ID: 969511920

View in Genome Browser
Species Human (GRCh38)
Location 4:7623002-7623024
Sequence GACTGATGACCGATGGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 69}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969511909_969511920 22 Left 969511909 4:7622957-7622979 CCCCAGAGCCACTCCCTGCCACT 0: 1
1: 0
2: 10
3: 53
4: 535
Right 969511920 4:7623002-7623024 GACTGATGACCGATGGCATATGG 0: 1
1: 0
2: 0
3: 3
4: 69
969511913_969511920 14 Left 969511913 4:7622965-7622987 CCACTCCCTGCCACTGAGGAGTG 0: 1
1: 0
2: 6
3: 32
4: 309
Right 969511920 4:7623002-7623024 GACTGATGACCGATGGCATATGG 0: 1
1: 0
2: 0
3: 3
4: 69
969511911_969511920 20 Left 969511911 4:7622959-7622981 CCAGAGCCACTCCCTGCCACTGA 0: 1
1: 0
2: 0
3: 30
4: 312
Right 969511920 4:7623002-7623024 GACTGATGACCGATGGCATATGG 0: 1
1: 0
2: 0
3: 3
4: 69
969511917_969511920 4 Left 969511917 4:7622975-7622997 CCACTGAGGAGTGGAAACGCTAG 0: 1
1: 0
2: 1
3: 7
4: 102
Right 969511920 4:7623002-7623024 GACTGATGACCGATGGCATATGG 0: 1
1: 0
2: 0
3: 3
4: 69
969511910_969511920 21 Left 969511910 4:7622958-7622980 CCCAGAGCCACTCCCTGCCACTG 0: 1
1: 0
2: 0
3: 42
4: 382
Right 969511920 4:7623002-7623024 GACTGATGACCGATGGCATATGG 0: 1
1: 0
2: 0
3: 3
4: 69
969511915_969511920 9 Left 969511915 4:7622970-7622992 CCCTGCCACTGAGGAGTGGAAAC 0: 1
1: 0
2: 0
3: 10
4: 139
Right 969511920 4:7623002-7623024 GACTGATGACCGATGGCATATGG 0: 1
1: 0
2: 0
3: 3
4: 69
969511916_969511920 8 Left 969511916 4:7622971-7622993 CCTGCCACTGAGGAGTGGAAACG 0: 1
1: 0
2: 2
3: 6
4: 106
Right 969511920 4:7623002-7623024 GACTGATGACCGATGGCATATGG 0: 1
1: 0
2: 0
3: 3
4: 69
969511908_969511920 27 Left 969511908 4:7622952-7622974 CCAGACCCCAGAGCCACTCCCTG 0: 1
1: 1
2: 3
3: 59
4: 537
Right 969511920 4:7623002-7623024 GACTGATGACCGATGGCATATGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969511920 Original CRISPR GACTGATGACCGATGGCATA TGG Intronic
900540665 1:3201085-3201107 GACTGAAGTCTGATGGCAGAAGG + Intronic
902573455 1:17361541-17361563 GACTCATGACCCATGGAAAATGG + Intronic
904031053 1:27533621-27533643 GACTGATGACCTGGGGCAAATGG + Intergenic
905015446 1:34775160-34775182 GACTGACAGCCGATGGCATCAGG - Intronic
907215989 1:52864475-52864497 GCCTCATGAGCCATGGCATACGG + Intronic
907257042 1:53187406-53187428 GACTGAAGACCACTGGCCTAAGG + Intergenic
909496477 1:76284827-76284849 GACTGAAGGACAATGGCATATGG - Intronic
912631743 1:111252440-111252462 GTCTGATGACCTATGACCTAAGG + Intergenic
915719264 1:157972236-157972258 GACTGATGACCTAGGGTATCTGG - Intergenic
921557939 1:216621700-216621722 AACTGCAGACTGATGGCATATGG + Intronic
922911292 1:229220057-229220079 GGCTGATGATTGATAGCATAAGG - Intergenic
922911319 1:229220248-229220270 GGTAGATGACAGATGGCATATGG - Intergenic
1065895415 10:30159082-30159104 GACTGATGACAAATTGGATATGG - Intergenic
1066684148 10:37964569-37964591 GACTGATGACCTAGGGTATCTGG + Intronic
1067698350 10:48551427-48551449 GACTGAGGACTGATGGCAAATGG - Intronic
1072513153 10:96149218-96149240 GACTGGTGATAGATGGCTTATGG + Intronic
1075184714 10:120245363-120245385 GAGTGATGACCTAGGGCATCTGG + Intergenic
1075949947 10:126468529-126468551 GACTGATCACGGTTGGCATCAGG + Intronic
1077034771 11:489327-489349 GTCTGTTGCCCGATGGCACAGGG + Intronic
1084658807 11:70535366-70535388 GACTGATGGATGATGGCAGATGG - Intronic
1084658817 11:70535428-70535450 GACTGATGGATGATGGCAGATGG - Intronic
1088700260 11:112405182-112405204 AACCGATGACAGATGGAATATGG + Intergenic
1095145681 12:38722988-38723010 GGCGGATGACCGATGGCACAGGG - Intronic
1102653549 12:114461172-114461194 GAGTGATGACCAATGGAACATGG + Intergenic
1103153840 12:118666354-118666376 GAATGATGGCCTATGGAATAAGG - Intergenic
1108131240 13:47302755-47302777 GGCTGATGACTGATGACAAATGG + Intergenic
1111658687 13:91182256-91182278 GACTGAGGACTCATGGCATATGG - Intergenic
1112634555 13:101200643-101200665 CACTGAGGACCCATGCCATAGGG + Intronic
1113133682 13:107065200-107065222 GACTGATGACAGATGTCAGTTGG + Intergenic
1117313797 14:54554606-54554628 AACTGGTGACAGATGGCATGTGG - Intergenic
1120594691 14:86419228-86419250 GCCTGATGACAGTTGTCATAAGG - Intergenic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1122644721 14:103186708-103186730 GACTGATGAGTGAGGGCAGAGGG - Intergenic
1124464585 15:29925366-29925388 GACTGAGGACAGAGGGCATCAGG + Intronic
1141664879 16:85460899-85460921 GTCTGATGACAGATGGGAAAGGG + Intergenic
1149922909 17:60675893-60675915 GACTGATGACCGTAGACATCTGG + Intergenic
1154070981 18:11150691-11150713 GACTCAAGACAGTTGGCATATGG + Intergenic
1156697657 18:39786581-39786603 GACTGCTGACAGATGGGATGTGG - Intergenic
927384407 2:22516384-22516406 GACTGATACACCATGGCATAGGG - Intergenic
932128883 2:69169520-69169542 GAATGATGACACATGGGATAAGG - Intronic
937117883 2:119421840-119421862 GAGTGATGACCTAGGGTATATGG - Intergenic
1174176226 20:48646739-48646761 GATTGATGAGCTATGGCCTAGGG - Intronic
1178330157 21:31682961-31682983 GACTGCTGACTGAAGGCACATGG + Intronic
1180123373 21:45768939-45768961 GCATGATGACCGATGGCAGGAGG + Intronic
968329737 3:197856896-197856918 GTCTGATGAACGATATCATAAGG + Intronic
969511920 4:7623002-7623024 GACTGATGACCGATGGCATATGG + Intronic
970848877 4:20577697-20577719 GACTGATGATCTATAGCACAGGG - Intronic
974231617 4:59122910-59122932 AAGTAATGACAGATGGCATAAGG - Intergenic
978831372 4:113089236-113089258 GAATAGTGACTGATGGCATATGG - Intronic
981686878 4:147464710-147464732 GGCTGATATCTGATGGCATATGG - Intergenic
981817986 4:148852727-148852749 GAGTGAAGAACGAAGGCATAAGG + Intergenic
985579453 5:689277-689299 GACTGATGACTGATGGCCAGAGG + Intronic
985594299 5:781336-781358 GACTGATGACTGATGGCCAGAGG + Intergenic
985809473 5:2072551-2072573 GACTGATGACCTAGGGTATGTGG + Intergenic
985929166 5:3042629-3042651 CACTGATGACCAAAGGCATTGGG + Intergenic
989754849 5:44940020-44940042 GTCTGATGACCAAGGGCAGAAGG - Intergenic
1001832314 5:174799140-174799162 GACTGATATCCGTTGGCAGAGGG - Intergenic
1002824881 6:763671-763693 AGCTGAGGACCGAGGGCATAAGG + Intergenic
1011309447 6:85966049-85966071 AACTGATGAACTATAGCATAGGG + Intergenic
1012503983 6:99923183-99923205 GATTGTTGACTGTTGGCATATGG + Intronic
1013235756 6:108196727-108196749 GAGTGAGGACCAATGGCATCAGG - Intergenic
1029950270 7:104576713-104576735 GACTGATGACTGAAGGCACTGGG - Intronic
1036813200 8:11881768-11881790 GCCTGATGACCACTGGCATGAGG - Intergenic
1039397693 8:37241106-37241128 GACTGAAGACCGAAGGCCGATGG + Intergenic
1042372897 8:68012909-68012931 GACTGATAAACCATGTCATATGG + Intronic
1043044069 8:75299135-75299157 AACTGATGACCAATAGTATAAGG + Intergenic
1053088487 9:35250300-35250322 GACTGATGACTAAGGGCACAGGG - Intronic
1053706671 9:40761013-40761035 CTCTGATGATCCATGGCATATGG + Intergenic
1054416585 9:64881782-64881804 CTCTGATGATCCATGGCATATGG + Intergenic
1059685039 9:116626914-116626936 TGCTGATGACGGATGGCAGATGG - Intronic
1188888604 X:35582025-35582047 GAGTGATGACCTAAGGTATATGG + Intergenic
1188888715 X:35583010-35583032 GAGTGATGACCTAAGGTATATGG + Intergenic
1199698907 X:150362609-150362631 CACTGATGACCGCTGGCTTTTGG + Intronic