic
990448626 5:55915866-55915888 TACATGCCAGGTGCTGGGCTAGG + Intronic
990906183 5:60805873-60805895 TACATGCCAGGCGTTGGTCTAGG - Intronic
991312926 5:65264799-65264821 TACATGCCAAGTGCTATTCTAGG - Intronic
992139968 5:73786151-73786173 TACGTGCCAGGCATTGTTCTAGG + Intronic
993060435 5:83031991-83032013 TATATACCAGGCGTTGTGCTTGG + Intergenic
993090702 5:83422448-83422470 TACATGTTAGGTGCTGTGCTAGG - Intergenic
994878292 5:105452366-105452388 TATATGCCAGATGTTGCCCAAGG + Intergenic
995060782 5:107809845-107809867 CATATGCCAGGCATTGTCCTAGG + Intergenic
995074076 5:107960814-107960836 TTCATGCCAGGTACTGTGCTGGG + Intronic
996631560 5:125639162-125639184 TACTTGCCAGGCCTTCTCCTTGG + Intergenic
996658270 5:125967502-125967524 GAAATGCCAGGGGTTGTTCTAGG + Intergenic
996975737 5:129432191-129432213 TCCTTTCCAGGTGTTTTCCTAGG - Intergenic
997258751 5:132449271-132449293 TATATGCCAGGCACTGTCCTAGG - Intronic
998006856 5:138662787-138662809 TATGTGCCAGGCGCTGTCCTGGG - Intronic
998190113 5:140016509-140016531 TACGTGCCAGGCATTGTGCTAGG + Intronic
998226061 5:140327168-140327190 TCCATGCCGTGTGTTGTCCGTGG + Intergenic
998385562 5:141755247-141755269 TCCGTGCCAGGTGCTGTGCTGGG + Intergenic
998437377 5:142123451-142123473 TAGATGCCAGTTGTAGTCCATGG + Intronic
998861605 5:146449298-146449320 TACATGACAGTTGCTGACCTAGG + Intronic
998895285 5:146792414-146792436 TATATGCCAAGTACTGTCCTAGG + Intronic
998985719 5:147754303-147754325 TATATGCCAGGATGTGTCCTGGG + Intronic
999266852 5:150272113-150272135 TGAGTGCCAGGTGCTGTCCTAGG + Intronic
999364235 5:151011360-151011382 TACGTGCCTGGTATTCTCCTAGG + Intergenic
999516026 5:152302347-152302369 TACATGCCAGGTACTGTGCCCGG - Intergenic
999656855 5:153818946-153818968 TACATGCCAGACATTGTGCTGGG - Intergenic
1000002365 5:157151245-157151267 TACATGCCAGCTACTTTCCTAGG + Intronic
1000478400 5:161741810-161741832 TAAATGCCAGGTTTTTTGCTAGG + Intergenic
1001018547 5:168163311-168163333 TACAGGCCAGGTTTGGTCCATGG - Intronic
1001221733 5:169906166-169906188 TACATGCCAGGCATTGTGCCCGG + Intronic
1001278389 5:170367480-170367502 TCTATGCCAGGTCTTGTGCTGGG - Intronic
1001675704 5:173513098-173513120 TATATGCCAGATATTGACCTAGG - Intergenic
1001875736 5:175198787-175198809 TACATGCCAGGTGGTGTTTTAGG + Intergenic
1002156119 5:177281466-177281488 TATGTGCCAGGTATTGTGCTGGG + Intronic
1003377099 6:5589317-5589339 TACCTGCCAAGTGCTGTCTTGGG - Intronic
1003635788 6:7830358-7830380 TATGTGCCAGGTGCTGTGCTGGG + Intronic
1003909228 6:10728239-10728261 TACATGTCAAGTGCTGTGCTAGG - Intronic
1004237485 6:13887212-13887234 TATGTGCCAGGTACTGTCCTAGG - Intergenic
1004985616 6:21078926-21078948 TCTATGCCAGGTATTGTGCTAGG - Intronic
1006923792 6:37643176-37643198 TGACTGCCAGGTGATGTCCTGGG - Intronic
1008153314 6:47982814-47982836 TATCTGCTAGGTGTTGTGCTAGG - Intronic
1008833634 6:55800555-55800577 TACATGCCTGGTGTGCTACTAGG - Intronic
1008868952 6:56248601-56248623 TATATTCCAGGTATTGTTCTAGG - Intronic
1010009647 6:71035743-71035765 TATATGTCAGGTGCTGTGCTAGG + Intergenic
1010012049 6:71059379-71059401 TATATGCCAGGCATTGTGCTAGG - Intergenic
1010410258 6:75553315-75553337 TATATGCAAGGTATTGTCTTAGG - Intergenic
1010720368 6:79276630-79276652 TGCATGCCAGGCATTGTTCTGGG + Intergenic
1011506758 6:88053195-88053217 TCCATGCGATTTGTTGTCCTAGG + Intronic
1012541343 6:100365870-100365892 TATGTGCCAGATGTTGTTCTAGG + Intergenic
1013459643 6:110362949-110362971 TACATGCCAGATACTGTTCTAGG - Intergenic
1014052165 6:116967280-116967302 TACATGCTAGGCATTGTGCTTGG - Intergenic
1014172744 6:118296789-118296811 CACATTCCAGGCATTGTCCTGGG - Intronic
1015684230 6:135841553-135841575 TACATGCCAGGTACTGTGCTAGG + Intergenic
1016071430 6:139743738-139743760 TACAAGGCACTTGTTGTCCTTGG + Intergenic
1017209645 6:151840897-151840919 TACATGCCAGGTACTGTGCTGGG + Intronic
1018356326 6:163021334-163021356 TAGAAGCCAGGAGTTGTCCTTGG + Intronic
1019271252 7:150283-150305 GAGAGGCCAGGTGTTGGCCTGGG + Intergenic
1019692826 7:2426219-2426241 TCCATGCCAGGTCCTATCCTGGG - Intronic
1020383853 7:7576245-7576267 TATATGCCAGGAGTTATCCTAGG + Intronic
1020967949 7:14896306-14896328 TGCATGCCAGATGTTCTTCTGGG + Intronic
1021812663 7:24418339-24418361 TATGTGCCAGGTGCTGTCCTGGG + Intergenic
1022109756 7:27220986-27221008 TATATGACAGGTGCTGTGCTAGG + Intergenic
1022567503 7:31417804-31417826 TATGTGCCAGGTCCTGTCCTAGG - Intergenic
1022833735 7:34094207-34094229 TACATGCTAGGTTCTGTCATAGG + Intronic
1023954500 7:44873422-44873444 TATATTCCAGGTATTGTACTAGG - Intergenic
1024823308 7:53359834-53359856 TGAATGCCAGGTGTGATCCTGGG - Intergenic
1024868013 7:53925978-53926000 TGCATGCCAGGTCCTGTTCTGGG - Intergenic
1026766589 7:73164038-73164060 TAAATGACAGGTGAGGTCCTTGG - Intergenic
1027043067 7:74973737-74973759 TAAATGACAGGTGAGGTCCTTGG - Intronic
1027080580 7:75228622-75228644 TAAATGACAGGTGAGGTCCTTGG + Intergenic
1027200085 7:76058521-76058543 TATATACCATGTGTTTTCCTAGG + Intronic
1027770078 7:82395390-82395412 TACTTGCCAGGGGTTATCCACGG + Intronic
1028342849 7:89744458-89744480 TATTTGCAAGGTGTTGTGCTAGG - Intergenic
1028454185 7:91020382-91020404 TCAATGCCAGGCATTGTCCTAGG + Intronic
1028704139 7:93818033-93818055 TCTATGCCAGTCGTTGTCCTAGG - Intronic
1029389779 7:100267231-100267253 TAAATGACAGGTGAGGTCCTTGG + Intronic
1029468213 7:100739351-100739373 AATATGCCAGGTGCTGTCCTAGG + Intronic
1030333420 7:108297579-108297601 TACATGCCAGGCAGTGTTCTTGG + Intronic
1031257627 7:119475926-119475948 TACATGCCAGGTACTGTTCTCGG - Intergenic
1032131187 7:129229364-129229386 TATGTGCCAGGAGTTGTCATAGG + Intronic
1032403279 7:131638366-131638388 TACAAGCCAGGTGATGGGCTCGG + Intergenic
1033147220 7:138881810-138881832 AGCAGGTCAGGTGTTGTCCTAGG - Intronic
1034036450 7:147828583-147828605 TAGATGCCAGATGTTGTCAGAGG - Intronic
1034433167 7:151050944-151050966 TACATGCCAGGTGAGGGGCTGGG + Exonic
1035600374 8:893753-893775 GCCCTGCCAGGTGCTGTCCTAGG + Intergenic
1036217859 8:6895882-6895904 TACGTGCCAACTGTTGTCATGGG - Intergenic
1036450074 8:8858219-8858241 TACATGCCAAGCATTGTCTTAGG + Intronic
1036733968 8:11291286-11291308 TATATGCTAGGTGCTGTACTAGG + Intronic
1037613505 8:20496155-20496177 TACATGCCAGTTCTAGTGCTAGG - Intergenic
1037708583 8:21336565-21336587 TACATGCCAGGCACTGTTCTAGG - Intergenic
1038755535 8:30337113-30337135 TACATGCCAGGAGTTTTACCAGG + Intergenic
1038919815 8:32070157-32070179 TATATGCCAGATACTGTCCTGGG + Intronic
1039246880 8:35618609-35618631 CACATGCCAGGCTTTCTCCTAGG + Intronic
1039993382 8:42509211-42509233 TACATACCAGGTACTGTTCTTGG - Intronic
1040930882 8:52733912-52733934 TGTATGCCAGGTGTTGTTTTTGG - Intronic
1041137104 8:54771477-54771499 TACAGGGAAGGTGTTGACCTAGG + Intergenic
1041297482 8:56373714-56373736 TACACGTTAGGTATTGTCCTAGG + Intergenic
1041340867 8:56844117-56844139 TATGTGCCAGATGTTGTGCTGGG - Intergenic
1042679494 8:71366672-71366694 TACATGCCAGGCACTGTGCTAGG + Intergenic
1043837153 8:85061064-85061086 TACATGCCAGGAACTGTTCTAGG + Intergenic
1044512249 8:93095940-93095962 TGCAATCCAGGTGTTGTCCAGGG + Intergenic
1044726825 8:95201124-95201146 TACATGCCAGGCACTGTCATAGG - Intergenic
1046715331 8:117560755-117560777 TACCGGCCAAGTGTTGTTCTAGG - Intergenic
1047015960 8:120723803-120723825 TATGTGCTAGGTATTGTCCTGGG - Intronic
1047163777 8:122413019-122413041 TATGTGCCAGGTACTGTCCTTGG + Intergenic
1047277603 8:123417351-123417373 TATATGCCACGCGTTGTTCTGGG + Intronic
1047969968 8:130076222-130076244 TACATGCCAGGTGCTGCTCTAGG + Intronic
1048342157 8:133548526-133548548 CACATGCCAAGTGGTGTGCTGGG - Intronic
1048883443 8:138888850-138888872 TACATGCTAGGAGCTGTTCTAGG - Intronic
1049214112 8:141399789-141399811 TACCTGCCAGGTTGTGTTCTTGG + Intronic
1050120270 9:2300461-2300483 TATATGCCAGGGGTTATGCTAGG - Intergenic
1050886622 9:10774766-10774788 TACATGTTAGGTATTTTCCTTGG + Intergenic
1051374689 9:16391153-16391175 TGCATGCCAGGCATTGTTCTAGG - Intergenic
1052405962 9:28061173-28061195 TAGATGCCAGGTTCTGTGCTAGG - Intronic
1052983009 9:34462515-34462537 TATATTCCAGGTATTGTGCTAGG - Intronic
1053091638 9:35283562-35283584 TACATTCCAGGTTTTGTTCTAGG + Intronic
1053255489 9:36613753-36613775 AACATGCCTGGTGTTGTCAAGGG + Intronic
1055311519 9:74986958-74986980 TACACTCCAGCTGTTGTCTTTGG - Intronic
1057325271 9:94057548-94057570 TAAAAGCCAGGTGTTGTGGTAGG + Intronic
1058202158 9:102057426-102057448 GACATGCCAGCCATTGTCCTTGG - Intergenic
1058419266 9:104819109-104819131 TATATGCCAGGCATTGTGCTAGG + Intronic
1058573700 9:106377043-106377065 TATGTGCCAGGTGTTGTACTAGG - Intergenic
1059531982 9:115043589-115043611 TGCATGCCAGATGCTGTGCTGGG - Intronic
1059693910 9:116712904-116712926 TACATGCCAGGAGGTATGCTGGG - Intronic
1059694028 9:116713837-116713859 TACATGCCAGGAGATATGCTGGG - Intronic
1059984284 9:119806832-119806854 TATGTACCAGGTGCTGTCCTAGG - Intergenic
1060241448 9:121907168-121907190 TACATTCCAGGCATTGTGCTGGG + Intronic
1060995251 9:127872164-127872186 TTCCAGCCAGGTGCTGTCCTGGG + Intronic
1061132920 9:128718329-128718351 TACGTGGCTTGTGTTGTCCTGGG + Exonic
1061923475 9:133794753-133794775 CACATGCCAGGTGCTGTGCCTGG + Intronic
1185865758 X:3622514-3622536 GACAAGCCAGGTGACGTCCTAGG + Intronic
1186458304 X:9728197-9728219 TACATGCCAGGTGTTGTCTGGGG - Intronic
1186546029 X:10450471-10450493 TACATGCCAGGTCCTGTGCCTGG - Intronic
1186817441 X:13251850-13251872 TAAATGCAATGTGGTGTCCTGGG - Intergenic
1187230465 X:17416707-17416729 TAGATGCCAGGTGCTATGCTGGG - Intronic
1187967661 X:24628317-24628339 TATATGCCAGGTACTGCCCTGGG - Intronic
1187980269 X:24749199-24749221 TGCATGCCAGGCATTGTTCTAGG + Intronic
1188350299 X:29121905-29121927 TATTTGCCAGGTGTTATGCTAGG + Intronic
1189046341 X:37595662-37595684 TAGATGTCAGGTATTGTACTAGG - Intronic
1189715536 X:43861176-43861198 TACATGCCAGATATTCTCCCGGG - Intronic
1190216623 X:48483231-48483253 TGTATGTCAGGTGTTGTTCTAGG + Intronic
1190375410 X:49784162-49784184 TACATGCCAAGCGCTGTACTAGG - Intergenic
1191047130 X:56150484-56150506 TACATCCCAGGTGTTGTACCAGG - Intergenic
1191729479 X:64318005-64318027 TCCATGCCCTGTGTTGTCATTGG - Intronic
1191791955 X:64980546-64980568 TACATGCCAGGCACTCTCCTAGG + Intronic
1191845693 X:65546058-65546080 TACTTGCCAGGTTTTGTGTTGGG + Intergenic
1192179675 X:68908701-68908723 TATGTGCCAGGTGTTATGCTAGG + Intergenic
1192833935 X:74779555-74779577 AACATGTCAGGTGTTGTGCATGG - Intronic
1193844998 X:86457558-86457580 TACATGCTAGGTTTTGTTTTAGG + Intronic
1194231436 X:91329936-91329958 TACATACCAGGTGCTGTGTTAGG + Intergenic
1194562746 X:95443320-95443342 TATAGGCCAGGTATTGTGCTTGG - Intergenic
1195270957 X:103230532-103230554 TATGTGCCTGGTGCTGTCCTAGG + Intergenic
1195702893 X:107718017-107718039 CACAGGGCAGGTGTTTTCCTGGG - Intronic
1195775125 X:108394647-108394669 TACATGCCAGACATTGTGCTAGG - Intronic
1196049282 X:111288273-111288295 TATGTGCCAGGTGCTGTGCTAGG - Intergenic
1196200374 X:112879864-112879886 TACATGCCAGGCACTGTGCTTGG - Intergenic
1196678698 X:118447933-118447955 TACATGCCAGGCATTTTGCTAGG - Intronic
1196947049 X:120837690-120837712 TACATGGCAGGTACTGTGCTAGG - Intergenic
1197763631 X:130045027-130045049 TAGATTTCAGGTGCTGTCCTGGG + Intronic
1198086941 X:133290850-133290872 TATGTGCCAGGTATTGTGCTAGG - Intergenic
1198183541 X:134233097-134233119 AGCATGCCAGTTGTTGGCCTAGG - Intergenic
1198221199 X:134604148-134604170 TACACCCCTGGTGTTGTCCAAGG - Intronic
1198520440 X:137447024-137447046 TATATGCCAGGCATTGTGCTAGG + Intergenic
1198676965 X:139141317-139141339 TACATTCCAGGCATTGTCCTCGG - Intronic
1199300426 X:146207135-146207157 TAAAATCCAGGTGTTGGCCTGGG + Intergenic
1199427208 X:147716821-147716843 TATATGCAAGGTATTATCCTAGG - Intergenic
1199519524 X:148719844-148719866 TACATGCCAGGAGCTCTGCTGGG - Intronic
1200798045 Y:7359837-7359859 TGCAAGCCAGGTGATGTCCCAGG - Intergenic
1201360966 Y:13148434-13148456 TAAATGCCAGGAGTTGTACCTGG + Intergenic
1201447806 Y:14077502-14077524 TACATGCCAAGTGCTATGCTTGG + Intergenic
1201687471 Y:16722798-16722820 TACATGTCAGGTGGTGTCACTGG + Intergenic