ID: 969512997

View in Genome Browser
Species Human (GRCh38)
Location 4:7630224-7630246
Sequence CCATGTCCACAGGTGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 6, 3: 23, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969512990_969512997 9 Left 969512990 4:7630192-7630214 CCAGGACTGCTTGAGCTCAGGAT 0: 1
1: 0
2: 2
3: 30
4: 197
Right 969512997 4:7630224-7630246 CCATGTCCACAGGTGAGGCTGGG 0: 1
1: 0
2: 6
3: 23
4: 234
969512985_969512997 30 Left 969512985 4:7630171-7630193 CCTCTGGGACCTGGACACAGCCC 0: 1
1: 1
2: 4
3: 41
4: 453
Right 969512997 4:7630224-7630246 CCATGTCCACAGGTGAGGCTGGG 0: 1
1: 0
2: 6
3: 23
4: 234
969512989_969512997 10 Left 969512989 4:7630191-7630213 CCCAGGACTGCTTGAGCTCAGGA 0: 1
1: 2
2: 22
3: 86
4: 368
Right 969512997 4:7630224-7630246 CCATGTCCACAGGTGAGGCTGGG 0: 1
1: 0
2: 6
3: 23
4: 234
969512987_969512997 21 Left 969512987 4:7630180-7630202 CCTGGACACAGCCCAGGACTGCT 0: 1
1: 0
2: 1
3: 38
4: 408
Right 969512997 4:7630224-7630246 CCATGTCCACAGGTGAGGCTGGG 0: 1
1: 0
2: 6
3: 23
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969512997 Original CRISPR CCATGTCCACAGGTGAGGCT GGG Intronic
900538705 1:3192013-3192035 CCAGGTCCACAGGGTAGGGTAGG + Intronic
900673058 1:3867928-3867950 CCAAGTCCACAGGGCAGGCCAGG - Intronic
902396108 1:16133169-16133191 TCATCTCCAAATGTGAGGCTTGG - Exonic
902922933 1:19678265-19678287 CTAGGTCCACAGTTGAGGCTTGG + Intronic
903117824 1:21192642-21192664 CCAGGTCCAGAGGAGATGCTTGG + Intergenic
903620378 1:24693848-24693870 CCATGGCCACCAGTGATGCTGGG + Intergenic
906199913 1:43953328-43953350 TTATGACCACAGCTGAGGCTGGG - Intronic
906210453 1:44009954-44009976 CCATGTTCAAAGGTGAGGCCTGG - Exonic
908979718 1:69941121-69941143 TGCTGTCCACAGGTCAGGCTTGG - Intronic
911475491 1:98367548-98367570 CCAGGTCCAGAGCTGTGGCTGGG + Intergenic
913341205 1:117759517-117759539 CCATGTCGACAGGAGAGGGGAGG + Intergenic
916407454 1:164511355-164511377 CACTGTCCATAGCTGAGGCTTGG + Intergenic
916407909 1:164515618-164515640 ACTTGTCCATAGCTGAGGCTTGG - Intergenic
917966059 1:180179338-180179360 CCATTTCCTCCGGTGGGGCTAGG - Intronic
920048356 1:203148313-203148335 CCATCTCCACAGGTGAGACTGGG - Intronic
920756382 1:208737984-208738006 CCATTTCAACATGTGATGCTGGG - Intergenic
921124913 1:212168866-212168888 AAATATCCTCAGGTGAGGCTGGG - Intergenic
921186199 1:212671670-212671692 CGATTTACACAGCTGAGGCTTGG - Intergenic
922390642 1:225138056-225138078 TCATCTCCACAGCTGAGACTAGG + Intronic
922721100 1:227900684-227900706 CCATGTCCACAGGGGGACCTGGG + Intergenic
922987772 1:229879576-229879598 TCATCTGCACAGGTGAAGCTGGG + Intergenic
923328050 1:232898229-232898251 CCAGGTCCACAGCTGCAGCTGGG - Intergenic
1062837954 10:648550-648572 CCACGTCCACATTTGAGGGTGGG + Intronic
1062837962 10:648595-648617 CCACGTCCACATTTGAGGGTGGG + Intronic
1062838083 10:649358-649380 CCACGTCCACATTTGAGGGTGGG + Intronic
1062854875 10:774963-774985 CCCTGTCCACGGGTTAGTCTCGG - Intergenic
1063677923 10:8158288-8158310 ACATGGCCACACGTGAGGCTTGG + Intergenic
1066102564 10:32130864-32130886 CCAGGTCCAGAGGTGAGGGAAGG + Intergenic
1067716969 10:48697366-48697388 ACACGTCCCCAGGTGAGGCCAGG - Intronic
1069901677 10:71710191-71710213 GAATGTGTACAGGTGAGGCTGGG - Intronic
1070525009 10:77288635-77288657 CCAGGTGCAGAGGTGAGACTAGG + Intronic
1070835251 10:79443908-79443930 CCAGGTCAACAGGTCAGCCTGGG + Intronic
1072608647 10:97002693-97002715 CCATGGCCACAAGTGAGCCTGGG - Exonic
1074028627 10:109663145-109663167 CCAGGTCCACAGCTGTGGCTTGG - Intergenic
1075084032 10:119402123-119402145 CCATGGCCAGTGGGGAGGCTGGG + Intronic
1075204153 10:120432232-120432254 CCATGGCTCCAGGTGGGGCTGGG + Intergenic
1076540759 10:131213294-131213316 CCACGTTCACGGGTGAGCCTGGG - Intronic
1076738894 10:132471383-132471405 CTATGGCCACAGGGGAGGCTGGG + Intergenic
1077370410 11:2179272-2179294 CCAAGTCTACACGTGTGGCTGGG - Intergenic
1078085592 11:8231499-8231521 CCATGTGGACCCGTGAGGCTGGG + Intronic
1078345642 11:10545183-10545205 CCAGGTCCACAGCTGTGGTTGGG + Intergenic
1078637985 11:13069591-13069613 ACTTGGCCACAGGAGAGGCTGGG + Intergenic
1080174953 11:29351811-29351833 GCATGGGCACAGATGAGGCTTGG + Intergenic
1082079219 11:47999205-47999227 CCATGGCCACAAGAGAGGCAAGG + Intronic
1082116960 11:48338891-48338913 CCATCTCCACAGGGGAGCCTTGG - Intergenic
1082256828 11:50041418-50041440 CCATCTCCACAGGAGATCCTTGG + Intergenic
1083720279 11:64600464-64600486 CACTGTGCTCAGGTGAGGCTGGG + Exonic
1083752390 11:64767687-64767709 CCATGCCCACCTGTCAGGCTGGG + Exonic
1083752476 11:64768095-64768117 CCACCTCCACCGGTGAGCCTGGG - Exonic
1083896844 11:65624355-65624377 ACGTGGCCACTGGTGAGGCTGGG + Exonic
1084176668 11:67425904-67425926 CCATGTGCATAGGGGAGGTTGGG - Intergenic
1084809678 11:71604557-71604579 CCATCTCCACAGGTGAACCCTGG + Intergenic
1085415906 11:76318842-76318864 CCATCTCCAGGGATGAGGCTTGG - Intergenic
1086947159 11:92854337-92854359 CCAGGTCCAGAGCTGTGGCTGGG + Intronic
1087453522 11:98353861-98353883 CCAGGTCCACAGTCAAGGCTAGG + Intergenic
1087776926 11:102265052-102265074 CCATGTGAACAGGTGAGTCGGGG + Intergenic
1088345359 11:108818137-108818159 GCATGTCCACTGGTGAGGGCAGG - Intronic
1089453124 11:118610515-118610537 CCAGGGACACAGGTGAGGCCGGG + Intronic
1089700296 11:120240360-120240382 CCATGCACACAGGTGAGGGGCGG + Intronic
1090664328 11:128905084-128905106 TCCTGTCCACCGGTGTGGCTTGG + Intronic
1090743468 11:129688007-129688029 CCATGACCGTAGGTGAGGCATGG + Intergenic
1090931297 11:131300204-131300226 TCGGGTCCACAAGTGAGGCTGGG + Intergenic
1093913152 12:24769819-24769841 CCATTTCAGCAGGTGGGGCTTGG + Intergenic
1094411312 12:30170632-30170654 CCCTGTCCCCAAGGGAGGCTGGG - Intergenic
1094606428 12:31953176-31953198 CCTTGTCAACTGGTCAGGCTTGG - Intergenic
1096486075 12:51982236-51982258 ACATGTGCAAAGGTGAGGTTTGG + Intronic
1097469986 12:59977498-59977520 TCATTTCCTCAGGTGAGTCTAGG + Intergenic
1098904660 12:76149653-76149675 CAATGCCTACAGGTGAGGTTGGG + Intergenic
1100244020 12:92738297-92738319 CCAGGACCACAGGGGAGGATGGG + Intronic
1100847751 12:98678457-98678479 CCAGGTCCACAGCTGTGGCTTGG - Intronic
1101041784 12:100762778-100762800 GCATGTCCACAGACGAGGCATGG - Intronic
1102788272 12:115621805-115621827 CAAAGTCCACAGGGCAGGCTGGG + Intergenic
1110334234 13:74308151-74308173 CCATTTTCACAGGTGTGGATGGG + Intergenic
1110342831 13:74413456-74413478 CCACGTCCGCAGCTGTGGCTGGG - Intergenic
1110519934 13:76463738-76463760 CAGAGTCCACAGGTGAGGATAGG + Intergenic
1112221393 13:97494863-97494885 CCCTAGCCACAGGGGAGGCTGGG - Intergenic
1112265581 13:97920377-97920399 CTATTAACACAGGTGAGGCTGGG - Intergenic
1113458031 13:110462801-110462823 TCATTTCCTCAGGGGAGGCTGGG + Intronic
1113822306 13:113223240-113223262 ACATTTCCCCAGGTGAGACTGGG - Intronic
1117852215 14:59986263-59986285 CCATGTAAACAGGAGATGCTGGG - Intronic
1118755817 14:68843258-68843280 CCCTGGTCACAGATGAGGCTGGG - Intergenic
1119749509 14:77067376-77067398 CCAAGTTCACAGCTGTGGCTGGG - Intergenic
1119859379 14:77925335-77925357 CCATCACCTCTGGTGAGGCTTGG - Intronic
1120350753 14:83354861-83354883 TCATGTCCACAACTGAGGCAGGG + Intergenic
1121333309 14:93061433-93061455 CCATGGGCACAGCTGCGGCTAGG + Intronic
1121415922 14:93779301-93779323 CCATGTGTACAGGTGACGCATGG - Exonic
1121581716 14:95037003-95037025 CCCTTTCCACAAGTGAGGCTGGG - Intergenic
1121883935 14:97525460-97525482 TCATGTGCTCTGGTGAGGCTTGG - Intergenic
1122719014 14:103711940-103711962 CCATGTCCTCCAGTGAGGCCTGG + Exonic
1123038660 14:105481556-105481578 CCCTGCTCACAGGAGAGGCTGGG + Intergenic
1124106274 15:26740632-26740654 CTGTCTCCACAGCTGAGGCTTGG + Intronic
1124252711 15:28117447-28117469 CCACGTCCACAGCTGCGGCCCGG + Intronic
1124472850 15:30003546-30003568 CCATCTCCACTGGTGTAGCTCGG - Intergenic
1124948869 15:34297564-34297586 CCAAGACCACAGCTGAGGCCTGG - Intronic
1128799940 15:70490899-70490921 CCTTGACCTAAGGTGAGGCTTGG + Intergenic
1130330491 15:82918482-82918504 CCACCTCAGCAGGTGAGGCTGGG + Intronic
1132396599 15:101479505-101479527 CCATGGCCACAGCCGAGGCCGGG - Intronic
1132565111 16:618607-618629 CCATGTGCACAGGTCTGGCGGGG + Intronic
1132565222 16:619342-619364 CCATGTGCACAGGTCTGGCGGGG + Intronic
1132615694 16:840254-840276 CCGTGTCCCCAGGTGGGGCGCGG + Intergenic
1132712233 16:1274151-1274173 CCAGGTCCTGAGCTGAGGCTGGG - Intergenic
1136296601 16:29307583-29307605 CCATGGACACAGGTGTGGATGGG + Intergenic
1137444343 16:48522699-48522721 CCCTTCCCACTGGTGAGGCTTGG + Intergenic
1137593877 16:49710893-49710915 CCATGTCCCCAAGTGAAGCCTGG - Intronic
1141126420 16:81404034-81404056 CTTTGTCCACATGTGAGGGTGGG + Intergenic
1141592188 16:85076703-85076725 GCCTGCCCACTGGTGAGGCTGGG - Intronic
1142433049 16:90040804-90040826 CTGAGTCCACAGGTGGGGCTGGG + Intronic
1142864846 17:2784616-2784638 CCCTGGCCACAGGTGAGGCTTGG + Intronic
1143895929 17:10136211-10136233 CCAGATCCACGGGGGAGGCTGGG + Intronic
1144103559 17:11965164-11965186 GCATGTCCACAGCTGTGGATGGG - Intronic
1145741265 17:27276702-27276724 ACATATCCACAGGGGATGCTGGG - Intergenic
1145957574 17:28865293-28865315 CCAAGTCCAAAGGTGAGCATGGG + Intergenic
1146806442 17:35868644-35868666 ACAAGACCAAAGGTGAGGCTGGG - Exonic
1148777645 17:50104717-50104739 CTCTGTCCCCAGGTGGGGCTGGG - Intronic
1149496551 17:57121965-57121987 CAATGGCCACAGCTCAGGCTTGG - Intergenic
1149600368 17:57889405-57889427 TCATGGCCCCAGGGGAGGCTGGG + Intronic
1150256086 17:63745944-63745966 TCTTTTCCACAGTTGAGGCTGGG - Exonic
1150734749 17:67727331-67727353 CAAAGTACACAGGTGAGGATGGG - Intronic
1150950790 17:69801014-69801036 CCGGGTCCGCAGCTGAGGCTTGG - Intergenic
1151766927 17:76137586-76137608 CCACGTCCACGTGTGAGGCGGGG + Exonic
1152104817 17:78322863-78322885 ACATGTCCACAGCTGGGGGTGGG - Intergenic
1152167868 17:78722593-78722615 CCGTGTCCAAAAGAGAGGCTTGG + Intronic
1152710788 17:81869730-81869752 CCGTTTCCGCAGGTGAGTCTGGG - Exonic
1153723879 18:7936282-7936304 CCAGGTCCACAGCCGTGGCTGGG - Intronic
1153815288 18:8785485-8785507 CCATGCACCCAGGCGAGGCTAGG - Intronic
1154346703 18:13548683-13548705 CCATGTCCACAGCTGTGGCTGGG + Intronic
1157584768 18:48794024-48794046 CCATCTCCCCAGGGGAGGCGAGG + Intronic
1159324943 18:66902588-66902610 CCAAGTCAAGAGGTCAGGCTGGG + Intergenic
1160099206 18:75904583-75904605 TCAGGGCCGCAGGTGAGGCTGGG + Intergenic
1160425732 18:78777991-78778013 CCATCTTCACGGGCGAGGCTGGG + Intergenic
1160604384 18:80038331-80038353 CCATGTCCCCAGGTGAAGTAGGG - Intronic
1160662721 19:308566-308588 GGATGCGCACAGGTGAGGCTTGG - Exonic
1160765477 19:805710-805732 CCACGTCCACAGAGCAGGCTTGG + Intronic
1161195494 19:2984015-2984037 CCAGGACCACAGGCCAGGCTGGG - Intronic
1161420592 19:4174343-4174365 TGTTGTCCAGAGGTGAGGCTGGG - Exonic
1161847072 19:6718236-6718258 CTGGCTCCACAGGTGAGGCTGGG - Exonic
1162908254 19:13836088-13836110 GCATGGCCACAGCTCAGGCTGGG - Intergenic
1166944470 19:46388437-46388459 CCACAGCCACAGGTGAGTCTAGG + Exonic
1168020325 19:53604392-53604414 TCTTGTCCTCAGGTGAGACTGGG - Intergenic
1168416955 19:56175369-56175391 ACATGTCCTGGGGTGAGGCTGGG + Intergenic
1168547501 19:57265696-57265718 CCAAGGGCACAGATGAGGCTGGG - Intergenic
925515183 2:4674220-4674242 CCAGGTCCACACCTGTGGCTTGG - Intergenic
926070509 2:9884813-9884835 CCACGTCCACAGCTGTGGCTTGG - Intronic
926811004 2:16755395-16755417 CCATGTCCACAGCTCAGGAAGGG - Intergenic
927982737 2:27384784-27384806 GCATTCCCACTGGTGAGGCTGGG - Exonic
929543818 2:42842674-42842696 TCATGTCCTTAGGTGGGGCTGGG - Intergenic
929781928 2:44962592-44962614 CCATGACCAGAGGTGGGGGTAGG - Intergenic
930957161 2:57217053-57217075 CCAGGTCCACAGCTGTAGCTTGG - Intergenic
931180987 2:59900532-59900554 CCTTGCCCACAGGAGAGGTTGGG - Intergenic
931763298 2:65434730-65434752 CCATGGCCAAAGGTGAGACTTGG - Intergenic
933131297 2:78677012-78677034 CCCAGTCCCCAGGTGGGGCTTGG + Intergenic
934055586 2:88248743-88248765 TCAACTCCAGAGGTGAGGCTTGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
937495345 2:122413425-122413447 CCAAGTCCACATGTGGGGCTAGG - Intergenic
941440444 2:165528926-165528948 CCAAGTCCACAGCTATGGCTTGG - Intronic
942603734 2:177668033-177668055 CCATCTCCTCAGGGGAGGCCTGG - Intronic
943064389 2:183071173-183071195 CCCAGTCCACAGCTGAGGCCGGG + Intergenic
943190906 2:184679489-184679511 CCAGGTCCACAGTAGTGGCTGGG - Intronic
943876411 2:193072766-193072788 CCAGGCCCACAGGTGGTGCTTGG + Intergenic
947875689 2:233467005-233467027 CCATCTCCACCAGAGAGGCTGGG - Intronic
1169325371 20:4671272-4671294 CCGAGTGCACAGGTGGGGCTTGG - Intergenic
1172564778 20:35920709-35920731 GCATGTCCACTGGTGGTGCTGGG - Intronic
1174703532 20:52633567-52633589 CCATGTCCACACCTGGGGTTGGG - Intergenic
1174781588 20:53394260-53394282 CGATGTCCCCAGTTGAGGTTTGG + Intronic
1174831786 20:53820219-53820241 GCATGTCCACAGGTGCTGTTCGG + Intergenic
1175428649 20:58888272-58888294 CCATGTGCCCAGGTGAGCCGAGG - Intronic
1175453330 20:59089466-59089488 CCATGTCCAGCGCTGAGGATTGG + Intergenic
1178947272 21:36959091-36959113 CCAGGTCCGCAGCTGTGGCTGGG - Intronic
1180046806 21:45310347-45310369 GCATGTCCACAGGTGGAGGTGGG + Intergenic
1181009624 22:20032776-20032798 CCATCACACCAGGTGAGGCTGGG - Intronic
1181600231 22:23947508-23947530 CCTTGTCCACACATAAGGCTTGG + Intergenic
1181608274 22:23993812-23993834 CCTTGTCCACACATAAGGCTTGG - Intergenic
1181638749 22:24186148-24186170 CGATGTCCAACGGTGAGGCCAGG + Exonic
1181809217 22:25393196-25393218 CTATGTCCACAGGGGAGGCTTGG - Intronic
1182845098 22:33424133-33424155 CAATGTCTAGAGATGAGGCTGGG - Intronic
1182852636 22:33489075-33489097 CCATGTCTACATATGATGCTAGG + Intronic
1183085029 22:35481423-35481445 CCATGTCCACCCTTGGGGCTTGG + Intergenic
1184430654 22:44440006-44440028 CCCTCACCACAGGGGAGGCTGGG + Intergenic
1184651744 22:45922465-45922487 CCATGCCGCCAGGTGGGGCTGGG + Exonic
1184878624 22:47291176-47291198 CCAGGACCACAGGTGAGTCCTGG - Intergenic
950489813 3:13297052-13297074 GCCTGTCCACAGATGAGGATTGG - Intergenic
953533037 3:43755381-43755403 CCCTGTGCAGGGGTGAGGCTGGG + Intergenic
955216050 3:56985825-56985847 ACATACCCACAGGTGGGGCTGGG + Intronic
955506291 3:59636331-59636353 CTGTGACCACAGGTGAGGGTGGG + Intergenic
958019752 3:87980957-87980979 CCAGGTCCACAGCTGTAGCTGGG + Intergenic
959790589 3:110356618-110356640 CCACTTCCACAGGGGAGGGTGGG + Intergenic
961719567 3:128883907-128883929 CCATGAGGACAGGTGATGCTTGG + Intronic
963169999 3:142241033-142241055 CCATGACCACCTGTGAGCCTGGG - Intergenic
963805009 3:149714216-149714238 CCATGTCCACAGCGGTGTCTTGG - Intronic
964731221 3:159867335-159867357 CCATGTCTGCATGTGAGGCCTGG + Intronic
968552301 4:1229887-1229909 CCAGGGCCACAGCAGAGGCTGGG + Intronic
969512997 4:7630224-7630246 CCATGTCCACAGGTGAGGCTGGG + Intronic
971548424 4:27917055-27917077 CCATTTCCCCAAGTGAGGCTTGG + Intergenic
971758624 4:30735341-30735363 CCATGTTTAAAGGTGAGGCGGGG + Intronic
976189995 4:82478348-82478370 ACATTTACACAGGTGAGGTTTGG - Intergenic
976698518 4:87943933-87943955 TGATGTCCCCAGGTGAGGTTAGG + Intergenic
977249046 4:94668296-94668318 CCATATTCACAGGTTAGGATAGG + Intergenic
980323360 4:131307905-131307927 CCATGCCCAGCGGTGAGACTGGG + Intergenic
982487472 4:155984301-155984323 CCATGGCAACAAGTGAGGCAGGG + Intergenic
985066978 4:186132092-186132114 TCATTTCCACAGCAGAGGCTTGG + Intronic
985704123 5:1390822-1390844 CCATGACAACTGGTGAGGTTGGG + Intergenic
985816995 5:2134571-2134593 CCATGGCTGCAGGTGGGGCTTGG - Intergenic
985849653 5:2379256-2379278 CCCACTTCACAGGTGAGGCTGGG - Intergenic
986533702 5:8764563-8764585 CCATGCCACCAGGTGAGGATGGG - Intergenic
990873868 5:60462641-60462663 CCAGCTCAACAGGTGAGGCCAGG + Intronic
991017752 5:61949620-61949642 CCTGGTCCACAAGTGAGGCTTGG + Intergenic
994141141 5:96342448-96342470 ACAAGTGCTCAGGTGAGGCTGGG + Intergenic
994593809 5:101806552-101806574 CCAAGTCCACAGCCGTGGCTGGG - Intergenic
998480629 5:142459694-142459716 CCAGGTCCACAGCTGTGGCTGGG + Intergenic
1000439155 5:161246872-161246894 ACAGGTCCACAGATGAGGATGGG - Intergenic
1002200723 5:177526351-177526373 CCATGTGCGAAGGTGGGGCTGGG + Intronic
1002535026 5:179871506-179871528 CAATGTCCACAGGTATAGCTCGG + Exonic
1002988802 6:2218273-2218295 GCATTTCCAGAGGTGAGTCTGGG - Intronic
1005364127 6:25060447-25060469 CCATGACCACAGTTGAGCCAAGG - Intergenic
1007398428 6:41590159-41590181 CCATCTCCTCAGGTGAGGGTGGG + Exonic
1012928966 6:105297064-105297086 GCATGTACACAGGTGTGTCTGGG - Intronic
1013451261 6:110283567-110283589 CCTAGTCCACAGTGGAGGCTTGG - Intronic
1014517947 6:122401958-122401980 CCTTGGCCACATGTGAGCCTCGG - Intronic
1015208859 6:130672595-130672617 CCGTGTTCTCAGCTGAGGCTCGG - Intergenic
1016461860 6:144286289-144286311 CGGTGTCCACAGGAGAGGGTGGG + Intronic
1019398968 7:840244-840266 GCATCTCCAAGGGTGAGGCTGGG - Intronic
1019480582 7:1264901-1264923 CCATTTGCACAGTCGAGGCTGGG + Intergenic
1019727716 7:2612215-2612237 CCATGTCCTCTGGTGCAGCTGGG + Exonic
1019925944 7:4191820-4191842 CCATCTCCACAGGTGTGGCCGGG + Intronic
1020212582 7:6167253-6167275 CCAAGTCCACAGGGGAGGGCAGG + Intronic
1020309672 7:6858512-6858534 CCATCTCCACAGGTGAACCCTGG - Intergenic
1021250423 7:18318474-18318496 CCATCTCCACAGGTGACTCCAGG - Intronic
1021343224 7:19489547-19489569 CCAGGTCCACAGCTGTGGCTGGG + Intergenic
1022225285 7:28356557-28356579 CCAAGACAACAGGTGAGGGTAGG - Intronic
1024824778 7:53379040-53379062 CCATGTCCCCACGTCAGCCTTGG + Intergenic
1028136659 7:87230180-87230202 CCAGGTCCACAGCTGCAGCTGGG - Intergenic
1028378994 7:90176929-90176951 CCAGGTCCACAGCTGTGGCTTGG + Intronic
1028755844 7:94433404-94433426 CTATGTCCACATTTGAGTCTAGG - Intergenic
1028844794 7:95467722-95467744 CACTGCCCACAGGTGGGGCTAGG - Intergenic
1029441525 7:100589622-100589644 CCATGTCCCCAGCCTAGGCTTGG - Exonic
1033174894 7:139114680-139114702 ACATGACCACAGGTGAGGCTGGG + Intergenic
1033595582 7:142855851-142855873 CCATGACCACAGTTAAGCCTTGG + Intronic
1033886997 7:145961275-145961297 CCTTGTCCACAGGTGAGGGAGGG + Intergenic
1035643341 8:1200137-1200159 ACAGGCCCACAGGAGAGGCTGGG + Intergenic
1036443470 8:8801793-8801815 CAGTGTCCACAGGGGAGGCCAGG + Intronic
1037950403 8:23015732-23015754 CCATGTCCCCAGGTGAGCATCGG + Exonic
1040837445 8:51747211-51747233 CCATGTCCAGTGGAGAGGGTGGG - Intronic
1043402168 8:79894418-79894440 CCATGTCTGCAGGTCAGGGTAGG - Intergenic
1047095167 8:121617158-121617180 CCATCTCCACAGATGAGGCTGGG + Exonic
1049128116 8:140810651-140810673 ACATGTGCACTGGTGAGGCACGG - Intronic
1049506173 8:143000353-143000375 CTAGGTCCCCTGGTGAGGCTGGG - Intergenic
1050641295 9:7670527-7670549 CCTTGTCCACAGCTGTGGTTAGG - Intergenic
1056758286 9:89396494-89396516 CCATGGCCAAGGGTGAGGCCTGG - Intronic
1057217265 9:93236011-93236033 CCAGGCCCACAGGTGAGTCAAGG - Intronic
1059400062 9:114063353-114063375 CCCTGCCCACAGGTGAGACCTGG + Intronic
1060779609 9:126401761-126401783 CCATGTCCAGAGGGAAGGCGGGG - Intronic
1061403770 9:130382674-130382696 CCAGGATCACAGGTGGGGCTGGG - Intronic
1061446067 9:130638838-130638860 CCACAGCCACAGGTGAGGCTGGG - Intergenic
1062255577 9:135619233-135619255 CCAGGCCCACAGGCCAGGCTGGG - Intergenic
1185686629 X:1934143-1934165 CCATGAGCACAGTTGAGGTTGGG + Intergenic
1187053088 X:15713699-15713721 CCATGTCCTCAAGTGAGACAGGG - Intronic
1188063636 X:25630933-25630955 ACATGACCACAGCTGAGGCCTGG - Intergenic
1189238010 X:39503413-39503435 CCCTGACCAGAGCTGAGGCTAGG + Intergenic
1189856561 X:45229881-45229903 CCAGGTCCACAGCTGTGGTTTGG + Intergenic
1189858836 X:45251580-45251602 CCCTGCCCTCAGGTGTGGCTGGG + Intergenic
1192496976 X:71622699-71622721 CCTTGACCACAGGTGGGGCCCGG - Intergenic
1195419032 X:104653130-104653152 CAATGTCCAGAGGAGATGCTTGG - Intronic
1198373812 X:136017576-136017598 CCATGACTACAGGAGAGGATAGG + Intronic
1200152818 X:153959626-153959648 CCATTTCCACAGGTGGGGCCAGG + Intronic