ID: 969510293

View in Genome Browser
Species Human (GRCh38)
Location 4:7613866-7613888
Sequence GTGAATGAATGGATGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1323
Summary {0: 1, 1: 1, 2: 28, 3: 208, 4: 1085}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969510293 Original CRISPR GTGAATGAATGGATGGTGAA TGG (reversed) Intronic
900333175 1:2146876-2146898 GTGGGTGAATGGATGATGTACGG - Intronic
900338964 1:2178845-2178867 CAGCAGGAATGGATGGTGAAAGG + Intronic
900498136 1:2985870-2985892 GTGAATGAATGGATGGATGATGG - Intergenic
900498152 1:2985943-2985965 GTGGATGGATGGATGATGGATGG - Intergenic
900498155 1:2985958-2985980 GTGAATGGATGGATGGTGGATGG - Intergenic
900498167 1:2986011-2986033 GTGAATGAATGGATGGAGGATGG - Intergenic
900498729 1:2989278-2989300 ATGAATGGATGGATGGAGGATGG - Intergenic
900498754 1:2989403-2989425 GTGGATGGATGGATGATGGATGG - Intergenic
900498784 1:2989543-2989565 ATGGATGAATGGATGGAGGATGG - Intergenic
900498793 1:2989588-2989610 GTGGATGAGTGGATGATGGATGG - Intergenic
900509584 1:3052193-3052215 ATGAATGAATGGATGGATGATGG - Intergenic
900535659 1:3175940-3175962 GTGGATGGATGGATGGGGTAAGG - Intronic
900573330 1:3370817-3370839 ATGGATGAATAGATGGTGGATGG - Intronic
900573347 1:3370883-3370905 ATGGATGAATGGATGGTGGATGG - Intronic
900573359 1:3370946-3370968 ATGAATCGATGGATGGTGAATGG - Intronic
900573384 1:3371060-3371082 ATGGTTGAATGGATGGTGGATGG - Intronic
900573396 1:3371123-3371145 ATGAATCAATGGATGGTGAATGG - Intronic
900573426 1:3371253-3371275 ATGGATGAATGGATGGTGGATGG - Intronic
900573442 1:3371339-3371361 ATGAATGGATGGATGGTGAATGG - Intronic
900573460 1:3371418-3371440 ATGTATGGATGGATGATGAATGG - Intronic
900896754 1:5488029-5488051 TTGGATGGAAGGATGGTGAATGG - Intergenic
900930992 1:5737442-5737464 TTGGATGGATGGATGATGAATGG + Intergenic
900931027 1:5737700-5737722 ATATATGAATGGATGGTGGATGG + Intergenic
901001223 1:6149714-6149736 ATGGATGGATGGATGATGAATGG + Intronic
901001268 1:6149970-6149992 GCAAATGAATGGATGATGGATGG + Intronic
901001369 1:6150510-6150532 ATGGATGGATGGATGGTGGATGG + Intronic
901006541 1:6174414-6174436 ATGGATGAATGCATGGTGGATGG + Intronic
901006594 1:6174672-6174694 GTGGAAGGATGGATGGTGGATGG + Intronic
901006601 1:6174699-6174721 ATGGATGAATGGATGGTGGATGG + Intronic
901006615 1:6174786-6174808 GTGGATGGATGAATGGTGGATGG + Intronic
901006671 1:6175047-6175069 GTGGATGAATGGTGGATGAATGG + Intronic
901006675 1:6175066-6175088 ATGGATGAGTGGATGGTGGATGG + Intronic
901006719 1:6175276-6175298 ATGCATGGATGGATGGTGGATGG + Intronic
901006723 1:6175299-6175321 ATGAATGAATGGATGGTGGATGG + Intronic
901006731 1:6175341-6175363 ATGGATGAGTGGATGGTGGATGG + Intronic
901006736 1:6175364-6175386 ATGCATGGATGGATGGTGGATGG + Intronic
901006779 1:6175551-6175573 GTGGATGGGTGGATGGTGGATGG + Intronic
901699820 1:11039315-11039337 GTGGATGGAAGGATGGTGGATGG + Intronic
901700270 1:11041584-11041606 GTGGGTGGATGGATGGTGGATGG + Intronic
901774665 1:11552074-11552096 GTGAATGAAGGGAAGATGGAAGG + Intergenic
901863596 1:12089915-12089937 ATGGATGGATGGATGGGGAAGGG - Intronic
901863697 1:12090315-12090337 ATGGATGGATGGATGGGGAAAGG - Intronic
901928637 1:12583135-12583157 GTGAGTGGATGGATGGAGTAGGG - Intronic
901928784 1:12583713-12583735 ATGCATGAATGGATGGAGTAGGG - Intronic
902202607 1:14845125-14845147 GTGGATGAGTGGATGATGAATGG + Intronic
902202609 1:14845140-14845162 ATGAATGGATGGATAGTGAGTGG + Intronic
902398066 1:16143145-16143167 GTGAATGGATGGATGATGGATGG + Intronic
902599040 1:17528624-17528646 ATGAATGAATGGATGGAGGATGG - Intergenic
902613694 1:17612084-17612106 GAGAATGAATGGAGGGAGGATGG - Intronic
902666458 1:17942660-17942682 GTGAATCAATGGATATAGAAAGG - Intergenic
902721184 1:18305246-18305268 ATGGATGCATGGATGGTGGATGG + Intronic
902790551 1:18764988-18765010 ATGAATGAATGCATGGGGAAGGG - Intergenic
903234459 1:21940659-21940681 ATGAATGAATGAATGGACAAAGG - Intergenic
903277511 1:22231388-22231410 ATGGATGAATGGATGATGGATGG - Intergenic
903766387 1:25737517-25737539 ATGAATGAATGAATGGCGATTGG - Intronic
903949724 1:26989207-26989229 ATAAATGAATGAATGGAGAAGGG + Intergenic
904993706 1:34614534-34614556 GTGGATGGATGGATGGTGGGTGG + Intergenic
905272039 1:36793675-36793697 GTGGATGGATGGGTGGTGGATGG + Intergenic
905493653 1:38365511-38365533 AAGAATGGATGGATGGTGAAGGG - Intergenic
905528927 1:38661119-38661141 GTGATTGTATGGATGGGGATGGG + Intergenic
905554448 1:38871266-38871288 GTGAAAGACTGAATGGTAAAAGG - Intronic
906076327 1:43054832-43054854 GTGGATGAATAAATGGAGAAGGG - Intergenic
906688813 1:47779379-47779401 CTGAATGAATGAATAGTGAGTGG - Intronic
907004458 1:50896531-50896553 GTCCATGAATGGATGTTAAATGG + Intronic
907455781 1:54574620-54574642 TTGAATGAATGAATGGAGAGAGG + Intronic
908097981 1:60760609-60760631 ATGAATGAATGCATGATGACAGG - Intergenic
908391400 1:63686850-63686872 ATGGATGAATGGATGGGGGATGG - Intergenic
908391406 1:63686869-63686891 ATGGAAGGATGGATGGTGAATGG - Intergenic
908437474 1:64120830-64120852 GTGGATGGATGGATGGAGAATGG + Intronic
908901163 1:68958147-68958169 ATGGATGGATGGATGTTGAATGG + Intergenic
910625653 1:89303556-89303578 GAGAAAGAAGGCATGGTGAAAGG + Intergenic
911020463 1:93381914-93381936 GTGACTGGGTAGATGGTGAAGGG - Intergenic
913083832 1:115415439-115415461 GTGAAAGAATTGATGATGGATGG + Intergenic
913094343 1:115502369-115502391 GAGAATGAGTGTCTGGTGAAGGG - Intergenic
913139769 1:115929280-115929302 GTGAATGAATGAATGCATAAAGG + Intergenic
913704709 1:121407896-121407918 TTGAATGAATGGGTGGTGACAGG + Intergenic
914351247 1:146842484-146842506 GTGGGTGAATGGATGATGGATGG + Intergenic
914351375 1:146843022-146843044 ATGGATGAATGGATGATGGATGG + Intergenic
914855420 1:151346946-151346968 GGGATTGAATGGAGGGGGAAGGG - Intronic
915116063 1:153600520-153600542 ATAAATAAATGGATGGTGGAGGG - Intergenic
916802077 1:168225418-168225440 GTGACTGAAGGAATGTTGAAAGG - Intergenic
918117062 1:181506875-181506897 GTGAAAGAATGGATAGTGGCAGG - Intronic
918130707 1:181626013-181626035 GGGAATGAATGGCAGGTCAATGG + Intronic
918319379 1:183350182-183350204 GTGAATAAATGAATGGGGAGAGG + Intronic
918375727 1:183907356-183907378 GAGAATGAATGGTTGGGTAAGGG - Intronic
918892346 1:190291904-190291926 GTGAAAGAATGGATTTTAAAAGG + Intronic
919053125 1:192535708-192535730 GTTTATGAATGGGTGGAGAAAGG + Intergenic
919588740 1:199472348-199472370 GTGAATGAGTTGAAGCTGAAAGG + Intergenic
919922272 1:202173655-202173677 ATGGATGGATGGATGGTGGATGG - Intergenic
920287354 1:204890214-204890236 GTGAATGGATGGATGCAGGAAGG - Intronic
920743400 1:208602584-208602606 GTGAATGAATGGATGAGTAGGGG - Intergenic
920910213 1:210209463-210209485 GTGAATGAATGGTTGAAGTATGG - Intergenic
921557843 1:216620608-216620630 GTGAATGAATTAGAGGTGAAGGG - Intronic
921816172 1:219566414-219566436 TGGAATGAATGGATGATGAATGG - Intergenic
922506922 1:226131855-226131877 GTGAATGCATGGAAGGTGCCGGG - Intergenic
922745544 1:228041379-228041401 ATGGATGAATGGATGATGGATGG - Intronic
922745570 1:228041547-228041569 ATGAATTGATGGATGGTGGATGG - Intronic
922745795 1:228042926-228042948 ATGGATGGATGGATGGTGAATGG + Intronic
922790581 1:228308776-228308798 ATGGATGGATGGATAGTGAATGG - Intronic
922790597 1:228308871-228308893 AAGAATGAATGGATGGATAATGG - Intronic
922790883 1:228310319-228310341 ATGAATGGATGGATTATGAATGG - Intronic
922790891 1:228310379-228310401 GTGAATGGATGGATGGTGGATGG - Intronic
922790895 1:228310394-228310416 GTGGATGAGTGGATGGTGAATGG - Intronic
922790956 1:228310785-228310807 GTGAATGAATGGATAGCAAGTGG - Intronic
922792858 1:228319739-228319761 ATGAATGGATGAATGGTGGATGG - Intronic
924034288 1:239920361-239920383 GTGGATGAATGGCTGATGGATGG - Intergenic
924034300 1:239920405-239920427 ATGGATGAATGGATGATGGATGG - Intergenic
924200422 1:241652723-241652745 GTGAAAGAATGGGTGCTGAAAGG + Intronic
924753035 1:246914770-246914792 TTGAATGCATGGTTGGTGTATGG - Intronic
1062940159 10:1414930-1414952 GTGGATGGATGGATGGTGGATGG + Intronic
1062940195 10:1415088-1415110 ACCAATGGATGGATGGTGAATGG + Intronic
1062943694 10:1444250-1444272 GGAAATAGATGGATGGTGAATGG - Intronic
1062943720 10:1444374-1444396 GTAGATAGATGGATGGTGAATGG - Intronic
1062943868 10:1445125-1445147 GTGAGTGAATGGATGGTAAATGG - Intronic
1063348630 10:5335047-5335069 GAGAATGAATGAATGTTAAAGGG - Intergenic
1063957964 10:11283525-11283547 GATAATGGATGGATGATGAATGG + Intronic
1063958242 10:11284773-11284795 GTGGATGGATGGATGGTGGATGG + Intronic
1064097191 10:12432705-12432727 GTGAACGAATGAATGGTGTCAGG + Intronic
1064132361 10:12721505-12721527 ATGGATGGATGGATGGTGGATGG - Intronic
1064355325 10:14612352-14612374 GAGAATGAATGCATGATGGAAGG + Intronic
1064735028 10:18373226-18373248 GTGAATGAATGAAAGGAGAGGGG - Intronic
1064896381 10:20241954-20241976 ATGGATGGATGGATGGAGAAAGG + Intronic
1065278400 10:24109657-24109679 GTGAAAGGAAGAATGGTGAAAGG + Intronic
1065860679 10:29870336-29870358 ATGGATGGATGGATGGTGGATGG - Intergenic
1065860693 10:29870394-29870416 GTGTATGAATGGGTGGTGGGTGG - Intergenic
1065860728 10:29870550-29870572 ATGAATGAGTGGATGGTAGATGG - Intergenic
1065860770 10:29870778-29870800 ATGAATGGATGGATGGTAAATGG - Intergenic
1065860774 10:29870808-29870830 GTAGATGGATGGGTGGTGAATGG - Intergenic
1065860789 10:29870885-29870907 ATGAATGGATGGATGGTAGATGG - Intergenic
1065951642 10:30657783-30657805 ATGGATGAGTGGATGGAGAAAGG - Intergenic
1066015751 10:31241943-31241965 ATGAATGAATGGATAATCAATGG - Intergenic
1066229330 10:33416895-33416917 ATGAATGGATGGATGGTGGATGG + Intergenic
1067709629 10:48637607-48637629 GTGAATGGATGGATGGCAAATGG + Intronic
1068580449 10:58733282-58733304 GTGAGTGAATGAATAATGAATGG + Intronic
1069220051 10:65871909-65871931 TTAAGTAAATGGATGGTGAATGG - Intergenic
1069392570 10:67951818-67951840 GTGAATGAAGGAATTGTGGAAGG - Intronic
1070504708 10:77103010-77103032 GTGAATGAACCGATGGAGAGGGG + Intronic
1070580371 10:77714448-77714470 GTGAATGAATGAATGGTTGATGG - Intergenic
1070891359 10:79944166-79944188 GTGAGTGAATGGAAGCTGGAAGG - Intronic
1071131212 10:82395660-82395682 ATGAATGGATGGATGATGGATGG - Intronic
1071131215 10:82395675-82395697 ATGAGTGGATGGATGATGAATGG - Intronic
1071131931 10:82404571-82404593 ATGAATGAATGAAGGATGAATGG + Intronic
1071283995 10:84127537-84127559 GAGAAGGAATGGATGTTGATGGG - Intergenic
1071509032 10:86249872-86249894 ATAAATGGATGGATGGTGGAAGG + Intronic
1072276866 10:93832304-93832326 TTGAATGAATGGATTGTGCTAGG - Intergenic
1072532786 10:96335375-96335397 GTGAATGAAAGGATGGAGGAAGG - Intronic
1072706689 10:97686246-97686268 TTGAATGAATAAATGATGAAGGG + Intronic
1072784397 10:98269820-98269842 GGGAATGAATGGATGTTGCCCGG + Intergenic
1072935694 10:99711029-99711051 GTGAATGCATGAATGGAAAATGG - Intronic
1073467170 10:103700964-103700986 ATGGATGGATGGATGGTGGATGG - Intronic
1073467179 10:103701013-103701035 ATGGATGGATGGATGGTGGATGG - Intronic
1073467185 10:103701036-103701058 ATGGATGGATGGATGGTGGATGG - Intronic
1073467213 10:103701172-103701194 ATGGATGGATGGATGGTGGATGG - Intronic
1073467235 10:103701288-103701310 ATGAATGGATGGATGATGGATGG - Intronic
1073467239 10:103701311-103701333 ATGAATGGATGGATGATGGATGG - Intronic
1073467254 10:103701387-103701409 GTGGATGGATGGATGATGGATGG - Intronic
1073467257 10:103701402-103701424 GTGGATGGATGGATGGTGGATGG - Intronic
1073467264 10:103701428-103701450 ATGAATGGATAGATGGTGGATGG - Intronic
1073467274 10:103701484-103701506 ATGAATGGATGGATGATGGATGG - Intronic
1073467279 10:103701511-103701533 GTGGATGGATGGATGATGGATGG - Intronic
1073467282 10:103701526-103701548 GTGGATGGATGGATGGTGGATGG - Intronic
1073467297 10:103701608-103701630 GTGGATGGATGGATGATGGATGG - Intronic
1073467364 10:103701979-103702001 ATGGATGGATGGATGGTGGATGG - Intronic
1073467394 10:103702135-103702157 GTGAATGGATGATGGGTGAATGG - Intronic
1073467399 10:103702161-103702183 ATGGATGGATGGATGGTGGATGG - Intronic
1073580316 10:104659840-104659862 GTGAAAGAATGGCTGGCAAAAGG - Intronic
1073765650 10:106679829-106679851 GTGCATGGATGTATGGTAAATGG - Intronic
1073782962 10:106859354-106859376 GTGTATGAATGAATTGTGATCGG - Intronic
1073969817 10:109034656-109034678 GTGAATCAAGGGCTGGGGAAAGG - Intergenic
1074064276 10:109999088-109999110 GTGAATTAATGGACAGTGACTGG + Intronic
1074239067 10:111618832-111618854 GTCAATAAATGCATGTTGAATGG - Intergenic
1074844879 10:117388966-117388988 GTGAAGGGATGGATTGTGAAAGG - Intergenic
1075559647 10:123459268-123459290 GTGAGTGAATGGTTTCTGAAAGG + Intergenic
1075918320 10:126188945-126188967 GTGAATAGATGGATGATGAATGG - Intronic
1075918324 10:126188979-126189001 ATGGATGGATGGATGGTGAATGG - Intronic
1076077277 10:127544437-127544459 GTGAATGCATGGATGCTGTGAGG + Intergenic
1076078866 10:127559790-127559812 GAGAATGAATGCACAGTGAAGGG + Intergenic
1076088425 10:127656898-127656920 TTGAATGAATACATTGTGAATGG - Intergenic
1076278129 10:129223473-129223495 GTGAATGAGTGAATGGTGAGTGG + Intergenic
1076578003 10:131483685-131483707 ATGGATGAATGGATGATGGATGG + Intergenic
1076578053 10:131483943-131483965 GTGGATGAATGGTGGATGAATGG + Intergenic
1076676738 10:132151013-132151035 GAGAAGGAATGGATGGAGGATGG - Intronic
1076844953 10:133065483-133065505 ATGGATGGATGGATGGTGGATGG + Intergenic
1076844985 10:133065582-133065604 GTGGATGGATGGATGGTGGATGG + Intergenic
1076845018 10:133065705-133065727 ATGGGTGGATGGATGGTGAATGG + Intergenic
1076845054 10:133065817-133065839 GTGGATGGATGGAGGGTGGACGG + Intergenic
1076845126 10:133066061-133066083 GTGGATGGATGGAGGGTGGATGG + Intergenic
1076845138 10:133066100-133066122 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845186 10:133066247-133066269 GTGGATGGATGGATGGTGGATGG + Intergenic
1076845225 10:133066368-133066390 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845241 10:133066417-133066439 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845269 10:133066508-133066530 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845285 10:133066557-133066579 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845313 10:133066648-133066670 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845355 10:133066760-133066782 GTGGATGGGTGGATGGTGGATGG + Intergenic
1077159495 11:1106246-1106268 GTGGATGGATGGATGGTGGATGG - Intergenic
1077159570 11:1106513-1106535 ATGGATGGATGGATGGTGGATGG - Intergenic
1077159606 11:1106644-1106666 GTGAATGGAGGGAGGGAGAATGG - Intergenic
1077357547 11:2125627-2125649 GTGGATGGATGGAGGGTGAGTGG + Intergenic
1077357642 11:2126104-2126126 GTGAGTGGATGGAGGGTGAGTGG + Intergenic
1077357820 11:2126891-2126913 GTGAATGGGTGGATGGTGAGTGG + Intergenic
1078017381 11:7626603-7626625 ATAAGTGAAAGGATGGTGAATGG + Intronic
1078802954 11:14665659-14665681 GTGAATGAAGCAATTGTGAATGG - Intronic
1078964306 11:16320121-16320143 GTGAATGCAAGGCTGCTGAAGGG - Intronic
1079103545 11:17556593-17556615 GTGAATGAAGAGTTGGTAAATGG + Intronic
1079108698 11:17591162-17591184 GTGAATGAATGGAGTGGTAAAGG + Intronic
1079231188 11:18650109-18650131 TTAAATGAATGCATGGAGAAGGG + Intergenic
1079280693 11:19084377-19084399 ATGGATGGATGGATGATGAATGG - Intergenic
1079460829 11:20676436-20676458 ATGAATGAATGCAGAGTGAATGG + Intronic
1079478521 11:20857328-20857350 GTGAGTGGATGGGTGGTGAATGG - Intronic
1080415115 11:32062562-32062584 ATGGATGGATGGATGGTGGATGG + Intronic
1080790854 11:35521334-35521356 GTGGAAGGCTGGATGGTGAATGG - Intronic
1081287183 11:41285246-41285268 ATGAATGAATGGATGGATGATGG - Intronic
1081738333 11:45420746-45420768 GTGAGTGAATGGATGGATAGTGG - Intergenic
1081765852 11:45609654-45609676 ATGAATTCATGGATGATGAATGG + Intergenic
1081792937 11:45801829-45801851 GTGACTTAGTGGATGGTGAAGGG - Intergenic
1082781387 11:57290225-57290247 GTGAGTGCACAGATGGTGAATGG + Intergenic
1083879852 11:65543013-65543035 GTGGATGGATGGATGGAGAAAGG + Intronic
1084266375 11:68007471-68007493 ATGAATGAATGAATTATGAATGG + Intergenic
1084413444 11:69016880-69016902 GTGGATGGATGGATGATGGATGG - Intergenic
1084491756 11:69482524-69482546 ATGAATGGATGGATGATGAGTGG + Intergenic
1084576525 11:69992160-69992182 GTAGATGAATGGATGATGGATGG + Intergenic
1084596273 11:70118788-70118810 ATGGATGAATGGATGCTGAAGGG + Intronic
1084596335 11:70119072-70119094 GTGAATTGATGGATGCTGGAGGG + Intronic
1084609661 11:70194152-70194174 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609760 11:70194630-70194652 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609837 11:70195037-70195059 ATGGATGGATGGATGGTGGATGG + Intergenic
1084705154 11:70811817-70811839 ATGGATGAATGAATGGTGGATGG - Intronic
1084705318 11:70812990-70813012 GTGAATGAATGAATGGAGAAAGG - Intronic
1084739924 11:71133129-71133151 GTGAATGAGTGGATGGAGGGAGG + Intronic
1084781787 11:71414705-71414727 ATGAATGAATGAATGATGGATGG + Intergenic
1084781829 11:71414919-71414941 ATGAATGAATGAATGTTGGATGG + Intergenic
1084781888 11:71415145-71415167 GTGAATGGATGGATGATGGGTGG + Intergenic
1085032777 11:73282751-73282773 ATGAATGAATGAATGGAGGAGGG + Intronic
1085406834 11:76268536-76268558 ATGGATGGATGGATGGTGGAGGG - Intergenic
1085406877 11:76268699-76268721 GTGGATGGATGGATGATGGATGG - Intergenic
1085406894 11:76268761-76268783 ATGAATGGATGGATGGAGGATGG - Intergenic
1085528583 11:77178329-77178351 GTGGATGGATGGATGGTGGATGG - Intronic
1085750852 11:79160069-79160091 GTGAGTGAGTGCATGGAGAAGGG - Intronic
1085871356 11:80353752-80353774 TTCAATGAATGTGTGGTGAAAGG - Intergenic
1086087806 11:82972515-82972537 GTGAATAAATGGATGGGTGAAGG + Intergenic
1086401989 11:86468392-86468414 ATGGATGGATGGATGATGAATGG - Intronic
1086445477 11:86866496-86866518 ATGAATGAATAGATGATGAATGG - Intronic
1086494951 11:87393355-87393377 ATGAAGGAATGGCTGGTCAATGG - Intergenic
1086930973 11:92692662-92692684 CTGTCTGAAAGGATGGTGAAGGG + Intronic
1087069387 11:94062570-94062592 GTAAATGAATGAATGGCAAATGG + Intronic
1087175913 11:95095233-95095255 TTGAATGAATGGATGGAGGGTGG + Intronic
1087226125 11:95601040-95601062 TTGAATGAATGGATGATGAAAGG + Intergenic
1087413161 11:97818059-97818081 TTGAATGAATGGGTGGAGAGTGG - Intergenic
1087507371 11:99042986-99043008 ATAAAAGAATGGAAGGTGAATGG - Intronic
1087565706 11:99854512-99854534 GTGAATGAATAGGTGGTGGTGGG + Intronic
1087650198 11:100857473-100857495 GGGAAGGAAAGGATTGTGAAAGG - Intronic
1088193129 11:107248186-107248208 GTAAATGGATGCATGGTGAATGG - Intergenic
1088375027 11:109131623-109131645 ATGGATGAATGGATGGTTAAAGG + Intergenic
1088375029 11:109131688-109131710 ATGGATGGATGGATGGTTAAGGG - Intergenic
1088488918 11:110368303-110368325 GTGAATGAACAGAGCGTGAACGG + Intergenic
1089271255 11:117303025-117303047 TTGAATGAATGAATGGTTGAAGG + Intronic
1089682550 11:120127253-120127275 GTGGATGGATGGATGTTGGAGGG + Intronic
1089719064 11:120395322-120395344 GTAAGTAAATGGATGGTAAATGG + Intronic
1089739554 11:120572964-120572986 GTGAATGAGTGAATGGAGTATGG - Intronic
1090140976 11:124261177-124261199 GTGGATGGATGGATGGATAAAGG - Intergenic
1090675174 11:128985678-128985700 ATGAATGAATGGATGGACAAAGG - Intronic
1090727998 11:129544871-129544893 TGGAATGAAGGGATGGTGATGGG + Intergenic
1090995114 11:131859067-131859089 ATGGATGGATGGATGTTGAAGGG - Intronic
1091011507 11:132005510-132005532 ATGAATGAATGAATGTTGGAAGG + Intronic
1091117902 11:133031578-133031600 GTGAATGGATGGGTGGTGGATGG + Intronic
1091194077 11:133717292-133717314 ATGAATGAATGAGTGGTGAATGG - Intergenic
1091407340 12:217424-217446 GTGGATGAATGGAACTTGAAGGG + Intergenic
1091442628 12:523282-523304 GTGAATGAATGAATGAAGGAAGG - Intronic
1091452571 12:582471-582493 GTGAATGAATGAATGGGCACAGG + Intronic
1091506791 12:1078150-1078172 TTGAATGAATTGATGACGAATGG + Intronic
1091574972 12:1724887-1724909 ATGAATGAATGAATACTGAAAGG - Intronic
1091654676 12:2337001-2337023 ATGGATGGATGGATGGTGAATGG - Intronic
1091891936 12:4063347-4063369 GTCCATGAAAGGATGCTGAAAGG - Intergenic
1091993031 12:4972336-4972358 GTGAATGGATGGATGGAGGGAGG - Intergenic
1092070659 12:5628954-5628976 GTGAAAGGAGGGATGGGGAAAGG - Intronic
1092440989 12:8502886-8502908 TTGAATAAATGAATGCTGAATGG + Intergenic
1092602188 12:10079273-10079295 GTGGATGGATGGATGGATAATGG + Intronic
1092837627 12:12506076-12506098 GTGAATGAAAGGTCAGTGAATGG - Intronic
1094355590 12:29574194-29574216 GTGAATGAATGAATGGAGGAAGG - Intronic
1095156632 12:38864300-38864322 GTAAATAAATGGATGATGATGGG - Intronic
1096536760 12:52279827-52279849 GTGAATGGATGGATGGAGAATGG - Intronic
1098700525 12:73618862-73618884 ATGTATGAATGGAAGGAGAAAGG - Intergenic
1099556676 12:84117569-84117591 GTGGTAGAATGGATGGGGAATGG - Intergenic
1100469906 12:94881339-94881361 TTGAATTAATGGATAGTAAAAGG + Intergenic
1100671990 12:96823736-96823758 TTGAATGGATAAATGGTGAAAGG + Intronic
1100705335 12:97194648-97194670 GTGAATGAATGAATGGGGATAGG + Intergenic
1100932741 12:99629192-99629214 CTGAGTGAATGGATGGTCTATGG - Intronic
1101201302 12:102439193-102439215 ATGAATAAATGAATGGAGAAGGG + Intronic
1101250819 12:102933098-102933120 GTGAAAGCGTGGATGGTTAATGG - Intronic
1101643657 12:106607775-106607797 ATGAATGAATGAATGGTGGGTGG + Intronic
1101787152 12:107893955-107893977 GTGAATGAATGGGTTGGAAAGGG - Intergenic
1101801032 12:108022084-108022106 ATGAATGAGTGGATGATGGATGG - Intergenic
1101801096 12:108022524-108022546 ATGAATGAATGGATGATGGAAGG - Intergenic
1101873189 12:108582022-108582044 ATGAATGAATGAATGGGGGATGG - Intergenic
1102506931 12:113389617-113389639 GTGAGTGGATGGATGATAAATGG - Exonic
1102507192 12:113391005-113391027 ATGAATGAATGGATGGCTGATGG - Exonic
1102920821 12:116789933-116789955 GTGGATGGATGGATGGTGGATGG + Intronic
1103002463 12:117395812-117395834 GTAGATGAATGAATGGTGAATGG - Intronic
1103006201 12:117422360-117422382 ATGTATGAATAGATGGTGGATGG - Intronic
1103024063 12:117559068-117559090 ATGGATGGATGGATGGTGGATGG + Intronic
1103064171 12:117883084-117883106 CTGAATGGATGGATGGTTGAAGG - Intronic
1103131019 12:118468732-118468754 ATGAATGAATAGATGGTGGCTGG - Intergenic
1103255955 12:119541445-119541467 ATGAATGAATGGATGGTGGATGG + Intergenic
1103992527 12:124808637-124808659 ATGAATGGATGGAGGGTGGATGG - Intronic
1104357642 12:128101752-128101774 GTGAGTGAGTGAAGGGTGAAGGG - Intergenic
1104778440 12:131404766-131404788 ATGAATGGATGGATGATAAATGG - Intergenic
1104778449 12:131404805-131404827 GTGGATGGATGGATGATGGATGG - Intergenic
1104778505 12:131405022-131405044 GTGGATGGATGGATGATGGATGG - Intergenic
1104778520 12:131405084-131405106 GTGGATGGATGGATGATGGATGG - Intergenic
1104778534 12:131405135-131405157 GTGGATGGATGGATGATGGATGG - Intergenic
1104778580 12:131405306-131405328 GTGGATGGATGGATGATGGATGG - Intergenic
1104779334 12:131409819-131409841 GTGAATGGATGGATGGATGATGG - Intergenic
1104896114 12:132164642-132164664 GTGGATGAATGGATGATGGATGG - Intergenic
1104896288 12:132166577-132166599 ATGAATGAATGTATGATGGATGG - Intergenic
1104896311 12:132166667-132166689 GTGAATGGATGGATGATGGGTGG - Intergenic
1104896343 12:132166788-132166810 ATGAATGAATGTATGATGGATGG - Intergenic
1104896409 12:132167039-132167061 ATGAATGAATGTATGATGGATGG - Intergenic
1104896439 12:132167148-132167170 GTGGATGAATGGATGGATAAGGG - Intergenic
1104896447 12:132167179-132167201 ATGAATGAATGTATGATGGATGG - Intergenic
1105514035 13:21075349-21075371 TTGAATGAATGAATGAAGAAAGG - Intergenic
1107246569 13:38303695-38303717 ATGAATGAATGAATGATGAGTGG + Intergenic
1107438172 13:40400484-40400506 ATGAATGAATGAATGAAGAATGG + Intergenic
1107836957 13:44420070-44420092 ATGAATGAATGAATGGAAAAGGG - Intergenic
1109439855 13:62355311-62355333 GGGAGGGAATGGATGGAGAAAGG + Intergenic
1109999142 13:70171422-70171444 CTGAGTGAATGAGTGGTGAATGG + Intergenic
1110087966 13:71406389-71406411 GTGAATGAAATGATGTTGTAGGG + Intergenic
1110348836 13:74482261-74482283 GAGAATGAATAGCTGATGAAGGG - Intergenic
1110683363 13:78342756-78342778 GTGTCAGAATGGATGGAGAAGGG - Intergenic
1110752517 13:79131803-79131825 TTGAATGAATGGATGGATGAAGG - Intergenic
1111426877 13:88096118-88096140 GTGAATAAGTGGTTAGTGAATGG + Intergenic
1111608707 13:90576131-90576153 GACAATGGAAGGATGGTGAAGGG - Intergenic
1112535676 13:100252863-100252885 TGCAATGAATGAATGGTGAAAGG - Intronic
1112730306 13:102353275-102353297 GTGAAGACTTGGATGGTGAAGGG - Intronic
1112955801 13:105056722-105056744 GGGATTGGGTGGATGGTGAATGG - Intergenic
1113394334 13:109932035-109932057 GGGACTGAAAGGATGGAGAAAGG + Intergenic
1113417572 13:110140288-110140310 ATGGATGGATGGATGGTGGATGG + Intergenic
1113595004 13:111525012-111525034 ATGAATGAATGGATGATCAGAGG + Intergenic
1113852283 13:113424665-113424687 ATAGATGAATGGATGGTGAATGG - Intronic
1114232646 14:20798195-20798217 GTGAATGAATGGAGGTTGGAAGG - Intergenic
1115161499 14:30401395-30401417 GTGAATGAATGGAAGATTAGAGG - Intergenic
1117269465 14:54127249-54127271 GTGAATGAAGGGAAAGTGAGAGG + Intergenic
1119806635 14:77486465-77486487 GTGGATGAGTGGAAGGTGGAAGG + Intronic
1119881284 14:78101763-78101785 GTGGATGGATGGAGGGTGAACGG + Intergenic
1121029945 14:90649760-90649782 GTGGATGGTTGGATGGTGGATGG - Intronic
1121029954 14:90649791-90649813 GTGGATGGGTGGATGGTGGATGG - Intronic
1121180623 14:91926032-91926054 TTGAATGAATGAATGGCGGAAGG - Intronic
1121398231 14:93646953-93646975 GTGAATGAATGAATGAATAAAGG - Intronic
1121423186 14:93830050-93830072 ATGGATGGATGGATGGTGGATGG + Intergenic
1121507475 14:94487686-94487708 GTGAAGGAAAAGATGGTGCAGGG + Intronic
1121557427 14:94849018-94849040 TTGAATGAATGAGTGATGAAGGG - Intergenic
1121983257 14:98473775-98473797 GGGAATGAATGGTTAGTTAATGG - Intergenic
1122335587 14:100977522-100977544 GTGACTAAATGAAAGGTGAAAGG + Intergenic
1122507140 14:102238870-102238892 GTGTAGGAATAGATGGGGAATGG - Intronic
1122600686 14:102920190-102920212 GTGAATGAATGAGTGGTAGATGG - Intergenic
1122600704 14:102920301-102920323 GTGGATGGATAGATGGTGGATGG - Intergenic
1122600746 14:102920520-102920542 GTGGATGAAGGGATGGTGGATGG - Intergenic
1122600758 14:102920568-102920590 GTGGATGGATGGATGGTGGATGG - Intergenic
1122600768 14:102920611-102920633 GTGGATGAGTGGATGGCGAATGG - Intergenic
1122600779 14:102920672-102920694 GTGGATGGATGAATGGTGGATGG - Intergenic
1122600787 14:102920703-102920725 GTGGATGGATGGATGGTGGATGG - Intergenic
1122600791 14:102920718-102920740 GTGGATAAGTGGATGGTGGATGG - Intergenic
1122600813 14:102920828-102920850 GTGAATAGGTGGATGGTGGATGG - Intergenic
1122600818 14:102920850-102920872 GTGAATGAGTGAATGGTGGATGG - Intergenic
1122600890 14:102921260-102921282 GTGAATAGATAGATGGTAAATGG - Intergenic
1122600892 14:102921282-102921304 CTGAATGGATGGATGGTGGATGG - Intergenic
1122625110 14:103081159-103081181 GTGACTGGATGGATGGTGAGTGG + Intergenic
1122804990 14:104252103-104252125 GTGGATGAATGGATGATGCGCGG - Intergenic
1122867510 14:104614057-104614079 GTGAATGGATGGAGGGTGGTTGG + Intergenic
1122877520 14:104675678-104675700 GTGGGTGAATGGATGATGGATGG + Intergenic
1122877536 14:104675733-104675755 GTGGATGGATGGTGGGTGAATGG + Intergenic
1122910343 14:104824792-104824814 ATGTATGGTTGGATGGTGAATGG + Intergenic
1122958313 14:105083068-105083090 GTGGATGGATGGATGATGGAGGG - Intergenic
1122958335 14:105083149-105083171 GTGGATGGATGGATGATGGAGGG - Intergenic
1123080402 14:105691023-105691045 GTGTATGAATGTGTGGTGTATGG - Intergenic
1124162852 15:27289671-27289693 GTGAATGAATGGAAGATGGTGGG + Intronic
1124395756 15:29300133-29300155 GTGAGTAAATGGATGGATAATGG + Intronic
1125431837 15:39603211-39603233 ATGAATGAATGGATGGCAGATGG + Intronic
1126335741 15:47584446-47584468 GTGAATGAATGCAAATTGAATGG + Intronic
1126584242 15:50267189-50267211 TTGGATGAATGGACGGTCAAGGG - Intergenic
1126654181 15:50957597-50957619 GTGAAAGAATGGATAGGGACAGG - Intronic
1127071557 15:55291757-55291779 GTGAATGAATGGGTGATGAATGG - Intronic
1127340554 15:58039020-58039042 GGGAATGAATGTCTGCTGAATGG - Intronic
1128233749 15:66053128-66053150 GTGAATGTATGGATAATAAATGG + Intronic
1128265213 15:66260121-66260143 ATGAATGAATGGATGATGGGTGG + Intergenic
1128308249 15:66614065-66614087 TTGAATGAATGGATGTTGGTTGG - Intronic
1129604991 15:77020525-77020547 GTGACTAAATGGATGGAGGATGG - Intronic
1129857790 15:78837409-78837431 GTGAATGAATGAATGGCGGCTGG + Intronic
1130027280 15:80280763-80280785 GTGAATGAATGGATGGGTGGCGG + Intergenic
1130353602 15:83111209-83111231 GTGAATGTATGGAGGATGGATGG - Intronic
1130415280 15:83688079-83688101 GGAAAGGAATGGATGGAGAAGGG + Intronic
1130733831 15:86527928-86527950 ATGGATGAATGGATGATGGATGG - Intronic
1131360646 15:91787786-91787808 TTGGATGAATGGATGAGGAATGG + Intergenic
1131754553 15:95545606-95545628 GTGGATGAGTGGAAGGTAAAAGG - Intergenic
1132019070 15:98344857-98344879 ATGAATGGATGGATGGTGGATGG + Intergenic
1132030864 15:98437755-98437777 ATGAATGGATGGATGGAGGATGG + Exonic
1132030943 15:98438128-98438150 GTGGATGGATGGATGATGGATGG + Exonic
1132346593 15:101112473-101112495 GGAAATGAATGGATGGGGACGGG - Intergenic
1132653706 16:1032785-1032807 GTGGATGGATGGATGATGGATGG - Intergenic
1132653748 16:1032990-1033012 GTGGATGGATGGATGGTGGATGG - Intergenic
1132653760 16:1033060-1033082 GTGGATGGATGGATGATGGATGG - Intergenic
1132653867 16:1033565-1033587 GTGGATGGATGGATGATGGATGG - Intergenic
1132653907 16:1033750-1033772 GTGGATGGATGGATGGTGGATGG - Intergenic
1133121413 16:3611158-3611180 ATGAATGAATGGATCGGTAAGGG + Intronic
1133204758 16:4226655-4226677 GTGAATGGAAGGATGATGGATGG + Intronic
1133213868 16:4278863-4278885 GTGAATGAATGAATGGCAACTGG + Intergenic
1133326833 16:4947077-4947099 ATGAATGGATGGATGGAGGAAGG - Intronic
1133456144 16:5944015-5944037 CTGGATGAATGGATGGTGGATGG - Intergenic
1133554397 16:6891096-6891118 ATGAATGAATGGATGGATATTGG - Intronic
1133677391 16:8087758-8087780 GAGACTGAAAGGATGGTGGAGGG - Intergenic
1133910021 16:10057109-10057131 GTGAATGGATGAATGATGGATGG - Intronic
1133965929 16:10531777-10531799 ATGAATGAATGAATGGTGGATGG + Exonic
1134105961 16:11486199-11486221 GTGGATGAATGGATGATGGGTGG + Intronic
1134106028 16:11486562-11486584 GTGGATGAATGGATGATGGATGG + Intronic
1134106064 16:11486679-11486701 GTGGATGAATGGATGATGGGTGG + Intronic
1134106115 16:11486857-11486879 GTGGATGAATGGATGATGGGTGG + Intronic
1134224454 16:12380540-12380562 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224460 16:12380559-12380581 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224475 16:12380601-12380623 GTGGATGGATGGATGGTGGATGG - Intronic
1134224482 16:12380624-12380646 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224495 16:12380662-12380684 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224500 16:12380677-12380699 GTGGATGGGTGGATGGTGGATGG - Intronic
1134224526 16:12380762-12380784 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224537 16:12380793-12380815 GTGGATGGATGGATGGTGTGTGG - Intronic
1134224574 16:12380915-12380937 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224579 16:12380930-12380952 GTGGATGGATGGATGGTGGATGG - Intronic
1134224588 16:12380970-12380992 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224647 16:12381134-12381156 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224653 16:12381153-12381175 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224727 16:12381387-12381409 GTGAGTGGATGGATGATGAGTGG - Intronic
1134375479 16:13668650-13668672 AAGAATTAATGGATAGTGAATGG - Intergenic
1134488469 16:14677907-14677929 ATGAATGGATGGATGATGGATGG + Intronic
1134554788 16:15155436-15155458 ATAAATGAATGGATGGGGAATGG - Intergenic
1134563741 16:15232860-15232882 GGGAATGTAGGGATGGTTAATGG + Intergenic
1134738752 16:16523833-16523855 GGGAATGTAGGGATGGTTAATGG - Intergenic
1134819995 16:17239326-17239348 GTGGATGGATGGATGATGGATGG - Intronic
1134820023 16:17239464-17239486 GTGGATGGATGGATGATGGATGG - Intronic
1134928747 16:18188320-18188342 GGGAATGTAGGGATGGTTAATGG + Intergenic
1135081918 16:19443766-19443788 TTGGATGGATGGATGGTAAATGG + Intronic
1135526942 16:23220436-23220458 GTGAATGAGTGGAGGGTGAGTGG - Intergenic
1135726537 16:24858440-24858462 ATGAGTGAGTGGATGGTGGATGG + Intronic
1135933217 16:26757154-26757176 GGGAGTGAATGGATGATGGATGG + Intergenic
1136071455 16:27790099-27790121 ATGAATGAATGAATGATGGATGG + Exonic
1136071468 16:27790214-27790236 ATGAATGGATGGATGGATAATGG + Exonic
1136597442 16:31261149-31261171 GTGACCGAATGGATGGGAAAGGG + Intronic
1137386085 16:48043911-48043933 GTGAATGGATTGATGGTGAATGG - Intergenic
1137386087 16:48043926-48043948 ATTGATGGATGGATGGTGAATGG - Intergenic
1137386105 16:48044027-48044049 ATGGATGGATGGGTGGTGAATGG - Intergenic
1137386121 16:48044097-48044119 GTGGTTGGATGGATGGTGGATGG - Intergenic
1137386128 16:48044120-48044142 GTGGATGGATGGATGGTGAATGG - Intergenic
1137386134 16:48044143-48044165 CTGGATGGATGGATGGTGAATGG - Intergenic
1137386145 16:48044196-48044218 ATGGATGGATGGATGATGAATGG - Intergenic
1137386148 16:48044215-48044237 ATGGATGGATGGATGATGAATGG - Intergenic
1137386153 16:48044242-48044264 ATAGATGGATGGATGGTGAATGG - Intergenic
1137386176 16:48044391-48044413 TTGGATGGATGGATGGTAAATGG - Intergenic
1137386179 16:48044406-48044428 GTGGATCAATGGATGTTGGATGG - Intergenic
1137386189 16:48044481-48044503 ATGGATGGATGGATGGTAAATGG - Intergenic
1137789765 16:51165196-51165218 GTGAATGGAGGGTTGGAGAAAGG + Intergenic
1137865358 16:51889951-51889973 GTGTGTGTATGGATGTTGAAAGG - Intergenic
1137977060 16:53040985-53041007 GTGGATGGATGGATGGATAATGG + Intergenic
1138024345 16:53511195-53511217 GGAAATGAGGGGATGGTGAAGGG + Intergenic
1138185798 16:54976629-54976651 GGGAAAGAATAGATGGTGAGAGG - Intergenic
1138398829 16:56729680-56729702 GAGAATGCTTGGATGTTGAAGGG - Intronic
1138495765 16:57408309-57408331 GTGAATGGATGGATGGAGGATGG - Intronic
1138926237 16:61594525-61594547 GTGAGTGAATGGCTAGGGAATGG - Intergenic
1139309549 16:66016958-66016980 CTGAATGAATAGTTGGTGCATGG + Intergenic
1139982663 16:70872525-70872547 ATGGATGAATGGATGATGGATGG - Intronic
1139982789 16:70873062-70873084 GTGGGTGAATGGATGATGGATGG - Intronic
1140067641 16:71625228-71625250 GTGAGTGGATGAATGGTGGATGG + Intergenic
1140067682 16:71625367-71625389 GTGGGTGGATGGATGGTGGATGG + Intergenic
1140197448 16:72866830-72866852 GTGCCTGTGTGGATGGTGAATGG - Intronic
1140297778 16:73725964-73725986 TTTATTTAATGGATGGTGAAAGG - Intergenic
1140678923 16:77364634-77364656 GTGGATGGATGGATGGTGGATGG + Intronic
1140716640 16:77732432-77732454 GTGAATGAGTGGGTGGTGAGTGG - Intronic
1140951728 16:79824971-79824993 ATGAATGCATGGATGGTAGATGG - Intergenic
1141096785 16:81168538-81168560 GAGGATGAATGGGTGATGAATGG + Intergenic
1141110087 16:81265258-81265280 ATGAATGGATGGATGGTGAGTGG - Intronic
1141110129 16:81265418-81265440 ATGAATGGATGGATGGTGGATGG - Intronic
1141110182 16:81265620-81265642 ATGAATGGATGGATGGTGGATGG - Intronic
1141110239 16:81265875-81265897 GTGGATGGATGGATGGTAGATGG - Intronic
1141110255 16:81265956-81265978 GTGGATGGATAGATGGTGGATGG - Intronic
1141178062 16:81733680-81733702 GTCGATGAATGGAGGGTGAATGG - Intergenic
1141396462 16:83709418-83709440 GTGCATGGATGAATGCTGAATGG - Intronic
1141606498 16:85156941-85156963 ATGGATGGATGGATGGAGAAAGG - Intergenic
1141658009 16:85426366-85426388 GTGGATGAATGGATGATAGATGG + Intergenic
1141748849 16:85944957-85944979 ATGGATGGATGGATGATGAATGG - Intergenic
1141854837 16:86673891-86673913 ATGAATGAATGAAGAGTGAATGG - Intergenic
1141943514 16:87294320-87294342 GTAGATGAATGGATGGTGGCTGG + Intronic
1142124131 16:88401794-88401816 GTGGATGGATGGATGGTAGATGG + Intergenic
1142248375 16:88979993-88980015 GTGGGTGAATGAATGGTGGATGG + Intergenic
1142248479 16:88980403-88980425 GTGGGTGAATGAATGGTGGATGG + Intergenic
1142960542 17:3549781-3549803 ATGAGTGAATGGATGATGGATGG + Intronic
1143152311 17:4815243-4815265 ATGGATGGATGGATGATGAAGGG + Intronic
1143393997 17:6577299-6577321 CTGAATTAATGAAAGGTGAAGGG - Intergenic
1143536420 17:7542876-7542898 TTGAATGAATGGGTGGTCCAAGG - Intergenic
1143858160 17:9868126-9868148 ATGAATGAATGAAAGGAGAAAGG + Intronic
1144767832 17:17742447-17742469 GTGAATGAATGAATGAATAAAGG + Intronic
1144866574 17:18339395-18339417 TTGAATGAAAGGAGGGTGCATGG - Intronic
1145245076 17:21263496-21263518 GTACATGAATGGATGGTTACAGG - Intergenic
1145262485 17:21362919-21362941 GTGAATGAATGGTTAGTTAGAGG + Intergenic
1145271569 17:21407568-21407590 GTGGATGGATGGATGGGTAATGG - Intronic
1145978964 17:29000501-29000523 ATGAATGAATGAATGATGGATGG + Intronic
1147300712 17:39524605-39524627 GTGAATGAATGGAGGAGCAAAGG - Intronic
1147401216 17:40181016-40181038 GTTAATGATGGAATGGTGAAGGG - Intronic
1147497082 17:40926912-40926934 GTGAATGAAGGGAAGAAGAAAGG - Intronic
1147526924 17:41233895-41233917 TTGAATGAATGGCTGGTCAGAGG - Intronic
1147639568 17:41987422-41987444 TTGAATGAATGTATGGTGCTTGG - Intronic
1147776749 17:42907364-42907386 GTGGATGGATGGGGGGTGAACGG + Intronic
1148190203 17:45672949-45672971 ATGAATGAATGAATGAAGAAAGG + Intergenic
1148823047 17:50371776-50371798 ATGAATGAATAGATGTTTAAAGG - Intronic
1148907800 17:50922271-50922293 AGGAATGGTTGGATGGTGAATGG + Intergenic
1149175859 17:53868998-53869020 TTGTATAAATGGATGGTGAGTGG + Intergenic
1150439050 17:65176973-65176995 GTGTACGAATGGATGGAGGAAGG - Intronic
1150634543 17:66903803-66903825 GTGGATAGATGGATGGTGGAGGG + Intergenic
1150845373 17:68651827-68651849 GTGAATGAATAAATGGTAAAAGG - Intergenic
1151382485 17:73735396-73735418 ATGAATGAATGAATGATTAATGG + Intergenic
1152034054 17:77861163-77861185 ATGGATGAATGGATGGAGGATGG + Intergenic
1152159548 17:78658888-78658910 ATGAATGAATGAGTGATGAAGGG + Intergenic
1152165390 17:78701492-78701514 GGGAATGACTGGATGGTCAAGGG - Intronic
1152301818 17:79499276-79499298 ATGAATAAATGGATGGTAGATGG - Intronic
1152301831 17:79499374-79499396 GTGAATGAATGAATAGTGGATGG - Intronic
1152301845 17:79499465-79499487 ATGAATGAATGGATGGTGGATGG - Intronic
1152541868 17:80980771-80980793 GTGAATGAATGAATGAGGGAGGG + Intergenic
1152767482 17:82148995-82149017 ATGAATGGATGGGTGGTGGATGG + Intronic
1153381338 18:4442993-4443015 ATGAATGAATGGATTGACAATGG + Intronic
1153836483 18:8968844-8968866 GTGGGTGAATGGATAGAGAAAGG + Intergenic
1153857012 18:9159737-9159759 ATTAATAAATGGATGGTGAAGGG - Intronic
1153937866 18:9946707-9946729 GTGAATGAGTGGTGAGTGAATGG + Intronic
1154307812 18:13243518-13243540 GTGGATGGATGGATGATGGATGG - Intronic
1154307969 18:13244153-13244175 GTGGATGAATGGATGGATAGAGG - Intronic
1156471602 18:37380520-37380542 GAGAATGGATGGATGATGAATGG - Intronic
1156471704 18:37381150-37381172 GTGGATGAATGGTAGGTGGATGG - Intronic
1157441208 18:47713073-47713095 GTGAATGAATGAATGGTGATGGG - Intergenic
1158010319 18:52720657-52720679 GTGAATGAAGGGGAGATGAAAGG + Intronic
1158060111 18:53330355-53330377 GTGATTGAATGGATATTGACAGG - Intronic
1158380092 18:56920075-56920097 GTGTATGTATGGTTGGGGAAGGG - Intronic
1158677436 18:59533717-59533739 GTGAATTAATGCATGGTACAGGG - Intronic
1158799762 18:60892421-60892443 GTGAATGAGTGGACTGTGTAAGG - Intergenic
1158957880 18:62558581-62558603 GAAAATGAATGGAGGGTGAGTGG - Intronic
1159233116 18:65634815-65634837 GTGCAAAAATGGATGGGGAAAGG + Intergenic
1160226839 18:77018458-77018480 GTGGATGGATGGATGACGAATGG - Intronic
1160502432 18:79408802-79408824 ATGAATGAATGGATAGGGAATGG - Intronic
1160502455 18:79408928-79408950 ATGAATGAATGGATAGGGAATGG - Intronic
1160502478 18:79409057-79409079 ATGAATGAATGGATAGGGAATGG - Intronic
1160502502 18:79409198-79409220 ATGAATGGATGGATAGGGAATGG - Intronic
1160502523 18:79409313-79409335 ATGAATGAATGGATAGGGAATGG - Intronic
1160502560 18:79409521-79409543 ATGAATGGATGGATGATGGATGG - Intronic
1160502561 18:79409525-79409547 GTGGATGAATGGATGGATGATGG - Intronic
1160526572 18:79542138-79542160 GTGGATGGATGGATGTTGGATGG - Intergenic
1160526647 18:79542489-79542511 GGAAATGGATGGATGGTGATGGG - Intergenic
1160526684 18:79542682-79542704 ATGAATGCATGGATGATGAATGG - Intergenic
1160588028 18:79923301-79923323 GTGGATGGGTGGATGGTGGACGG + Intronic
1160681769 19:414933-414955 GTGGATGCATGGATGATGAATGG + Intergenic
1160687132 19:442336-442358 GTGGATGGATGGAGGGTGGAAGG + Intronic
1160687368 19:443075-443097 GTGGATGGATGGAGGGTGGATGG + Intronic
1160687643 19:444073-444095 GTGGATGGATGGAGGGTGGATGG + Intronic
1160767912 19:816612-816634 ATGAATGGCTGGATGATGAATGG - Intronic
1160767916 19:816647-816669 GTGCATGAGTGGATGATGGATGG - Intronic
1160926824 19:1550428-1550450 ATGGATGGATGGATGTTGAATGG - Intergenic
1160960331 19:1718117-1718139 GAGAATGGATGGATGATAAATGG + Intergenic
1161287320 19:3475548-3475570 GTGGATAGATGGATGATGAATGG + Intronic
1161287583 19:3476939-3476961 GTGGGTGGATGGATGGTGAATGG + Intronic
1161287805 19:3477785-3477807 GTGGATGAGTGGATGATGGATGG + Intronic
1161329110 19:3678034-3678056 GAGAATGGAGGGATGGAGAATGG + Intronic
1161347763 19:3776669-3776691 GTGGATGAGTGGATGGTGGGTGG + Intergenic
1161347797 19:3776813-3776835 ATGGATGAGTGGATGGTGATTGG + Intergenic
1161449100 19:4334697-4334719 CTGGATGGATGGATGATGAATGG - Intronic
1161449206 19:4335189-4335211 GTGGATGGATGGATGATGGATGG - Intronic
1161449221 19:4335270-4335292 GTGGGTGGGTGGATGGTGAATGG - Intronic
1161657482 19:5525011-5525033 GTGGATGAATGGATGGTGAGTGG - Intergenic
1161657497 19:5525094-5525116 GTGAATGGATGGATGATGGATGG - Intergenic
1161679757 19:5673921-5673943 GTGAGTGGATGGATGATGAATGG - Intergenic
1161681462 19:5681760-5681782 GTGGATGGATGGATGATGGACGG - Intronic
1161768977 19:6221247-6221269 ATGAATGAATGGATGGATGAGGG - Intronic
1161933779 19:7358321-7358343 ATGGATGAATGGATGTTGAATGG - Intronic
1162091584 19:8283771-8283793 GTCAATCAATGAATGGAGAAAGG - Intronic
1162093821 19:8298620-8298642 GTCAATCAATGAATGGAGAAAGG - Intronic
1162112519 19:8407614-8407636 ATGAATGAATGAATGGAGACTGG + Intronic
1162180842 19:8867693-8867715 ATGGATGGATGGATGGTGGATGG + Intronic
1162321281 19:9972286-9972308 GTGAATGAATGGATGAACGAGGG - Intronic
1162875225 19:13616399-13616421 ATGAATGAATGAATGATGAATGG - Intronic
1163177176 19:15572510-15572532 GTGAATGGATGTCTGGTGAATGG - Intergenic
1163382648 19:16979020-16979042 GTGGATGAGTGGATGATGGATGG - Intronic
1163383546 19:16985272-16985294 GTGGATGAATGGATGGATGAAGG + Intronic
1163383662 19:16985765-16985787 GTGAATGAATGGAGGGAGAGAGG + Intronic
1163609847 19:18295166-18295188 GGGGATGAGTGGATGGTGGATGG - Intergenic
1163609884 19:18295314-18295336 GTAGATGGATGGATGGTGGATGG - Intergenic
1163609904 19:18295383-18295405 GTGGATGGGTGGATGGTGAATGG - Intergenic
1163609920 19:18295439-18295461 GTGGATGGATGGCTGGTGGATGG - Intergenic
1163609931 19:18295482-18295504 GTGGGTGAGTGGATGGTGGATGG - Intergenic
1163609958 19:18295568-18295590 ATGGATGGGTGGATGGTGAATGG - Intergenic
1163609980 19:18295650-18295672 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163609990 19:18295695-18295717 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163609997 19:18295729-18295751 ATGGATGGATGGATGGTGGATGG - Intergenic
1163610009 19:18295776-18295798 GTGGATGAGTGGATGGTGGATGG - Intergenic
1163610016 19:18295803-18295825 GTGGATGGGTGGATGGTGGATGG - Intergenic
1164597769 19:29541426-29541448 GTGAATGGATGGGGGATGAATGG + Intronic
1164670314 19:30068634-30068656 GTGGATGGATGGATGGAGAGAGG - Intergenic
1164701504 19:30287798-30287820 GAGGATGGATGGATGGTGGATGG + Intronic
1164732960 19:30519736-30519758 ATGAATGAATGAATGGTGTTGGG - Intronic
1164920545 19:32085445-32085467 ATGGATGGATGGATGATGAATGG + Intergenic
1165076595 19:33282925-33282947 GTGAATGAATGAAGGGCAAAAGG + Intergenic
1165144261 19:33721475-33721497 ATGGATGCATGGATGGTGAGTGG + Intronic
1165190271 19:34057234-34057256 GTGGATGGACGGATGATGAAAGG + Intergenic
1165554609 19:36619338-36619360 GTGAAGGAAAGGATGTGGAAAGG + Intronic
1166201456 19:41240169-41240191 ATAAATGACTGGATGGTGAGTGG + Intronic
1166828189 19:45622257-45622279 GTGGATGGATGGGTGATGAATGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1166935600 19:46330604-46330626 ATGGATGCATGGATGGTGGATGG + Intronic
1166935606 19:46330627-46330649 ATGGATGGATGGATGGTGGATGG + Intronic
1166935621 19:46330707-46330729 ATGGATGGATGGATGGTGGATGG + Intronic
1166935641 19:46330792-46330814 ATGGATGGATGGATGGTGGATGG + Intronic
1167161431 19:47769789-47769811 GTGGATGGATGGATGATGGATGG - Intergenic
1167598418 19:50439461-50439483 GTGAATGCATGGATGGAGCTTGG - Intronic
1167633069 19:50637897-50637919 TTGAATGAATGAATGATGAATGG - Exonic
1168326912 19:55543201-55543223 GTGGATGGATGGATGGTGGATGG - Intronic
1168330880 19:55567779-55567801 GTGAATGGATGGATGGATGATGG + Intergenic
1168330890 19:55567830-55567852 GTGAATGGATGGATGGATGATGG + Intergenic
1168330936 19:55568113-55568135 GTGAATGGATGGTGGATGAATGG + Intergenic
1168330970 19:55568324-55568346 GTGAATGGATGAATGGATAATGG + Intergenic
1168447230 19:56430466-56430488 CTGATTGATTGGATGGTGGAAGG + Intronic
925119342 2:1405291-1405313 ATGAGTGAATGGATGATGGATGG - Intronic
925119351 2:1405334-1405356 GTGGGTGGATGGATGATGAATGG - Intronic
925614029 2:5728457-5728479 ATCAATGAATGGATGATGGATGG + Intergenic
925667922 2:6281511-6281533 GTGAATGTAGAGATGGGGAAGGG - Intergenic
925723600 2:6851992-6852014 ATGAAAGAATGGAGGGTGACAGG + Intronic
925907726 2:8549227-8549249 GTGCATGAATGTTTGTTGAATGG - Intergenic
926263072 2:11285333-11285355 GTGAAAGCATGGATGGTACATGG - Intronic
926698637 2:15787991-15788013 ATGGATGAATGGATGGAGTATGG - Intergenic
926727451 2:16009518-16009540 GTGAATTCATGGTGGGTGAATGG - Intergenic
926727465 2:16009579-16009601 GTGAATGCATGGTGGGTGGATGG - Intergenic
926746614 2:16163780-16163802 CTGAATGAATGGCCGGTGCATGG + Intergenic
927477429 2:23424329-23424351 GTGAGAGAATGCATGGCGAACGG + Intronic
928234060 2:29524824-29524846 ATGAATGGATGGATGGTAGATGG + Intronic
929154701 2:38778991-38779013 ATGAGTGAATGGATGAAGAAAGG + Exonic
930003740 2:46879801-46879823 GTGAATGGATGGATGGTGAGTGG + Intergenic
930669278 2:54131351-54131373 ATCAATGAATAGATGGTGGAAGG + Intronic
931169179 2:59784511-59784533 ATGAATGGATGGATGGTGAATGG + Intergenic
931169181 2:59784538-59784560 ATGAATAGATGGATGATGAATGG + Intergenic
931803851 2:65785730-65785752 ATGAATGCATGAATGGTGACCGG + Intergenic
931861315 2:66357571-66357593 GTGAAGGAATGGATTGTCCAGGG + Intergenic
932557079 2:72833931-72833953 TTGGATGAAAAGATGGTGAAGGG - Intergenic
932659894 2:73642733-73642755 GTGACTGATTGCAGGGTGAATGG - Intergenic
932666461 2:73702393-73702415 GTGACTGAGTGCAGGGTGAATGG - Intergenic
932912449 2:75819607-75819629 ATGAATGAATAGATGATGGATGG - Intergenic
933668297 2:84982735-84982757 GAGGATGGTTGGATGGTGAATGG + Intronic
933803800 2:85983538-85983560 GTGAATGAATGGATGACAGAGGG + Intergenic
934646954 2:96064395-96064417 ATGAATGGATGGATGGTAGATGG - Intergenic
934646988 2:96064630-96064652 ATGAATGGATGGATGGTAGATGG - Intergenic
934647005 2:96064745-96064767 ATGAATGAATGGATGGTAGATGG - Intergenic
934840380 2:97620621-97620643 ATGAATGAATGGATGGTAGATGG - Intergenic
935258237 2:101331618-101331640 ATGAATGAATGGATAGGGATGGG + Intergenic
935415403 2:102811625-102811647 GTGAATAAATGAATAGGGAAAGG - Intronic
935637136 2:105257998-105258020 ATGAATGAATGAATGGAAAATGG + Intergenic
935782255 2:106518670-106518692 AGGAATGAATGGATGGTGAATGG - Intergenic
936523051 2:113224086-113224108 GTGGAAGAATGGATGATGAAAGG + Intronic
937078430 2:119123891-119123913 GTGTATGAGTGGCTGGTGCATGG + Intergenic
937115720 2:119403843-119403865 GTGAATGAATGAAAGAAGAATGG - Intergenic
937285607 2:120748976-120748998 GTCAATGAATGTATGATGGATGG - Intronic
937329083 2:121012879-121012901 GAAAATGAAAGGATGGGGAAAGG + Intergenic
937970743 2:127546885-127546907 GTGGATAGATGGATGGTGGATGG - Intronic
938108054 2:128546710-128546732 GTGGCTGGATGGATGGAGAATGG - Intergenic
938108073 2:128546804-128546826 ATGGATGGATGGATGGAGAATGG - Intergenic
938108082 2:128546855-128546877 ATGAATGAATGGGTGGATAATGG - Intergenic
938108134 2:128547078-128547100 GTGGCTGGATGGATGGAGAATGG - Intergenic
938112039 2:128574442-128574464 GTGAGTGAATGCTTGGTGGAAGG + Intergenic
938601695 2:132849017-132849039 GTGAATGAATAAAGGGTAAAAGG + Intronic
938617601 2:133015637-133015659 GCGAATGAATGGATTGTGTTTGG - Intronic
939035321 2:137123630-137123652 TTCAATGAATGCATGTTGAAAGG + Intronic
939164499 2:138626102-138626124 GTGAATGTAAGAATGGAGAAGGG - Intergenic
939562383 2:143747770-143747792 ATAAATGAATGGATAATGAATGG - Intronic
939679296 2:145110468-145110490 ATGAATAAATAGATGATGAATGG + Intergenic
941298183 2:163767003-163767025 GTGAATAATTGGATAGAGAAAGG - Intergenic
941592600 2:167438406-167438428 GTGAATGACTGTTTGGTCAAAGG + Intergenic
941750662 2:169132087-169132109 ATGAATAGATGGATGATGAATGG + Intronic
942583313 2:177445738-177445760 GTGAATGAATGTATCATAAAAGG - Intronic
943041385 2:182809346-182809368 GTGAATGAATGAATGGGATAGGG + Intergenic
943082918 2:183278066-183278088 GTGAATGAATGGATGGATGGAGG - Intergenic
944066115 2:195620695-195620717 ATGAATGAATGGCTCTTGAAGGG - Intronic
944480617 2:200153951-200153973 CTGAATGAATGTCTGGTGTAGGG + Intergenic
945326025 2:208483239-208483261 GTGCATGAGTTTATGGTGAAAGG + Intronic
946313105 2:218893626-218893648 GGGAATGAATGGAAGCTGACGGG + Exonic
947812837 2:233015136-233015158 GTGGATGGATGGATGGTGGATGG - Intronic
947812841 2:233015151-233015173 GTGAAGGGATGGATGGTGGATGG - Intronic
947812912 2:233015413-233015435 GTGGATGGATGGATGGTGGATGG - Intronic
947812932 2:233015496-233015518 GTGGATGGATGGATGGTGGATGG - Intronic
948330116 2:237157896-237157918 GTGAGTGAGGGGCTGGTGAATGG - Intergenic
948458469 2:238118129-238118151 GAGAAGGAATGGATGGAGGAGGG + Intronic
948458503 2:238118255-238118277 ATGGAGGAATGGATGGTGGAGGG + Intronic
948818697 2:240527354-240527376 TTGGATGAATGGATGTTGCATGG + Intronic
948818778 2:240527793-240527815 CTGAAAGAATGGATGTTGCATGG + Intronic
949065739 2:241989524-241989546 ATGGATGAATGGATGGTGGGTGG - Intergenic
949065748 2:241989561-241989583 GTGGATGGATGGATGGTGGATGG - Intergenic
949065752 2:241989576-241989598 ATGGATGGATGGATGGTGGATGG - Intergenic
949065765 2:241989631-241989653 ATGGATGGATGGATGGTGGATGG - Intergenic
949065788 2:241989733-241989755 GTGGATGGATGGATGGTGGATGG - Intergenic
949065795 2:241989759-241989781 GTGGATGGATGGATGGATAATGG - Intergenic
949065798 2:241989774-241989796 ATGGATGAATGGATGGTGGATGG - Intergenic
949065806 2:241989811-241989833 ATGGATGGATGGATGGTGGATGG - Intergenic
949065812 2:241989834-241989856 GTGGGTGGATGGATGGTGGATGG - Intergenic
949065816 2:241989849-241989871 ATGGATGAATGGATGGTGGGTGG - Intergenic
949065828 2:241989902-241989924 ATGGATGCATGGATGGTGGATGG - Intergenic
949065838 2:241989948-241989970 GTGGATGGATGGATGGTGGATGG - Intergenic
949065842 2:241989963-241989985 GATAATGGATGGATGGTGGATGG - Intergenic
949065862 2:241990050-241990072 GTGGATGGATGGATGATGGATGG - Intergenic
949065879 2:241990122-241990144 ATGGATGCATGGATGGTGGATGG - Intergenic
949065883 2:241990141-241990163 ATGGATGCATGGATGGTGGATGG - Intergenic
949065894 2:241990186-241990208 ATGGATGCATGGATGGTGGATGG - Intergenic
949065898 2:241990205-241990227 ATGGATGCATGGATGGTGGATGG - Intergenic
949065906 2:241990238-241990260 ATGGATGCATGGATGGTGGATGG - Intergenic
949065920 2:241990289-241990311 ATGGATGGATGGATGGTGGATGG - Intergenic
949065938 2:241990354-241990376 ATGGATGGATGGATGGTGGATGG - Intergenic
949065948 2:241990392-241990414 GTGGATAGATGGATGGTGGATGG - Intergenic
949065955 2:241990422-241990444 ATGGATGGATGGATGGTGGATGG - Intergenic
949065977 2:241990504-241990526 ATGGATGGATGGATGGTGGATGG - Intergenic
949065986 2:241990537-241990559 ATGGATGGATGGATGGTGGATGG - Intergenic
949065992 2:241990560-241990582 ATGGATGGATGGATGGTGGATGG - Intergenic
949066000 2:241990591-241990613 GTGGATGGATGGATGGTGGATGG - Intergenic
1169097322 20:2913955-2913977 GTCAATGAATGGATGTAGAAGGG - Intronic
1170258532 20:14375699-14375721 GTGAATGAATGGATTGTCTCCGG + Intronic
1170323573 20:15130241-15130263 GTGGATGGATGAATGGTGAATGG - Intronic
1170361177 20:15548084-15548106 ATGGATGAATGGATGGAGGAAGG - Intronic
1170379194 20:15737876-15737898 ATGGATGGATGGATGATGAATGG + Intronic
1170414635 20:16126844-16126866 ATGAATGAATGAATGATGAGAGG + Intergenic
1170729532 20:18961162-18961184 GTGAATAGGTGGATGCTGAAGGG + Intergenic
1170956595 20:20985636-20985658 ATGAATGAATGAATGGTGAATGG - Intergenic
1171086946 20:22246420-22246442 GTGAACTAATGGATGTAGAACGG - Intergenic
1171227084 20:23451024-23451046 GTAAATGGATGGATGGGGGATGG - Intronic
1172544655 20:35750278-35750300 TTGGATGAATGGATGGACAAAGG - Intergenic
1172578835 20:36030839-36030861 CTGAGTGAATGGATGGTCAGAGG + Intergenic
1172617787 20:36300518-36300540 GTGAATGAATGGATGAGATAAGG + Intergenic
1172782055 20:37442702-37442724 ATGGATGGATGGATGATGAATGG - Intergenic
1172783316 20:37450184-37450206 ATGGATGAATGGATGGACAAAGG - Intergenic
1172885844 20:38230218-38230240 GTGAGTGAATGAATGATGAGTGG - Intronic
1172939121 20:38642656-38642678 GAGAATAAATGGGTGGTGGAAGG - Intronic
1172978777 20:38925961-38925983 ATGAATGAATACATGGTTAAAGG + Intergenic
1172981002 20:38941636-38941658 GTGGAGGAATAGAAGGTGAATGG + Intronic
1173063507 20:39684612-39684634 ATAAATGAATGAATGGTGTATGG + Intergenic
1173465023 20:43274009-43274031 GTGAATGGGCGGATGGTGGAGGG + Intergenic
1173529634 20:43759186-43759208 GTGAATGAATGATTGGTAATTGG - Intergenic
1173556239 20:43968065-43968087 GTGAATGAATAGATGGGTGAGGG - Intronic
1173826237 20:46049477-46049499 ATGAATGGATGGGTGGTGAGGGG + Intronic
1173871498 20:46344890-46344912 ATGGATGAATGGATGGTAGATGG - Intergenic
1174125625 20:48303018-48303040 ATGAATGGATGGATGAAGAATGG - Intergenic
1174279725 20:49430467-49430489 GTGGATGGATGGATGATGGATGG - Intronic
1174680409 20:52401062-52401084 GTGAATGAATGAATCTAGAATGG + Intergenic
1174940004 20:54916434-54916456 ATTAATGAATGAATGGTGGATGG - Intergenic
1175138018 20:56839607-56839629 ATGGATGAATGGATGGTAAGTGG + Intergenic
1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG + Intergenic
1175221172 20:57417361-57417383 ATGTATGGATGGAGGGTGAATGG + Intergenic
1175301919 20:57948960-57948982 ATGGATGAATGGATGATGGATGG + Intergenic
1175301982 20:57949292-57949314 ATGGATGAATGGATGATGGATGG + Intergenic
1175687942 20:61045036-61045058 ATGGATGGATGGATGGTCAATGG - Intergenic
1175687995 20:61045296-61045318 ATGGATGGATGGATGGTGGATGG - Intergenic
1175688001 20:61045319-61045341 ATGCATGGATGGATGGTGAAAGG - Intergenic
1175772631 20:61633182-61633204 ATGGATGAATGGATGGAGGATGG - Intronic
1175779196 20:61671649-61671671 GTGAATGGATGGATAATGGATGG + Intronic
1175779199 20:61671660-61671682 GATAATGGATGGATGGTGGATGG + Intronic
1175779244 20:61671862-61671884 ATGGATGGATGGATGGTGGATGG + Intronic
1175781064 20:61682358-61682380 ATGGATGGATGGATGGTGGATGG + Intronic
1175799056 20:61790661-61790683 ATGAATGGATGGATGGTGGGTGG - Intronic
1175799084 20:61790824-61790846 ATGAATGGATGGATGGTGGGTGG - Intronic
1175817406 20:61890524-61890546 GTGGATGGATGGATTATGAATGG + Intronic
1175817960 20:61893389-61893411 GTGAATAGAGGGATGGTGGATGG + Intronic
1175818038 20:61893710-61893732 GTGAATAGAGGGATGGTGGATGG + Intronic
1175818052 20:61893761-61893783 GTGAATAGAGGGATGGTGGATGG + Intronic
1176039544 20:63057183-63057205 GTGAATGAATGAATGAAAAAAGG - Intergenic
1176039550 20:63057654-63057676 GTGAATGAATGAGTGAAGAAAGG - Intergenic
1176047158 20:63098773-63098795 GTGAATGCATGGATGGATCATGG + Intergenic
1176047174 20:63098894-63098916 GTGAATGCATGGATGGAACATGG + Intergenic
1176047190 20:63099015-63099037 GTGAATGCATGGATGGATCATGG + Intergenic
1176057881 20:63158378-63158400 ATGGGTGACTGGATGGTGAATGG + Intergenic
1176057958 20:63158651-63158673 GTGGATGAGTGGATGGTGGATGG + Intergenic
1177646774 21:23908793-23908815 GTGAATGAGTGGAGAGTGATTGG + Intergenic
1177851734 21:26357197-26357219 CTGAATGAATGAATGGGAAAGGG + Intergenic
1178264575 21:31131075-31131097 ATGAATGAATGGAAGGTGGGTGG - Intronic
1178368634 21:32008836-32008858 ATGGATGGATGGATGGTGAATGG + Intronic
1178788791 21:35678714-35678736 ATGGATGGATGGATGATGAATGG + Intronic
1179006741 21:37521939-37521961 CTGAAAGAATGGATGGAGGAGGG + Intergenic
1179249442 21:39660800-39660822 GGGAAAGAGAGGATGGTGAAGGG + Exonic
1179474384 21:41633982-41634004 ATGAATGAATGGGTGGTAGATGG - Intergenic
1179474751 21:41636035-41636057 ATGGATGGATGGATGATGAATGG - Intergenic
1179474758 21:41636075-41636097 GAAGATGAATGGATGGTGGATGG - Intergenic
1179474764 21:41636106-41636128 ATGAATGGATGGATGATGGATGG - Intergenic
1179474765 21:41636110-41636132 GTGGATGAATGGATGGATGATGG - Intergenic
1179549151 21:42132379-42132401 GTGGATGGATGGATGATGGATGG - Intronic
1179611219 21:42552575-42552597 GTGAATGAATGATTGGTCAGTGG + Intronic
1179623649 21:42634720-42634742 GTGGATGAATAGATGGACAATGG - Intergenic
1179623676 21:42634944-42634966 GTGGATGAATAGATGGACAATGG - Intergenic
1179623690 21:42635050-42635072 GTGGATGAATAGATGGACAATGG - Intergenic
1179623732 21:42635384-42635406 GTGGATGAATAGATGGACAATGG - Intergenic
1179623759 21:42635604-42635626 GTGGATGAATAGATGGACAATGG - Intergenic
1180024906 21:45155579-45155601 GTGAGTGGATGGATGATGGATGG - Intronic
1181002419 22:19994121-19994143 ATGAATGAATGGAGGGTGGCTGG + Intronic
1181002442 22:19994218-19994240 ATGAATGGATGGATGGGGGATGG + Intronic
1181537075 22:23551936-23551958 GTGGATGAATGGAAGATGGATGG - Intergenic
1181537279 22:23552990-23553012 GAGAATGAATGGAGACTGAAGGG - Intergenic
1181592312 22:23893069-23893091 GGGAATAAAGGGATAGTGAAAGG + Intronic
1181908751 22:26220929-26220951 GTGGATGGATGGATGATGAGTGG + Intronic
1182016461 22:27044250-27044272 TTGAAAGAATGGAAGATGAATGG - Intergenic
1182099741 22:27649441-27649463 GTGGATGGATGGATGGTGGAAGG + Intergenic
1182227774 22:28812953-28812975 ACGAATGAATGGAAGATGAATGG - Intergenic
1182227992 22:28814828-28814850 ATGAATGAATGGAAGATGAATGG + Intergenic
1182266345 22:29118765-29118787 GTGTATGAATGTATGGGAAAAGG - Intronic
1182478446 22:30590051-30590073 TTGAATGAATGAATGAGGAAGGG - Intronic
1182512290 22:30827980-30828002 TTGGTTGAATGGATGGTCAAGGG + Intronic
1182795713 22:32990237-32990259 GTGGATGAATGGATAATAAATGG - Intronic
1183100052 22:35578396-35578418 CTGGATGGATGGATGGTGGATGG + Intergenic
1183100062 22:35578439-35578461 ATGGATGGATGGATGGTGGATGG + Intergenic
1183303944 22:37072028-37072050 ATGAATGGATGGATGGTGGATGG + Intronic
1183303947 22:37072043-37072065 GTGGATGGATGGATGATGGATGG + Intronic
1183304000 22:37072326-37072348 ATGAATGGATGGATGATGGATGG + Intronic
1183304039 22:37072546-37072568 ATGAATGGATGGATGATGGATGG + Intronic
1183304137 22:37073048-37073070 GTGGATGGATGGATGATGGATGG + Intronic
1183983346 22:41555465-41555487 GTGAATGGATGGATGGCTGAGGG + Intergenic
1184321301 22:43744104-43744126 ATGAATGAATGGATGGGTTATGG + Intronic
1184387555 22:44185018-44185040 GCGAATGAATGAATGAAGAAAGG - Intronic
1184410416 22:44323022-44323044 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410476 22:44323254-44323276 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410502 22:44323362-44323384 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410543 22:44323556-44323578 GTGGATGGATGGATGGTGGATGG - Intergenic
1184410564 22:44323640-44323662 ATGGATGGATGGATGGTGAGTGG - Intergenic
1184460213 22:44633616-44633638 ATGAGTGGATGGATGATGAATGG + Intergenic
1184653345 22:45929349-45929371 GTGAATAGATGGATGGATAAAGG - Intronic
1184803736 22:46778158-46778180 GTGAATGAAGGGTGAGTGAATGG + Intronic
1184880683 22:47302594-47302616 ATGGATGGATGGATGATGAATGG - Intergenic
1184951616 22:47847069-47847091 GTGAGTGAATGGAGAGTGGATGG + Intergenic
1184991045 22:48170278-48170300 ATGAATGAATGGATGGAAAGAGG - Intergenic
1184996762 22:48212844-48212866 ATGAATGAATGAAAGATGAATGG - Intergenic
1185053521 22:48566117-48566139 ATGGATGGATGGATGATGAATGG + Intronic
1185053528 22:48566150-48566172 GACAATGAATGGATGGTGATGGG + Intronic
1185053568 22:48566335-48566357 GATGATGAATGGATGGTGATGGG + Intronic
1185076745 22:48687265-48687287 GTGGATGAATGGATGGTGGACGG + Intronic
1185103657 22:48855167-48855189 GTGAATGCATGGATGGATGATGG - Intergenic
1185104358 22:48858911-48858933 ATGGATGAATGGATGATGGAGGG - Intergenic
1185104407 22:48859118-48859140 ATTGATGAATGGATGATGAAAGG - Intergenic
1185108523 22:48887690-48887712 ATGAATGGATGGATGGTGGATGG - Intergenic
1185108605 22:48888127-48888149 GTGGATGGATGGATGGGGGATGG - Intergenic
1185154565 22:49185410-49185432 ATGGATGGATGGATGGTGAATGG - Intergenic
1185165588 22:49260426-49260448 ATGAATGGATGGATGATGGATGG - Intergenic
1185165597 22:49260477-49260499 ATGGATGAATGGATGATGGATGG - Intergenic
1185193338 22:49452610-49452632 GTGAATGGATGGATGATGGTGGG + Intronic
1185193379 22:49452813-49452835 GTGAGTCGATGGATGGTGGAAGG + Intronic
1185193493 22:49453436-49453458 ATGAGTGAATGGATGATGGATGG + Intronic
1185196791 22:49476767-49476789 ATGGATGAATGGATGCTGGATGG + Intronic
1185196810 22:49476847-49476869 ATGGATGGATGGATGGTGGATGG + Intronic
1185196821 22:49476893-49476915 ATGGATGGATGGATGGTGGATGG + Intronic
1185196831 22:49476927-49476949 GTGGGTGGATGGATGGTGGATGG + Intronic
1185196851 22:49477040-49477062 ATGAATAGATGGATGGTAAATGG + Intronic
1185196856 22:49477062-49477084 GTGGATGGATGGATGATGGATGG + Intronic
1185196871 22:49477125-49477147 ATGGATGGATGGATGGTGGATGG + Intronic
1185196874 22:49477140-49477162 GTGGATGGATGGATGGTGAATGG + Intronic
1185196886 22:49477190-49477212 ATGGATGGATGGATGGTGGATGG + Intronic
1185196904 22:49477250-49477272 GTGGATGGATGGATGGTGGATGG + Intronic
1185196932 22:49477385-49477407 ATGGATGGATGGATGGTGGATGG + Intronic
1185196939 22:49477411-49477433 GTGGATGGATGGATGGTGGATGG + Intronic
1185196952 22:49477460-49477482 ATGGATGGATGGATGGTGGATGG + Intronic
1185196969 22:49477521-49477543 TTGGATGGATGGATGGTGGATGG + Intronic
1185196980 22:49477563-49477585 TTGGATGGATGGATGGTGGATGG + Intronic
1185196988 22:49477593-49477615 ATGGATGGATGGATGGTGGATGG + Intronic
1185197001 22:49477649-49477671 ATGGATGGATGGATGGTGGATGG + Intronic
1185197036 22:49477771-49477793 ATGGATGGATGGATGGTGGATGG + Intronic
1185197042 22:49477794-49477816 ATGGATGGATGGATGGTGGATGG + Intronic
1185197048 22:49477817-49477839 ATGGATGGATGGATGGTGGATGG + Intronic
949845357 3:8364686-8364708 ATGAATGAATGGATGGATGAAGG - Intergenic
949917069 3:8973377-8973399 GTGGATGTCTGGATGGAGAAGGG + Intergenic
949929588 3:9068257-9068279 GTGGATGGATGCATGGTGATTGG - Intronic
950020974 3:9787388-9787410 GTGAATGAATGAATGAAGCATGG - Intronic
950025774 3:9819072-9819094 GTGGATGGATGGCTGGTGGATGG - Intronic
950177755 3:10887237-10887259 ATGCATGGATGGATGATGAATGG + Intronic
950202938 3:11057607-11057629 ATGGGTGAGTGGATGGTGAATGG + Intergenic
950257532 3:11518052-11518074 GTGATTGGTTGGATGGTGAGTGG + Intronic
950278150 3:11681386-11681408 CTGAATGAATGAATGAAGAAAGG - Intronic
951062401 3:18224460-18224482 ATGAATGAATGAATTCTGAAAGG + Intronic
951190090 3:19758111-19758133 GTGACTTAATGGATGGTGGTTGG - Intergenic
951443361 3:22748058-22748080 GTGAATGAACAGAGGATGAAAGG - Intergenic
951707701 3:25559806-25559828 GTGGATCAATGGATGGAAAATGG + Intronic
952206922 3:31189537-31189559 ATGAATGAATGAATGATGAATGG + Intergenic
952307671 3:32160312-32160334 GTGAATGGATGGATGATGGGTGG + Intronic
952307705 3:32160431-32160453 GTGAATGGATGGATGATGGGTGG + Intronic
952307735 3:32160537-32160559 GTGAATGGATGGATGATGGGTGG + Intronic
952978548 3:38716875-38716897 ATGGATGAATGGATGATGAATGG + Intronic
953066836 3:39480980-39481002 GTAAATGAATGGGAGGTGAAAGG - Intronic
953397325 3:42583429-42583451 ATAAATGGATGGATGGTGCAGGG + Intronic
954750206 3:52809307-52809329 GTGGATGCATGCATGGTGGAGGG - Intergenic
955026154 3:55169609-55169631 GTGAGTGAATGGATGGATGAAGG - Intergenic
955102590 3:55865844-55865866 ATGGATGAATTGATGTTGAATGG - Intronic
955399604 3:58581957-58581979 GTGAATCTATGGATGGTGAGAGG + Intronic
955410529 3:58652706-58652728 ATGAATGAGTGGGTGGAGAATGG - Intronic
955590784 3:60533091-60533113 GTGAATGAATTGATGGCAGATGG - Intronic
955880327 3:63537600-63537622 ATGAATGAATGAATGCTTAAAGG + Intronic
956098527 3:65743227-65743249 GCAAATGAATGGATTTTGAAAGG - Intronic
957603346 3:82367289-82367311 GTGTATGAATGGTTGATGTATGG + Intergenic
958436339 3:94100472-94100494 GTGAAGGGAAGGATGGGGAAAGG + Intronic
959224796 3:103566061-103566083 GTGAAAGAATGAATAATGAATGG + Intergenic
959386662 3:105717353-105717375 GTTATTGAATGGATGGATAATGG - Intronic
959577251 3:107947730-107947752 GTGAATGAATGAATATTGAATGG + Intergenic
961176871 3:124842891-124842913 GTGACTGTGTGGATGGAGAAGGG - Intronic
961554226 3:127686919-127686941 GTGAATGAATGGATGAGTGAAGG - Intergenic
961722612 3:128906729-128906751 GTGAATGAAGAGAGAGTGAAGGG + Intronic
961732410 3:128975572-128975594 ATGAATGGATGGATGGGGATGGG + Intronic
962103332 3:132365496-132365518 GTGAGTGAAGGGAGGGTGATAGG + Intronic
962242242 3:133759536-133759558 TTGTATGAGTGTATGGTGAAAGG + Intronic
962543932 3:136412238-136412260 ATGAATGAATAAATGGAGAAAGG + Intronic
962620739 3:137175608-137175630 TTGAATGAATGAATGATGAGTGG - Intergenic
962885099 3:139617336-139617358 GTGAATGAATGGAGGCTGCATGG + Intronic
963376600 3:144474254-144474276 GTGAATGAATGTATGTAGATAGG - Intergenic
963705444 3:148681305-148681327 ATGAATGAATGCATTGTGAAAGG - Intergenic
964061311 3:152527596-152527618 GTGAATGAATCAATCCTGAATGG + Intergenic
964211580 3:154234239-154234261 GTGAAAGGAAGGATGGTGATGGG - Intronic
964909546 3:161762628-161762650 GTGTATGAATGCATGTGGAATGG - Intergenic
965356563 3:167681487-167681509 ATGAATGAATGGATGGATCAGGG + Intergenic
965690020 3:171345927-171345949 ATGAATGAATGAATGATGAATGG + Intronic
966812646 3:183861286-183861308 TTGAGTGAATGAATGTTGAATGG - Intronic
967019025 3:185506345-185506367 GTGAATGAATGGATAAAGAAAGG - Exonic
967038259 3:185664496-185664518 GTGAATTAATGGAGGGAGAAGGG + Intronic
967660826 3:192107567-192107589 GAGAAAGAATGGAAGGTGAGAGG + Intergenic
967824646 3:193868782-193868804 GTGAATGAAGGGCTTGAGAAAGG - Intergenic
967948753 3:194824232-194824254 ATGAATGAATGAATGGTGACTGG + Intergenic
967954175 3:194864727-194864749 CTAAATGAAAGGATGGTGAAGGG + Intergenic
967995519 3:195163478-195163500 GTGAATCAATGGAAGGGGCAAGG - Intronic
968594525 4:1475458-1475480 GGGAATGGATGGATGGTGGGTGG + Intergenic
968924797 4:3541562-3541584 GGGAATAGATGGATGCTGAATGG + Intergenic
969146613 4:5129848-5129870 GTGAATGAATAAATATTGAATGG - Intronic
969352488 4:6605836-6605858 GTAGATGGATGGATGATGAATGG - Intronic
969465140 4:7351858-7351880 GTGAATGGATGGGGGATGAATGG - Intronic
969510293 4:7613866-7613888 GTGAATGAATGGATGGTGAATGG - Intronic
969510324 4:7614064-7614086 GTGGATGAATGGATCGTGGTTGG - Intronic
969510330 4:7614090-7614112 ATGGATGAATGGATGGTGATGGG - Intronic
969510492 4:7614811-7614833 ATGGATGAATGGATGGTGGTTGG - Intronic
969510521 4:7614940-7614962 ATGGGTGAATGGATGGTGAATGG - Intronic
969510736 4:7616373-7616395 ATGGATGAGTGGATGGTGAATGG - Intronic
969514943 4:7641945-7641967 ATGAATGGATGGATGGTAGATGG + Intronic
969523049 4:7689924-7689946 GTGAATGGATGGATGGAGGATGG + Intronic
969528492 4:7716520-7716542 ATGAATAGATGGATGGTGGATGG - Intronic
969599379 4:8166933-8166955 ATAGGTGAATGGATGGTGAATGG - Intergenic
969612210 4:8233712-8233734 GTGAATGGATGGATAATGGAAGG - Intronic
969612221 4:8233770-8233792 GTGAATGGATGGATAATGGAAGG - Intronic
969612236 4:8233847-8233869 GTGAATGGATGGATGATGGAAGG - Intronic
969612290 4:8234175-8234197 ATGAATGGATGGATGATGGATGG - Intronic
969612299 4:8234216-8234238 GTGAATGGATGGATGATGGAAGG - Intronic
969624384 4:8294920-8294942 GTGGATGAATGGATGATGGATGG - Intronic
969624392 4:8294955-8294977 GTAAATGGATGGATGATGGATGG - Intronic
969706674 4:8796153-8796175 GTGAATGCATGAATGTTGAATGG + Intergenic
970213730 4:13737227-13737249 GTGAATGAATGAATGATGAGTGG - Intergenic
970215207 4:13751816-13751838 GTGGATGAAAGGATGGTAAGCGG - Intergenic
970263609 4:14256232-14256254 GTGATTGACAGGATGGAGAATGG + Intergenic
970491027 4:16573735-16573757 CAGAATGCATGAATGGTGAATGG + Intronic
971425011 4:26507485-26507507 GTGAATGGATGGATGGAAGAAGG + Intergenic
974099347 4:57399554-57399576 GAGGATGAATGGATGGTATAAGG + Intergenic
974803174 4:66845470-66845492 TTGAATGAATGGATGTGGCAAGG + Intergenic
975628530 4:76375227-76375249 GTGCATTCATAGATGGTGAAAGG - Intronic
978662303 4:111141800-111141822 CTGAATGAATGGATAAAGAAAGG - Intergenic
978718739 4:111878531-111878553 GTGAATGAATTAATGATGTAAGG + Intergenic
979323797 4:119355159-119355181 GTGAATAAATGCATGGAAAATGG - Intergenic
979389584 4:120112326-120112348 GTGCATGTGTGGAAGGTGAAGGG + Intergenic
979498606 4:121412603-121412625 GTGTATGCATGGATGGAGAGTGG - Intergenic
979698842 4:123644089-123644111 GTGAATGAATGGATGGGTGATGG - Intergenic
980245695 4:130238093-130238115 TTGAATGAATGCATGGATAAAGG + Intergenic
980308566 4:131098520-131098542 ATGAATGAATGAGTGGTAAACGG - Intergenic
980906602 4:138954285-138954307 GTCAATGGCTGGATGGTGATGGG - Intergenic
982058975 4:151584034-151584056 GTAAATGAATGAATGATTAAAGG + Intronic
982395711 4:154913474-154913496 GTGAATGAATTAATGATGGATGG - Intergenic
982710106 4:158749429-158749451 GTGAAAGAATGGCTGGGGTAGGG + Intergenic
983048629 4:163017403-163017425 ATTAAGTAATGGATGGTGAATGG + Intergenic
983122201 4:163900237-163900259 GTGAATGAATGAATTTTGACTGG + Intronic
983622127 4:169772920-169772942 CTGAATGAATGGATGGATGAAGG - Intergenic
983745140 4:171189221-171189243 TTGAATCTTTGGATGGTGAAAGG + Intergenic
983779987 4:171656991-171657013 GTGCATTGATGGATGATGAACGG + Intergenic
984698614 4:182804091-182804113 GAGAAAGAAAAGATGGTGAACGG - Intergenic
985072122 4:186176584-186176606 GAGAAAGAATGGCTGGTGAAGGG + Intergenic
985179236 4:187238485-187238507 CTGGATGAATGGAGGGTGTAGGG - Intergenic
985709151 5:1418595-1418617 GTGGATGGATGGATGATGGATGG - Intronic
985709221 5:1418929-1418951 ATGGATGGATGGATGATGAATGG - Intronic
985709258 5:1419117-1419139 ATGGATGAATGGATGATGCATGG - Intronic
985829701 5:2219362-2219384 ATGAATGGATGGATTATGAATGG - Intergenic
985829711 5:2219413-2219435 ATGAATGGATGGATGTTGAATGG - Intergenic
985829729 5:2219500-2219522 GTGGATGGGTGGATGGTGAATGG - Intergenic
986277827 5:6295639-6295661 TTAAATAAATGGATGGTGAATGG + Intergenic
986413919 5:7509235-7509257 ATGAATGCATGCATGGTGAATGG + Intronic
986922728 5:12707426-12707448 GTGAAATAATGGAAGGTGAAGGG - Intergenic
987068021 5:14308642-14308664 ATGGATGGATGGATGATGAATGG - Intronic
987519044 5:18954461-18954483 ATGAATGAATGGAAAGTGAAAGG + Intergenic
987794958 5:22615811-22615833 GATAATGAATGTATGGTGAATGG + Intronic
989974027 5:50560761-50560783 TTGAATTAATGGGTGGTGATAGG - Intergenic
990521686 5:56587465-56587487 ATGAATGAATGGATGGGATAGGG - Intronic
990696455 5:58423083-58423105 GTTAATGAAAGGATTGTGGATGG - Intergenic
991248652 5:64534703-64534725 GGGTATTAATGGATGCTGAAAGG - Intronic
991327757 5:65456455-65456477 GTCAATGAAATAATGGTGAATGG - Intronic
993769959 5:91914807-91914829 GTGAATGCATGCATGGTGTGTGG + Intergenic
994436589 5:99742949-99742971 GATAATGAAAGGATGGTTAATGG - Intergenic
994499036 5:100551036-100551058 GAGAATGAAGGGAAGGTTAATGG + Intronic
994683655 5:102922273-102922295 GTTAAGGAATGGAAGGTGGATGG + Intronic
995778781 5:115754174-115754196 GGGAATGAATTTATTGTGAAAGG - Intergenic
996068452 5:119106810-119106832 ATGAATTAATGAATAGTGAAAGG + Intronic
996402174 5:123074511-123074533 GTGAATGAATGAATGAACAAGGG - Intergenic
996473764 5:123891075-123891097 GTGAATGAATAAATTGAGAAGGG + Intergenic
997755744 5:136397906-136397928 GGGAATGATTTGTTGGTGAAAGG + Intergenic
998178341 5:139915987-139916009 GGGAATGAAAGGATATTGAAGGG + Intronic
998297105 5:140981681-140981703 ATGAATGAATGAATGATGGAAGG - Intronic
998515573 5:142750737-142750759 ATGAATGAATGAATGATGGAAGG + Intergenic
998990392 5:147808959-147808981 AAGAGTGAATGGAAGGTGAAGGG - Intergenic
999211913 5:149896898-149896920 GTGCATCAATGGATGTTAAATGG - Intronic
999580340 5:153031439-153031461 GTGAATAAAGGGATGGAGATAGG - Intergenic
1000319547 5:160123240-160123262 GTGATTGGATGGATGGTTGATGG + Intergenic
1000397261 5:160788834-160788856 GTGGATGGATGGATGGTGGATGG - Intronic
1000673992 5:164098031-164098053 TTGAATGAAGGGTTGGTGGATGG + Intergenic
1001633303 5:173192482-173192504 ATGAATGAAGGGAGGGGGAAGGG + Intergenic
1001724745 5:173887736-173887758 GTGAGCGAATGGAAGGTTAAGGG + Intergenic
1001740843 5:174051568-174051590 ATGGATGGATGGATGATGAATGG - Intronic
1001751432 5:174134523-174134545 GTGAATGAATGGATAATGAGTGG - Intronic
1001751444 5:174134584-174134606 GTGAATGGATGGATGATGGATGG - Intronic
1001751495 5:174134893-174134915 ATGGATGGATGGATGATGAATGG - Intronic
1001865673 5:175102995-175103017 ATGAATGGATGGATGATGAATGG + Intergenic
1002010020 5:176271591-176271613 GGGAGAGAATGGATGGTTAATGG + Intronic
1002067664 5:176660209-176660231 ATGAGTGAATGGATGGAGGAAGG - Intergenic
1002216714 5:177640713-177640735 GGGAGAGAATGGATGGTTAATGG - Intergenic
1002298643 5:178245531-178245553 GTGAATGGATGGATGGGTGATGG - Intronic
1002760264 6:196513-196535 GTGAATGAATGAATAATGTATGG + Intergenic
1003178024 6:3768036-3768058 TTGAAGGAATGAGTGGTGAAAGG - Intergenic
1003287745 6:4749399-4749421 ATGAATGAATGTATGATGGATGG + Intronic
1003411694 6:5869623-5869645 GTGAATGAATGAATGAAAAATGG - Intergenic
1003520586 6:6855434-6855456 TTGAATGAATGGATGGAAAATGG - Intergenic
1003586121 6:7390557-7390579 GTGACTGAATGGGTAGGGAAAGG + Intronic
1003671825 6:8166238-8166260 GAGAATGGATGGCTGGTGACAGG - Intergenic
1003919292 6:10817468-10817490 GTTAATGAAAGAATGGAGAAAGG - Intronic
1004132255 6:12931599-12931621 GTGAATGAGTAGATGATAAATGG + Intronic
1004418325 6:15445523-15445545 GGGAGTGGATGGATGGGGAAAGG + Intronic
1004869565 6:19890994-19891016 GTGACTGTATGGATAGTTAATGG + Intergenic
1006260017 6:32859961-32859983 ATGAATGAATGCATTATGAAAGG - Intergenic
1006558800 6:34891025-34891047 CTAAATAAATGGATGGTGGATGG + Intronic
1008351245 6:50492869-50492891 ATGAATGAATAGATGATCAATGG + Intergenic
1008422134 6:51313636-51313658 ATGAATGGATGGATGATGGATGG - Intergenic
1008612602 6:53197898-53197920 ATGAATGTATGGAAGGTGTATGG - Intergenic
1008625149 6:53308453-53308475 GTGAATGAATGAATAATGAGTGG + Intronic
1009035760 6:58115736-58115758 ATGAATGAATGAATGAAGAATGG - Intergenic
1010149347 6:72712139-72712161 ATGAATGAATGAATGAAGAATGG + Intronic
1010689423 6:78891345-78891367 GTGAATGAATGGATGTGGGAAGG + Intronic
1011219674 6:85041006-85041028 TTGAGTGAATGAATGTTGAATGG - Intergenic
1011543276 6:88456692-88456714 TTGAATGAATGGATTGTGTAAGG - Intergenic
1011848900 6:91601607-91601629 GTGAATGAGTGAGTGGTGAGTGG + Intergenic
1013657800 6:112263663-112263685 TTGAATGAATGGATGGTGAATGG - Intergenic
1014139753 6:117927719-117927741 ATGAATGAATGAAAGGTGATGGG + Intronic
1015141544 6:129939856-129939878 ATGAATGAATGGATGGATGATGG - Intergenic
1015553313 6:134434886-134434908 ATAAATGAGTGGATGGTGGATGG + Intergenic
1015758720 6:136634341-136634363 GTGAATGAATGCATGTTTACAGG - Intronic
1016070008 6:139727304-139727326 GTGAGAAAATTGATGGTGAAAGG - Intergenic
1017053883 6:150420512-150420534 CTGAATGAATGTATGGAGCAGGG - Intergenic
1017207143 6:151815466-151815488 TTGAAAGAATGGATGGTGGTGGG + Intronic
1017659036 6:156656056-156656078 ATGAATGAATGGATGGATGAGGG - Intergenic
1017989927 6:159477677-159477699 TTGAATGAATGAATGAAGAAAGG + Intergenic
1018270578 6:162073149-162073171 GTAAATGAATGAATGGAGCAAGG + Intronic
1018309793 6:162495879-162495901 GTGAATGAATGTATGGAAAGGGG - Intronic
1019055265 6:169218871-169218893 GTGGATGGATGGATGATGAGTGG + Intronic
1019326895 7:442931-442953 GTGGATGAACGGAGGATGAATGG + Intergenic
1019326906 7:442988-443010 GTGGATGAATGGAGGATGAATGG + Intergenic
1019326912 7:443018-443040 ATGAATGGATGGAGGATGAATGG + Intergenic
1019327000 7:443437-443459 ATGGATGGATGGATGGTGAATGG + Intergenic
1019327014 7:443489-443511 GTGGATGGATGAATGGTGGATGG + Intergenic
1019327023 7:443520-443542 ATGGATGGATGGATGGTGGATGG + Intergenic
1019327040 7:443600-443622 GTGTATGGAGGGATGGAGAATGG + Intergenic
1019327048 7:443633-443655 GTGGATGGATGGATGGTGGATGG + Intergenic
1019327066 7:443727-443749 GTGAATAGATGGATGGTGGATGG + Intergenic
1019369877 7:656322-656344 GTGAATGAATGGATGATGCATGG + Intronic
1019555833 7:1630894-1630916 ATAAATGGATGGATGGTGGATGG - Intergenic
1019567197 7:1690201-1690223 GTGAATGGATGGATAGTTGATGG + Intronic
1019932128 7:4230568-4230590 ATGAATGGATGGATAATGAATGG + Intronic
1020365839 7:7379665-7379687 ATGAATAAATGAATGGAGAAAGG + Intronic
1020382738 7:7564943-7564965 GTGAAGTAATTGATGGTGCAAGG + Intergenic
1020895877 7:13938943-13938965 GTGTGTGATTGGATGGTAAATGG + Intronic
1021887405 7:25153176-25153198 GTGACTGAATGGTTGGAGAGAGG + Intronic
1022666051 7:32411587-32411609 GTGAGTGAATGGGGAGTGAATGG + Intergenic
1023595395 7:41824050-41824072 TTGAATGAATAAATGATGAATGG + Intergenic
1024378037 7:48661384-48661406 GTCAATGAAAGGATGGTGAGTGG + Intergenic
1024997243 7:55281263-55281285 GTGCATGAATGGTTGAAGAATGG + Intergenic
1025120103 7:56294618-56294640 ATGAATGGATGGATGGTTGATGG + Intergenic
1025120123 7:56294731-56294753 ATGAATGGATGGATAGTGGATGG + Intergenic
1025120126 7:56294746-56294768 GTGGATGGATGGATGGTGAATGG + Intergenic
1025120134 7:56294787-56294809 ATGAATGGATGAATGGTGGATGG + Intergenic
1025606884 7:63045842-63045864 ATGGATGAATGGATGATGGATGG - Intergenic
1026203538 7:68235740-68235762 ATGAATGGATGGAAGGTGGATGG + Intergenic
1026203561 7:68235896-68235918 ATGAATGAATGGATGGATGAAGG + Intergenic
1026203569 7:68235926-68235948 ATGAATGGATGCATGGTGGATGG + Intergenic
1026275192 7:68870244-68870266 ATGAATGGATGGATGATGAATGG + Intergenic
1026275213 7:68870372-68870394 ATGAATGGATGGATGATGGATGG + Intergenic
1026681752 7:72472290-72472312 GTGGATGAATGCATGGTCAATGG + Intergenic
1026828558 7:73598055-73598077 GTGGATGGATGGATGATGAATGG - Intronic
1027451605 7:78337885-78337907 ATGGATGGATGGATGGTGATTGG - Intronic
1027502999 7:78978923-78978945 CTGAATAAATGAATGGTGGATGG + Intronic
1027622223 7:80503266-80503288 AAGAATGCATGTATGGTGAATGG - Intronic
1027866422 7:83653219-83653241 GTGAATGATTGGATCGTATATGG - Intergenic
1028191995 7:87864666-87864688 GAAAATGAAGGGATGGGGAAAGG - Intronic
1028698120 7:93741355-93741377 GTAAATGAATGGAGGATGATGGG - Intronic
1028768729 7:94590345-94590367 GTGAATGAAAGCATGCTAAATGG - Intronic
1029088382 7:98029209-98029231 GTGAAAGAGGGGATGGTTAATGG - Intergenic
1029272335 7:99384667-99384689 GTGGATGTCTGGATGGAGAATGG + Intronic
1029604820 7:101592212-101592234 ATGAGTGGATGGATGGTGGATGG - Intergenic
1030171525 7:106607541-106607563 GTGAATGAATGGTAGGGGAGAGG + Intergenic
1030333787 7:108301696-108301718 TTGATTGAATGGAAGATGAATGG + Intronic
1030607621 7:111654689-111654711 GCCATTGATTGGATGGTGAAGGG + Intergenic
1031315536 7:120253831-120253853 CTCAATAAATGTATGGTGAAAGG + Intergenic
1031828723 7:126599952-126599974 ATGAATGGATGAATGGTGGATGG + Intronic
1032383694 7:131507145-131507167 GGGCATGAAAGGCTGGTGAATGG - Intronic
1032395549 7:131586736-131586758 CTGAATGAATAAATGGTAAAAGG - Intergenic
1034843623 7:154422678-154422700 GTGGATGGATGGATGGTGAGTGG + Intronic
1034883636 7:154780995-154781017 GTGAATGGATGGATGATGGGTGG + Intronic
1035278874 7:157765105-157765127 GTGAGTGGATGGATGGGGGAAGG - Intronic
1035278910 7:157765264-157765286 GTGGATGAATGGAGGAAGAATGG - Intronic
1035278964 7:157765505-157765527 GTGGGTGAATGGATGGAGGAAGG - Intronic
1035279030 7:157765788-157765810 GTGAGTGAATGGATGGAGGAAGG - Intronic
1035288533 7:157822039-157822061 ATGAGTGAATGGATGGTTATTGG - Intronic
1035452727 7:158988738-158988760 ATGAATGAATGCATGATGAATGG - Intergenic
1035452741 7:158988829-158988851 GTAAATGCATGGATGATGAATGG - Intergenic
1036662984 8:10720297-10720319 ATGAATGGATGGATGGAGAGTGG + Intergenic
1037101429 8:15052017-15052039 GTCAAAGCTTGGATGGTGAAGGG + Intronic
1037598690 8:20375276-20375298 ATGGATGGATGGATGGTGGATGG - Intergenic
1037747947 8:21661696-21661718 ATGAATGAATGAATGGAGAGTGG - Intergenic
1037921302 8:22808083-22808105 CTGAATGAATGGATGGATAGAGG - Intronic
1038325132 8:26567250-26567272 ATAAATGAATGGGTGGTGGATGG - Intronic
1038697109 8:29816446-29816468 ATGAATGAATGAATTATGAAAGG - Intergenic
1040499223 8:47992526-47992548 GTGCAGGAATAGATGGGGAATGG + Intergenic
1040584521 8:48726826-48726848 GTGGATGCATGGATGGACAATGG - Intronic
1040978216 8:53217573-53217595 GTGAAGGAATGGCTGCTGTAAGG + Intergenic
1041413749 8:57584678-57584700 ATGAATGAATGAATGGAGAACGG + Intergenic
1041630926 8:60086187-60086209 GTGAATGAAGGGAGGAAGAAGGG + Intergenic
1042068903 8:64909102-64909124 GTGAAAGTATAGATGGTGACAGG + Intergenic
1042094219 8:65194504-65194526 GTGAAAGATTGGAAGGTCAATGG - Intergenic
1042119607 8:65471589-65471611 ATGAATGAATAAATGATGAATGG + Intergenic
1042764741 8:72308739-72308761 GTGAATGTATGAATGGTCACTGG - Intergenic
1043013969 8:74914876-74914898 ATGAATGAATGTGTGGTGAGAGG - Intergenic
1043624578 8:82240423-82240445 GTGAATCAATGCCTGGAGAAGGG + Intergenic
1043842830 8:85128754-85128776 GTGACTGACTGGATGCTGGATGG - Intronic
1044517235 8:93153723-93153745 GTGAATGTATGGAGGTGGAAGGG + Intronic
1044898398 8:96917853-96917875 GACAATGAATGGTGGGTGAAGGG - Intronic
1045690912 8:104758961-104758983 GTGCATGACAGGAAGGTGAATGG - Intronic
1045795866 8:106043307-106043329 GCCAATGAATGGAGGGTGTAGGG - Intergenic
1046052394 8:109039340-109039362 ATAAATGGATGGATGATGAATGG + Intergenic
1046492365 8:114968932-114968954 ATGAATGAAATGATAGTGAAGGG + Intergenic
1047069258 8:121324390-121324412 GTAAATGAATGAATAATGAATGG + Intergenic
1047303049 8:123631216-123631238 TTGGATGAATGGAGAGTGAAAGG - Intergenic
1047306773 8:123659033-123659055 CTGAATGAATGGATGATGGATGG - Intergenic
1047306820 8:123659286-123659308 ATGGATGAATGGATGATGGATGG - Intergenic
1047306832 8:123659343-123659365 ATGGATGAATGGATGATGGATGG - Intergenic
1047306910 8:123659814-123659836 CTGGATGAATGGATGCTGGATGG - Intergenic
1047306946 8:123660041-123660063 ATGGATGAATGGATGATGGATGG - Intergenic
1047657372 8:126992490-126992512 GTGGTTGAATGGGTGGTGAATGG + Intergenic
1048010815 8:130454534-130454556 TTGAATGAATGGAGTGTCAAAGG + Intergenic
1048059987 8:130909033-130909055 ATGGATGGATGGATGGTGGATGG - Intronic
1048133241 8:131720503-131720525 TTGAATAAATGCGTGGTGAATGG + Intergenic
1048289839 8:133172288-133172310 ATGAATGAATGGATGATGGATGG - Intergenic
1048979765 8:139697005-139697027 GTGGACGGATGGATGGTGGATGG + Intronic
1048979784 8:139697087-139697109 GTGAACAGATGGATGGTGGATGG + Intronic
1048979837 8:139697312-139697334 GTGGGTGGATGAATGGTGAATGG + Intronic
1048989285 8:139751909-139751931 GTGGATAGATGGATGGTGGATGG - Intronic
1048989360 8:139752292-139752314 GTGGATGGATGGATGGTAGATGG - Intronic
1048989414 8:139752536-139752558 GTGGATAGATGGATGGTGGATGG - Intronic
1048989536 8:139753140-139753162 GTGGATGGGTGGATGGTGGATGG - Intronic
1048989541 8:139753155-139753177 ATGGATGGATGGATGGTGGATGG - Intronic
1048989576 8:139753312-139753334 GTGGATGGGTGGATGGTGGATGG - Intronic
1049042168 8:140120758-140120780 ATGAATGGATGGATGTTGGATGG - Intronic
1049233416 8:141495941-141495963 ATGACTGGATGGATGGTGAAAGG - Intergenic
1049359854 8:142207278-142207300 GTGAGTGGATGGATGGGGAATGG + Intergenic
1049359893 8:142207417-142207439 GTGGGTGGATGGATGGGGAATGG + Intergenic
1049359990 8:142207796-142207818 ATGCATGGATGGATGGGGAATGG + Intergenic
1049364269 8:142229156-142229178 ATGGATGAATGGAGGGTGGATGG + Intronic
1049364285 8:142229221-142229243 GTGGATGGATGGATGATGGATGG + Intronic
1049364290 8:142229244-142229266 ATGAATGGATGGATGGTGGATGG + Intronic
1049364302 8:142229294-142229316 ATGGATGGATGGATGGTGGATGG + Intronic
1049364328 8:142229433-142229455 GCAGATGAATGGATGGTGTACGG + Intronic
1049428492 8:142548479-142548501 GGGGATGGATGGATGGTGGATGG + Intergenic
1049428495 8:142548494-142548516 GTGGATGGATGAATGGTGGATGG + Intergenic
1049428499 8:142548509-142548531 GTGGATGGATGGATGGTGGATGG + Intergenic
1049464985 8:142746985-142747007 GTGGATGGATGGATGGTGGATGG + Intergenic
1049474805 8:142791914-142791936 ATGGATGGATGGATGATGAATGG - Intergenic
1049474881 8:142792463-142792485 ATGGATGGATGGAAGGTGAACGG - Intergenic
1049474926 8:142792728-142792750 GTGAATGGATGAATGGAGGATGG - Intergenic
1050629122 9:7540182-7540204 GTGAATGTAGGGGTGGTGAGGGG + Intergenic
1051695128 9:19760252-19760274 GTCCTTGAATGGATGGGGAATGG - Intronic
1052462367 9:28782342-28782364 GTGAATGAATGAAGGGAGGAAGG - Intergenic
1053295295 9:36908561-36908583 ATGAGTGAATGGGTGATGAATGG + Intronic
1053318642 9:37075553-37075575 GTAAATGAATGGTAGTTGAAAGG + Intergenic
1053322790 9:37115256-37115278 GTGGATGAATGGTAGTTGAAAGG + Intergenic
1053799975 9:41758006-41758028 AGGAATGAATGGATAATGAATGG + Intergenic
1053802979 9:41775744-41775766 ATGGATGGATGGATGGTGGATGG - Intergenic
1054142280 9:61539362-61539384 ATGGATGGATGGATGGTGGATGG + Intergenic
1054145341 9:61557396-61557418 GGGAATAGATGGATGCTGAATGG - Intergenic
1054188275 9:61969583-61969605 GGGAATAGATGGATGCTGAATGG + Intergenic
1054188404 9:61970154-61970176 AGGAATGAATGGATAATGAATGG + Intergenic
1054462029 9:65470513-65470535 ATGGATGGATGGATGGTGGATGG + Intergenic
1054465097 9:65488549-65488571 GGGAATAGATGGATGCTGAATGG - Intergenic
1054595960 9:67066477-67066499 ATGAATGAATGGGTTGTGACTGG + Intergenic
1054650121 9:67618467-67618489 AGGAATGAATGGATAATGAATGG - Intergenic
1054650239 9:67618993-67619015 GGGAATAGATGGATGCTGAATGG - Intergenic
1055016191 9:71620736-71620758 TTGAATGAAATGATGGTGACAGG + Intergenic
1055448089 9:76403196-76403218 GTGAATGAATGGATGAAGGAAGG - Intergenic
1055550540 9:77428521-77428543 CTGAATGAATTGGTGGTGAATGG - Intronic
1055673700 9:78633200-78633222 GTGAATGAATGGAGAGTTAAAGG + Intergenic
1056124645 9:83523141-83523163 GTGAATGGATGGAGGATGGATGG + Intronic
1057181121 9:93031042-93031064 ATGAATGAGTGGATAATGAATGG + Intronic
1057181133 9:93031085-93031107 GTGGATGAAGGGATGATGGATGG + Intronic
1058917183 9:109578931-109578953 GTGACTGAAGGGGTGGTGACCGG + Intergenic
1059249706 9:112877600-112877622 GTTAATGGATGGATGGTAGAGGG - Intronic
1059357651 9:113712375-113712397 GTGAATGACTAGATAGTCAATGG + Intergenic
1059409111 9:114120969-114120991 ATGGATGGATGGATGGTGGATGG + Intergenic
1059628644 9:116095385-116095407 CTGAGTGAATGAATGATGAATGG + Intergenic
1059739447 9:117135473-117135495 ATTAATGAATGGATGGAGACGGG - Intronic
1060010525 9:120039659-120039681 GAGAATGATAGGAGGGTGAAGGG + Intergenic
1060552554 9:124492496-124492518 ATGAATGAATGAATGGGCAAAGG - Intronic
1060724555 9:125998310-125998332 GTGACTGAATGCATGGTTATAGG + Intergenic
1060743712 9:126116355-126116377 ATGAATGAATGCATGGCTAATGG + Intergenic
1060864622 9:126985870-126985892 TTGAATGAGTGGAGTGTGAATGG + Intronic
1061210353 9:129188431-129188453 GTGAATGAATCAACAGTGAATGG - Intergenic
1061244708 9:129395496-129395518 GTGAATGAATGGAAGATGGATGG + Intergenic
1061256519 9:129456734-129456756 GTGGGTGAATGGAGGGTGGATGG + Intergenic
1061399583 9:130361047-130361069 ATGACTGAATGGATGGTGAATGG - Intronic
1061417477 9:130454914-130454936 ATGAATGGATGGATGGATAATGG - Intronic
1061417491 9:130454991-130455013 GTGAATGGATGGATGGATGATGG - Intronic
1061417498 9:130455025-130455047 ATGAATGGATGGATGATGGATGG - Intronic
1061417513 9:130455109-130455131 ATGAATAAATGGATGATGGATGG - Intronic
1061417522 9:130455169-130455191 ATGGATGAATGGATGATGCATGG - Intronic
1061876645 9:133547410-133547432 GTGAATGAATGAATGGGGGAGGG - Intronic
1061950523 9:133933489-133933511 ATGGATGGATGGATGGTGAATGG + Intronic
1061950533 9:133933543-133933565 ATGGATGGATGGATGGTGGATGG + Intronic
1061950538 9:133933562-133933584 ATGGATGGATGGATGGTGGATGG + Intronic
1061950566 9:133933692-133933714 ATGGATGGATGGATGGTGAGTGG + Intronic
1061950597 9:133933828-133933850 ATGGATGGATGGATGGTGGATGG + Intronic
1061950625 9:133933937-133933959 ATGGATGGATGGATGGTGGATGG + Intronic
1061955374 9:133958795-133958817 ATGAATGAATGAAGGATGAATGG - Intronic
1061980952 9:134103380-134103402 CTGGATGGATGGATGGTGGATGG - Intergenic
1061980956 9:134103395-134103417 GTGGATGGATGGATGCTGGATGG - Intergenic
1061980962 9:134103421-134103443 GTGGATGAATGGATGCTGGATGG - Intergenic
1061980970 9:134103458-134103480 GTGGATGGATGGATGGTGGATGG - Intergenic
1061980976 9:134103480-134103502 GTGGATGGATGGATGCTGGATGG - Intergenic
1061980992 9:134103562-134103584 ATGGATGGTTGGATGGTGAATGG - Intergenic
1061981081 9:134103991-134104013 GTGGATGGATGGATGGTGGATGG - Intergenic
1061981085 9:134104006-134104028 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981101 9:134104077-134104099 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981184 9:134104430-134104452 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981191 9:134104467-134104489 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981249 9:134104706-134104728 ATGGATGGATGGATGGTGGATGG - Intergenic
1061991925 9:134163820-134163842 GTGAATGAATCAATGTTGAGCGG + Intergenic
1062092308 9:134684890-134684912 GTGAATGGATAGATGGTGGATGG - Intronic
1062092317 9:134684933-134684955 ATGGATGAATGGATGGTGGATGG - Intronic
1062092322 9:134684956-134684978 ATTAATGGATGGATGGTGGATGG - Intronic
1062092328 9:134684987-134685009 ATTAATGGATGGATGGTGGATGG - Intronic
1062092341 9:134685049-134685071 ATGGATGGATGGATGGTGGATGG - Intronic
1062092349 9:134685080-134685102 GTGGATGGATGGATGGTGGGTGG - Intronic
1062092354 9:134685095-134685117 ATGAATGGATGGATGGTGGATGG - Intronic
1062092368 9:134685157-134685179 ATGAATGGATGGATGGTGGATGG - Intronic
1062092378 9:134685208-134685230 ATGGGTGAATGGATGGTGGATGG - Intronic
1062092387 9:134685247-134685269 CTTAATGGATGGATGGTGGATGG - Intronic
1062092395 9:134685286-134685308 GTGGATGGATGGATGGTGGATGG - Intronic
1062092399 9:134685301-134685323 ATGAATGGATGGATGGTGGATGG - Intronic
1062092411 9:134685356-134685378 ATGGGTGAATGGATGGTGGATGG - Intronic
1062092419 9:134685391-134685413 ATTAATGGATGGATGGTGGATGG - Intronic
1062092448 9:134685526-134685548 CTGGATGGATGGATGGTGGATGG - Intronic
1062092464 9:134685599-134685621 GTGGATGGATGGATGATGGATGG - Intronic
1062092467 9:134685614-134685636 GTGGATGGATGGATGGTGGATGG - Intronic
1062092471 9:134685629-134685651 ATGCATGGATGGATGGTGGATGG - Intronic
1062092538 9:134685934-134685956 ATGGATGGATGGATGGTGGATGG - Intronic
1062172222 9:135141221-135141243 ATGGATGAATGGATGATGGATGG + Intergenic
1062172231 9:135141274-135141296 ATGGATGAATGGATGATGGATGG + Intergenic
1062201249 9:135303981-135304003 GTGAATGGTTGGATGGTGGGTGG + Intergenic
1062201258 9:135304031-135304053 GTGGATGAATGGATGGTAGGTGG + Intergenic
1062201296 9:135304213-135304235 GTGGATGGATGGATGATGGAGGG + Intergenic
1062201359 9:135304496-135304518 GTGGATGGATGGATGATGGAGGG + Intergenic
1062201373 9:135304549-135304571 GTGGATGGATGGATGATGGAGGG + Intergenic
1062217059 9:135394893-135394915 GTGGATGGATGGGTGGTGGATGG + Intergenic
1062247722 9:135578049-135578071 GTGGGTGGATGGATGGTGGATGG - Intergenic
1062247791 9:135578395-135578417 GTGGGTGGATGGATGGTGGATGG - Intergenic
1062247860 9:135578741-135578763 GTGGGTGGATGGATGGTGGATGG - Intergenic
1062247979 9:135579411-135579433 GTGAATAAATGGATGGTGTATGG - Intergenic
1062248066 9:135579888-135579910 GTGGATGAATAGATAGTGAATGG - Intergenic
1062248072 9:135579929-135579951 GTAAATAAATGGATGGACAATGG - Intergenic
1062528763 9:136990375-136990397 GTGAATGAATGAATGGGGGGTGG - Intergenic
1062649860 9:137569898-137569920 GTGAGTGGATGGATGGTGGGTGG - Intronic
1185497529 X:566570-566592 GTAGATGGATGGATGGTGGATGG + Intergenic
1185543743 X:925356-925378 ATGGATGGATGGATGGTGGATGG + Intergenic
1185543748 X:925375-925397 ATGGATGGATGGATGGTGGATGG + Intergenic
1185546998 X:953845-953867 CTGAATGAATGGATGGATGAGGG - Intergenic
1185611535 X:1396267-1396289 TGGAATGAATGGATGATGGATGG + Intergenic
1185616429 X:1424687-1424709 GTGGATGACTGGATGGATAAAGG - Intronic
1185624710 X:1473732-1473754 GTGGGTGGATGGATGATGAATGG + Intronic
1185624839 X:1474250-1474272 GTGAGTGGATGGAGGATGAATGG + Intronic
1185624884 X:1474463-1474485 GTGAATGGATGTATGATGAATGG + Intronic
1185624936 X:1474700-1474722 GTGAATGGATGTATGATGAATGG + Intronic
1185624944 X:1474745-1474767 GTGAATGGATGTATGATGAATGG + Intronic
1185624998 X:1474998-1475020 GTGAATGGATGTATGAGGAATGG + Intronic
1185838885 X:3370100-3370122 TTTAATGAAAGGATGGTGGAAGG - Intergenic
1185925879 X:4145402-4145424 ATGGATGGATGGATGATGAATGG + Intergenic
1186084683 X:5974147-5974169 CTGAATGAAGGGGTGGGGAATGG + Intronic
1186150470 X:6669474-6669496 ATGAATGAATGGATGGAGAGTGG + Intergenic
1186284262 X:8027023-8027045 GTAGATGCATGGATGGTGGAAGG - Intergenic
1186358045 X:8807861-8807883 AAGAATGAATGGATGGGGATTGG - Intergenic
1186617455 X:11204294-11204316 AAGAATGAATGGATGGGGATTGG + Intronic
1186655410 X:11606536-11606558 GTGAATGAATAGATCCTGATAGG + Intronic
1186782953 X:12931481-12931503 GTGAATGAATGAATGAGCAAAGG + Intergenic
1187048523 X:15674126-15674148 ATGAATGAATGAATGGCTAATGG + Intergenic
1187070596 X:15883702-15883724 AAGAATGAATGGATGGGGATCGG - Intergenic
1187495846 X:19794845-19794867 CTGAATGAATGGAAGGAGTAAGG - Intronic
1188027816 X:25229174-25229196 GGGAAGGTAGGGATGGTGAAAGG + Intergenic
1190561185 X:51686910-51686932 ATGAGTAAATGGATGGTGGAGGG - Intergenic
1190563106 X:51706407-51706429 ATGAGTAAATGGATGGTGGAGGG + Intergenic
1190622160 X:52298337-52298359 ATGAATGAATGAATGGAGAGAGG - Intergenic
1190846707 X:54199273-54199295 TGGAATGGATGTATGGTGAAGGG - Intronic
1193620249 X:83744415-83744437 TTGACTGAATGGATGGAAAAGGG - Intergenic
1193853997 X:86576043-86576065 ATGAATGAATGGATGAAGAAAGG - Intronic
1194258221 X:91661188-91661210 ATGAATGAATGAATGATGGATGG - Intergenic
1194592531 X:95816864-95816886 GTGACTGATTGGATGGTGTGTGG - Intergenic
1194620994 X:96171660-96171682 GTGAATAAATGTATGATCAAAGG + Intergenic
1194809465 X:98373035-98373057 GTGAATAACTGGATGGTTAGAGG + Intergenic
1195741085 X:108065014-108065036 GTGAATGAATGAATTATAAATGG + Intronic
1196024808 X:111030609-111030631 ATGAATGAATGGATAGTTGAAGG + Intronic
1196213796 X:113026965-113026987 GTGAATGTGGGGATGGTTAATGG - Intergenic
1196650126 X:118159915-118159937 ATGGATGGATGGATGGAGAATGG + Intergenic
1199450717 X:147976227-147976249 TTGAGTGAATGGATGGATAAAGG - Intergenic
1200576988 Y:4900694-4900716 ATGAATGAATGAATGATGGATGG - Intergenic
1200687213 Y:6267336-6267358 GTGAATGAAGGTATTGTTAAGGG + Intergenic
1201048060 Y:9907374-9907396 GTGAATGAAGGTATTGTTAAGGG - Intergenic
1201144717 Y:11057971-11057993 GTGAATGAGTGGATGGAGGGAGG + Intergenic
1201236888 Y:11920696-11920718 TTTAATGAAAGGATGGTGGAAGG + Intergenic
1201242780 Y:11974842-11974864 GTGCATGAATGTCTGGTGCAGGG - Intergenic
1202579446 Y:26363968-26363990 GTGAATAAAAGCATGGGGAATGG - Intergenic