ID: 969511040

View in Genome Browser
Species Human (GRCh38)
Location 4:7618150-7618172
Sequence TTCACAGAAGCCTCCTCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969511034_969511040 17 Left 969511034 4:7618110-7618132 CCCTGATTCATCGCGTTGCCATC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 969511040 4:7618150-7618172 TTCACAGAAGCCTCCTCCGCAGG 0: 1
1: 0
2: 2
3: 14
4: 199
969511035_969511040 16 Left 969511035 4:7618111-7618133 CCTGATTCATCGCGTTGCCATCG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 969511040 4:7618150-7618172 TTCACAGAAGCCTCCTCCGCAGG 0: 1
1: 0
2: 2
3: 14
4: 199
969511037_969511040 -1 Left 969511037 4:7618128-7618150 CCATCGGAACTCTTCCACCTGCT 0: 1
1: 1
2: 0
3: 16
4: 234
Right 969511040 4:7618150-7618172 TTCACAGAAGCCTCCTCCGCAGG 0: 1
1: 0
2: 2
3: 14
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969511040 Original CRISPR TTCACAGAAGCCTCCTCCGC AGG Intronic
900361957 1:2293385-2293407 TTCAGAGAAGCGACATCCGCAGG - Intronic
900416390 1:2536941-2536963 TACACAGGAGCCTCCTGGGCTGG - Intergenic
900473390 1:2865207-2865229 TCCACAGAAGCCTCCGCAGGAGG + Intergenic
901259557 1:7861600-7861622 CTCACAGCAGCCTCCGCAGCAGG + Intergenic
901631090 1:10648486-10648508 TTCACAGCAGGCTTCCCCGCGGG + Intronic
901715401 1:11149596-11149618 TTCCCATAACCCTCCTCCTCAGG - Intronic
901801349 1:11709763-11709785 TACACAGAAAGCTCCTCCCCAGG - Intronic
902139140 1:14337597-14337619 TTAAGAGAAGCCTCCTTGGCTGG + Intergenic
902757388 1:18557984-18558006 TTCAAAGAAGCCGCCTCTGAGGG - Intergenic
904215440 1:28914913-28914935 TGCACACGAGGCTCCTCCGCGGG - Intronic
905141673 1:35850705-35850727 TTCACAGAAACCCCCGCCTCTGG - Intronic
907179588 1:52557860-52557882 CTCACTGAAGCCTCCACCCCCGG - Intergenic
907615344 1:55918774-55918796 ATTACAGCAGCCTCCTCCACTGG + Intergenic
911104099 1:94116650-94116672 TTCACAATAGCCTCTTCTGCCGG + Intronic
916261434 1:162846369-162846391 CTCACTGCAGCCTCCGCCGCTGG + Intronic
916552088 1:165859206-165859228 TTGCCAGCAGCCTCCTCCGCAGG - Intronic
916729419 1:167553178-167553200 TTCCCACAAGCCTCCGCCACTGG - Intronic
919787466 1:201268904-201268926 TTCACAGAGGCTTCGTCCACAGG + Intergenic
920173796 1:204087788-204087810 CTCACAGAAGCATCCTGTGCGGG - Intronic
922187878 1:223292569-223292591 TTCAAAGAAAACCCCTCCGCTGG + Exonic
923162445 1:231327488-231327510 CTCACTGCAGCCTCCTCCCCTGG + Intergenic
924536847 1:244942493-244942515 ATCACAGAGGCCCCCTCCTCCGG + Intergenic
1065210258 10:23396064-23396086 TTCAAAGAAGCATCCTTGGCCGG - Intergenic
1068763782 10:60740508-60740530 TTCACTGCAGCCTCCACCTCCGG - Intergenic
1071261389 10:83922614-83922636 TTCACAGCAGCATCCTTCTCTGG - Intergenic
1073995776 10:109313989-109314011 TTATCAAAATCCTCCTCCGCTGG + Intergenic
1074562080 10:114543845-114543867 TTCCCAGAACCCTCTTCCTCGGG + Intronic
1075495321 10:122914724-122914746 CTCACTGAAGCCTCCACCCCAGG - Intergenic
1075868613 10:125750452-125750474 TTCTCAAAAGACTCCTCTGCGGG - Intronic
1076507357 10:130986963-130986985 TTCACAGATGCCTCCTGCCCTGG - Intergenic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1080692952 11:34574336-34574358 ATCACAGAAGCCTCCTGAGAAGG + Intergenic
1080808717 11:35681373-35681395 TTCACAGAAGCCACCTCCTAGGG - Intronic
1081801062 11:45859669-45859691 TACAGAGGAGCCTCCTCCCCTGG + Intronic
1083463222 11:62828987-62829009 TTCACTGCAGCCTCCACCTCTGG - Intronic
1084788281 11:71456786-71456808 TTCACAGGAGCCTGCTCAGCAGG - Intronic
1084949976 11:72659449-72659471 TGCACAGAGGCCTCCCCCACAGG + Intronic
1085742809 11:79091451-79091473 TGCAAAGAAGCTTCCTCCGCAGG - Intronic
1087261002 11:96012401-96012423 TTCACAGCAGCCTCCTACAGAGG + Intronic
1088896784 11:114084508-114084530 TTCAAAAAACCCTCCTCCTCCGG - Intronic
1090796323 11:130138657-130138679 CTCACTGCAGCCTCCTCCTCTGG + Intronic
1090821792 11:130349194-130349216 CTCACTGAAGCCTCCACCTCCGG - Intergenic
1091261630 11:134239159-134239181 TCCACAGCAGCGTCCTCCCCAGG + Intronic
1091911035 12:4230872-4230894 TCCACATCAGCCTCCTCCTCTGG + Intergenic
1092395690 12:8123654-8123676 TTCACAGAAGCCCTTTCCTCAGG - Exonic
1097303765 12:58046586-58046608 CTCAAAGAAGCCTCTTCTGCTGG - Intergenic
1098149454 12:67531245-67531267 TGCTCAGAAGGCTCCTCCTCTGG + Intergenic
1098897243 12:76077907-76077929 CTCACTGCAGCCTCCTCCTCTGG - Intronic
1101512360 12:105404767-105404789 TTCACAGCTGCCTCCTCCATGGG + Intergenic
1102021825 12:109688458-109688480 CTCCCAGAAGCATCCTCCCCAGG + Intergenic
1102751453 12:115298292-115298314 TTCAGAGATTCCTCCTCCCCAGG + Intergenic
1103310821 12:120006189-120006211 TTTCCAGAAGCCTCCTCTCCAGG - Intronic
1103521098 12:121537444-121537466 TGCACAGAAGCCACCTGAGCTGG - Intronic
1103700880 12:122848206-122848228 TGCACAGGACCCTCCTCCCCGGG - Intronic
1104694975 12:130856364-130856386 TGAACAGAAGCCTCCTCCTAGGG - Intergenic
1111089937 13:83431785-83431807 CTGACAGAAGACTCCTCCCCTGG - Intergenic
1114184001 14:20386479-20386501 TTCACGGAATCGACCTCCGCTGG - Exonic
1117337554 14:54767725-54767747 CTCACTGCAGCCCCCTCCGCTGG - Intronic
1117793161 14:59362175-59362197 TCCCCAGAAGCCTCCACCCCAGG - Intronic
1119229809 14:72970978-72971000 ATCACAGAAGCCCTGTCCGCAGG + Exonic
1121104225 14:91270377-91270399 TTCACTGAAGCCTCGACTGCTGG + Intergenic
1123031884 14:105455858-105455880 AGCACAGAGGCCTCCTCCCCAGG - Intronic
1126141458 15:45442835-45442857 TTCACAAACTCCTCCTCCACTGG + Intronic
1127363166 15:58262768-58262790 ATCACAGAGGCCTCATCCTCTGG + Intronic
1130033745 15:80339797-80339819 TTCTCAGAGGCCTCCACCCCAGG - Intergenic
1132503739 16:296665-296687 AGCACAGAAGGCTCCTCCGTGGG + Intronic
1132682042 16:1146389-1146411 GTCAGGGAAGCCTCCTCCGAGGG - Intergenic
1135349389 16:21715981-21716003 TTCACTGCAGCCTCCACCTCTGG + Intronic
1135631571 16:24039651-24039673 TGCACAGAAGCCTCCTCACCTGG - Intronic
1135711129 16:24718184-24718206 CTCCCAGAAGCCTTCTCTGCTGG + Intergenic
1136185916 16:28588956-28588978 CTCACAGTAGCCTCCTGCGCAGG - Intronic
1137830429 16:51538650-51538672 TTCAGAGAAGCCTCATGCCCAGG - Intergenic
1138859763 16:60742545-60742567 TTCCCAGAATCCTCCACTGCTGG + Intergenic
1142229252 16:88892040-88892062 AACACGGAAGCCTCCTCCTCAGG - Intronic
1142230511 16:88898015-88898037 TTCACCGCAGCATCCTCAGCTGG - Intronic
1145056389 17:19706540-19706562 ATCCCAGAAGCCCCCTCCCCAGG - Intronic
1146693638 17:34893075-34893097 AGCACAGCAGCCTCCTCCTCAGG - Intergenic
1147056603 17:37839700-37839722 CTCACAGAAGCCTCCGGCACTGG - Intergenic
1147349968 17:39834889-39834911 TGCACAGTGGCCTCCTCCACAGG + Intronic
1152145328 17:78564918-78564940 TTCTCAGAAGGCTCTTCCCCAGG - Intronic
1152316979 17:79586726-79586748 TTCTCAGAAGCATCCTCTCCCGG + Intergenic
1152494860 17:80663882-80663904 GGCACGGAAGCATCCTCCGCTGG + Intronic
1152661448 17:81544185-81544207 TACACAGGAGCCTCCCCAGCTGG + Intronic
1156171038 18:34485839-34485861 TTCACTGCAACCTCCTCCTCTGG - Intergenic
1156250119 18:35344437-35344459 TTCCCAGAAGCCCCCGGCGCGGG + Exonic
1157163762 18:45339008-45339030 CTCACTGCAGCCTCCTCCTCCGG + Intronic
1162063103 19:8108749-8108771 CTCACTCAAGCCTCCTCCCCTGG + Intronic
1162804150 19:13128199-13128221 TTCACTGATGCCTCCCCCACTGG - Intronic
1162895126 19:13760842-13760864 CTCACTGAAGCCTCCACCCCAGG + Intronic
1163121818 19:15222966-15222988 CCCACAGAAGCCTCCCACGCCGG - Intergenic
1165150106 19:33755172-33755194 TTCACAGAAGCCTCTGGCACTGG + Intronic
1166809824 19:45508339-45508361 TTCACACCAGCCTCCTCCACAGG - Intronic
1167532277 19:50025476-50025498 TTCCCAGATGCCTCCGCGGCAGG + Exonic
1168362908 19:55757612-55757634 TTCACAGAAAGCAGCTCCGCTGG - Intergenic
1168363865 19:55767612-55767634 TTCACAGAAAGCAGCTCCGCTGG - Intergenic
924983616 2:247010-247032 CTCACAGAGGCCTCCTACACGGG - Intronic
925037207 2:697375-697397 TTGACAGAAGGCTCCTTGGCAGG - Intergenic
925297405 2:2786815-2786837 CTCACTGCAGCCTCCTCCTCAGG - Intergenic
926233594 2:11023080-11023102 TTCACAGAGGACTGCTCAGCAGG + Intergenic
926308769 2:11659471-11659493 GTGACAGATGCCTCCTCCTCAGG - Intronic
927856204 2:26529549-26529571 CTCACAGAAGCCTCCTCCCGAGG - Intronic
932641640 2:73453434-73453456 TTCAAAGAACCCTCTTCCACGGG + Exonic
934160962 2:89249193-89249215 ATCACAGCAGCCTGCTCCACAGG - Intergenic
934206315 2:89933240-89933262 ATCACAGCAGCCTGCTCCACAGG + Intergenic
934887776 2:98039872-98039894 TTCACAAAAACCTCCCCTGCTGG - Intergenic
935646727 2:105342953-105342975 TCGACTGAAGCCTCCCCCGCAGG + Exonic
935755203 2:106271203-106271225 TTCACAGAAGCCTCTAAGGCTGG - Intergenic
939881750 2:147639421-147639443 TTCCCAGATTCCTCCTCCCCAGG + Intergenic
939992222 2:148886455-148886477 TCCACATAAGCCTCCTCACCTGG + Intronic
940293501 2:152099217-152099239 TTCCGAGAAGCCCCCTCCCCGGG - Intergenic
941080742 2:161057875-161057897 TTCACAGCAGCCTCCTCTGCTGG - Intergenic
941163132 2:162057406-162057428 TTCCAAGAAGCCTCATCTGCAGG + Intronic
941796406 2:169604414-169604436 TACACATAAGCGTCCTCAGCTGG + Intronic
944560634 2:200933640-200933662 TTCACATAATCCTCCTCCCTTGG + Intronic
945235596 2:207628646-207628668 CTCACTGAAGCCTCCACCTCTGG - Intergenic
948989048 2:241542501-241542523 TTCACAAAACCCTCCTGAGCCGG + Intergenic
1170889199 20:20364685-20364707 TTCACAGAAGCCCCCACTCCCGG - Intergenic
1172885592 20:38228734-38228756 TTCCCAGAAGCCTCTTTCCCTGG - Intronic
1173381752 20:42550907-42550929 TTCAAAGAAGCCTCCTTTGGTGG - Intronic
1173925046 20:46774914-46774936 TTCACTGCAGCCTCCACCTCCGG + Intergenic
1174402797 20:50284939-50284961 TTCCCAGAAGCCTCTGCCCCCGG - Intergenic
1174592205 20:51654912-51654934 GTCACACAAGCCTCCTCCCTAGG + Intronic
1175749477 20:61485375-61485397 CTAACTGCAGCCTCCTCCGCAGG - Intronic
1176953613 21:15074151-15074173 TTCACTGAAGCCTCAGCCTCTGG + Intergenic
1178331259 21:31694812-31694834 TACACAGAAGCCGCATCAGCAGG - Exonic
1178398338 21:32262160-32262182 CTCACAGAACCCTCTTCCGTAGG - Intergenic
1178589635 21:33898508-33898530 TTCACAGAATCCTCCTTAGGTGG - Exonic
1179209929 21:39315558-39315580 TTCACTGCAGCCTCCGCCTCCGG - Intronic
1179249753 21:39663055-39663077 TTCAGAAAAGCCTCCTTCTCAGG + Exonic
1180225493 21:46389541-46389563 TTCAGAAAAGCCTCCTCCTTGGG - Intronic
1181368526 22:22398455-22398477 TGCACACCAGCCTCCTCCCCTGG - Intergenic
1182307344 22:29379657-29379679 ATCTCAGAACCCTCCTCCTCTGG - Intronic
1183065809 22:35361921-35361943 TTCACAGTAGCCTCTGCCTCGGG - Intergenic
1183543697 22:38444380-38444402 TGCTCAGAGGCCACCTCCGCTGG - Intronic
1184743272 22:46441565-46441587 TCCACAGAGGCCACCTCAGCTGG - Intronic
1184744887 22:46450439-46450461 TTCACAGCAACCTCCTCCAGAGG + Intronic
951562529 3:23982472-23982494 CTCACTGAAGCCTCCTCCACCGG - Intergenic
952680871 3:36089922-36089944 TTCACTGCAGCCTCCACCCCTGG - Intergenic
954044107 3:47914882-47914904 AACACAGAATCCTCCTCGGCCGG + Exonic
955365954 3:58310131-58310153 TTCACTGCAGCCTCCACCTCTGG - Intronic
957150150 3:76476077-76476099 TTCACTGAAACCTCCACCTCCGG - Intronic
962416765 3:135189860-135189882 TTCACATAAGCCTCCTGCCTGGG - Intronic
962712723 3:138101404-138101426 TGCACAGCAGCCTCCCCCGCTGG + Intronic
963407578 3:144886969-144886991 CTCACTGCAGCCTCCACCGCCGG + Intergenic
969511040 4:7618150-7618172 TTCACAGAAGCCTCCTCCGCAGG + Intronic
971277150 4:25209271-25209293 CTCACAGAAGCCTCAACCTCTGG - Intronic
971441423 4:26691908-26691930 TCCACAGAACCATCCTCAGCAGG + Intronic
972404916 4:38736378-38736400 TTCACTGAAACCTCCACCTCTGG + Intergenic
973004001 4:44987485-44987507 CTCTCAGAAGCCTCCTGCCCAGG - Intergenic
974084955 4:57250065-57250087 TTCATAGAGGCCTCCAGCGCAGG + Intergenic
975835140 4:78414959-78414981 GTCACAGAAGCTTCCTCTGGGGG + Intronic
976041086 4:80885787-80885809 TTCACAGTAGCCACCACAGCTGG - Intronic
979906185 4:126296726-126296748 CTCACCGAAGCCTCCACCTCCGG - Intergenic
981343623 4:143650446-143650468 TTCACAGAAGACTCGTCAACTGG - Intronic
985529072 5:423282-423304 TTCACAGAAGACCCCTGCACAGG + Intronic
986297345 5:6449884-6449906 CACACACAAGGCTCCTCCGCAGG + Intronic
986415674 5:7525887-7525909 TGCACAGATGCCTCCTCCCTTGG + Intronic
990508703 5:56470456-56470478 ATCACAAAAGCCACCTCCACAGG - Intronic
999391265 5:151193440-151193462 TTCACTGCAGCCTCCACCTCTGG - Intronic
1002181401 5:177432843-177432865 CCCCCAGAAGCCCCCTCCGCTGG - Intronic
1002898587 6:1392999-1393021 TCCTCCGAAGCCTCCACCGCTGG - Intronic
1005459688 6:26056367-26056389 TTTACAGGGGCCTTCTCCGCAGG + Exonic
1010158558 6:72824284-72824306 TTCACAGACCCCACCACCGCTGG - Intronic
1011464508 6:87641464-87641486 TCCACAGAAGCTTGCTCTGCTGG - Intronic
1012376421 6:98567276-98567298 TTCACTGAAACCTCCACCTCTGG + Intergenic
1012903710 6:105038607-105038629 TTCACAGAAATCTCCTTCTCTGG - Intronic
1016156447 6:140815236-140815258 TTCACTGAAACCTCCACCTCTGG - Intergenic
1018195775 6:161355276-161355298 TTCCAGGAAGCCTCCTCCTCCGG + Intronic
1018900626 6:168050094-168050116 TGCACAGAGGCCGCCCCCGCAGG - Intergenic
1022100210 7:27164927-27164949 TTCAGAGAAGGCGCCTTCGCTGG + Exonic
1023685652 7:42732244-42732266 TTCACAGCAGCATCCTGAGCAGG + Intergenic
1024594296 7:50918874-50918896 TGCTCAGAAGCCACCTCCACTGG - Intergenic
1026244859 7:68610937-68610959 TTCACAGTAGCCCCATCCACAGG + Intergenic
1026831426 7:73612566-73612588 CTCACTGCAGCCTCCTCCTCCGG - Intronic
1029745573 7:102514118-102514140 TTCACTGCAACCTCCTCCTCCGG - Intronic
1029763512 7:102613097-102613119 TTCACTGCAACCTCCTCCTCCGG - Intronic
1030672364 7:112351718-112351740 TTCACTGCAGCCTCCACCTCCGG - Intergenic
1032224129 7:130017131-130017153 CTCACTGTAGCCTCCTCCCCCGG + Intergenic
1032340566 7:131068967-131068989 TTCACAGATTCCTTCTCAGCTGG + Intergenic
1032546598 7:132748986-132749008 CTCACTGTAGCCTCCTCTGCAGG + Intergenic
1034578194 7:152019769-152019791 TTCACAGATGCCTCCAACTCTGG - Exonic
1035381804 7:158445407-158445429 TGCACAGCAGCCTCCATCGCAGG + Intronic
1037927623 8:22856640-22856662 TTCACAGAAACCTCTTCTTCTGG - Intronic
1038094333 8:24291086-24291108 TTCACTGCAACCTCCTCCTCCGG + Intergenic
1039080676 8:33731442-33731464 ATCACAGAAGTGTCCTCCTCTGG - Intergenic
1042595181 8:70439736-70439758 GCAGCAGAAGCCTCCTCCGCGGG - Intergenic
1042675112 8:71311912-71311934 TTCACAGAAGCCTGCTTGGCAGG + Intronic
1043387328 8:79761198-79761220 TTCACAGAAACCTCTTCCAAAGG - Intergenic
1044953245 8:97453756-97453778 TTCACTGCAGCCTCCGCCTCTGG - Intergenic
1046297862 8:112245609-112245631 TTCACTGCAGCCTCCACCTCCGG + Intronic
1047795772 8:128254037-128254059 ATCACAGAAGCCTGCTCTGGGGG + Intergenic
1048831436 8:138481498-138481520 TTCACAAAAGCCTGCTCCACTGG - Intronic
1049112118 8:140653104-140653126 CTCACTGAAGCCTCCACCCCTGG + Intergenic
1049425979 8:142538086-142538108 TTCACACAAGCTTCCACCCCAGG + Intronic
1049797112 8:144501853-144501875 TCCACGGGAGCCTCCACCGCCGG - Exonic
1049960675 9:735064-735086 CTCACAGATGCCTCCACCCCAGG - Intronic
1049988398 9:972077-972099 TTCCCAGGAGCCTCCTGGGCGGG - Intergenic
1050736448 9:8768477-8768499 CTCACTGCAGCCTCCTCCTCTGG - Intronic
1053246228 9:36536707-36536729 TTCACAGCAACCTCCACCTCTGG + Intergenic
1053428151 9:38024601-38024623 TTCCCAGCAGCCTCCTACCCAGG - Intronic
1055958593 9:81798086-81798108 CTCACTGAAACCTCCTCCCCTGG + Intergenic
1058648555 9:107153748-107153770 TTCACAGACTCCTCCTCAGAGGG - Intergenic
1060806983 9:126583992-126584014 TTCACAGAACTCTGCTCCCCAGG + Intergenic
1060869386 9:127027618-127027640 TTCAGGGAAGCCTCATCCACTGG - Intronic
1061412303 9:130428257-130428279 TCCACAGAGGCTTCGTCCGCAGG - Intronic
1061451407 9:130668862-130668884 ATCACAGAATCCTCCTCCTGGGG - Intronic
1062073316 9:134571052-134571074 TTCACAGCAACCTCATCCACGGG - Intergenic
1185721498 X:2385799-2385821 TTCAAAGAAGCATCATCGGCTGG - Intronic
1187131240 X:16505099-16505121 TTCACAGTTGCCTCCTCCAAAGG + Intergenic
1188444451 X:30241995-30242017 TTTTCAGAAGCCGCCTCTGCAGG - Intergenic
1188543028 X:31270438-31270460 TTCAGAGAAGCCTCCTCTGTAGG + Intronic
1189237672 X:39500516-39500538 TCCACAGAAGCCTCCTCCTCAGG - Intergenic
1193365057 X:80622578-80622600 CCCACAAAAGCCTCCTCCGAGGG - Intergenic
1196746307 X:119073880-119073902 TTCTCTGAGGCCTCCTCTGCGGG - Intergenic
1196746317 X:119073928-119073950 TTCTCTGAGGCCTCCTCTGCGGG - Intergenic
1200215662 X:154367182-154367204 GTCACAGAAGCCTGCTGCGTGGG - Intronic