ID: 969514427

View in Genome Browser
Species Human (GRCh38)
Location 4:7638579-7638601
Sequence GGGACCCGGAACCCCTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 220}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969514416_969514427 11 Left 969514416 4:7638545-7638567 CCCACCTGGAGGTGAGTGCCCAC 0: 1
1: 0
2: 0
3: 13
4: 156
Right 969514427 4:7638579-7638601 GGGACCCGGAACCCCTGGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 220
969514417_969514427 10 Left 969514417 4:7638546-7638568 CCACCTGGAGGTGAGTGCCCACT 0: 1
1: 0
2: 1
3: 13
4: 129
Right 969514427 4:7638579-7638601 GGGACCCGGAACCCCTGGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 220
969514422_969514427 -7 Left 969514422 4:7638563-7638585 CCCACTTGGAGCAAGTGGGACCC 0: 1
1: 0
2: 1
3: 6
4: 88
Right 969514427 4:7638579-7638601 GGGACCCGGAACCCCTGGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 220
969514423_969514427 -8 Left 969514423 4:7638564-7638586 CCACTTGGAGCAAGTGGGACCCG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 969514427 4:7638579-7638601 GGGACCCGGAACCCCTGGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 220
969514418_969514427 7 Left 969514418 4:7638549-7638571 CCTGGAGGTGAGTGCCCACTTGG 0: 1
1: 0
2: 1
3: 12
4: 154
Right 969514427 4:7638579-7638601 GGGACCCGGAACCCCTGGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969514427 Original CRISPR GGGACCCGGAACCCCTGGGC TGG Intronic
900109733 1:1000387-1000409 GGGCCCGGGACCCCCGGGGCTGG + Intergenic
900940172 1:5793429-5793451 GGGACCAGGCAGCCCTGGGAAGG + Intergenic
902478531 1:16700249-16700271 GGGACCCTGTGCCCCTTGGCCGG - Intergenic
903184180 1:21620113-21620135 GGGACCCGGAGGGCCGGGGCGGG - Intronic
903221800 1:21873463-21873485 GGGAAGCAGAACCCCAGGGCTGG + Intronic
903278983 1:22239389-22239411 GGCACCTGGCACCCCTGGGGTGG - Intergenic
903370990 1:22836097-22836119 GGGCCCCCGAGCCCCTGGGCCGG - Intronic
904538210 1:31215292-31215314 GGGATCCCGAAGCCCTGGGTTGG - Intronic
904768838 1:32870161-32870183 GGGCCCCGGCACCCCTGATCTGG - Intronic
906097430 1:43233862-43233884 GGGACGTGGAAGCCCTGGCCAGG + Intronic
906204593 1:43979929-43979951 CTGACCCAGAACCCCTGCGCCGG + Exonic
906214587 1:44031319-44031341 CGGACCCAGCACGCCTGGGCCGG - Intronic
907040119 1:51251422-51251444 GGGGCCCGGAGGCCCTGGGATGG - Intronic
907268445 1:53276644-53276666 CGGATCCGCAATCCCTGGGCGGG + Intronic
907844246 1:58189592-58189614 GGGACCTGCAACCAGTGGGCAGG - Intronic
909739141 1:79006718-79006740 GGGACCGGGCGCCGCTGGGCGGG + Exonic
911096602 1:94060301-94060323 TGGACCATGGACCCCTGGGCAGG + Intronic
911379671 1:97096951-97096973 GAGACCATGAACCCCTGGGCAGG + Intronic
911778833 1:101849453-101849475 GTGACCCTGAAGCCCTGAGCTGG - Intronic
912446369 1:109739978-109740000 GGGACTCGGCAGCCCCGGGCCGG - Intronic
912656580 1:111491260-111491282 GGGACCTGGAACACGTGAGCAGG + Intronic
914694258 1:150061644-150061666 GGCAGCCAGAGCCCCTGGGCAGG - Intergenic
915416646 1:155747753-155747775 AGGATCTGGAAGCCCTGGGCGGG - Intergenic
915527709 1:156486270-156486292 GGGAGCTGAAATCCCTGGGCTGG - Intronic
920227625 1:204449879-204449901 GGGTGCCTGAAGCCCTGGGCTGG - Exonic
920311168 1:205049112-205049134 GGTACCCAGGATCCCTGGGCCGG + Intronic
922535204 1:226374628-226374650 GGGACCAGCAACCCCAGGGTGGG - Intronic
922720067 1:227895853-227895875 GGGGCCCGGCACCCCAGGCCTGG + Intergenic
923803649 1:237234999-237235021 TGGACCCTGAACCCCAGGGGGGG - Intronic
924741979 1:246799513-246799535 GAGACCCGGAGCCTCAGGGCAGG - Intergenic
1063504095 10:6580409-6580431 GGGACCCGGCACCTCTAGCCAGG + Intergenic
1063995192 10:11611865-11611887 GGTGCCCGGAGCCCCTCGGCGGG + Intergenic
1067744349 10:48924133-48924155 GGGACCCAGACTCCCTGGGGAGG - Intronic
1068437911 10:57015737-57015759 GTGAACTGGAACACCTGGGCGGG - Intergenic
1069771190 10:70901515-70901537 GGGAGCTGCCACCCCTGGGCAGG - Intergenic
1070569827 10:77632455-77632477 GGGACCAGGAGCTGCTGGGCTGG - Intronic
1072241172 10:93496732-93496754 AGGACCCGCAGCCCCGGGGCCGG + Exonic
1072629581 10:97135941-97135963 GGCACCTGGGACCCCTGGGTGGG + Intronic
1073466191 10:103695863-103695885 GGGACCCGGAAGTCCTCGGTGGG - Intronic
1074507536 10:114084821-114084843 GGGATCCCCAACCCCTGGACTGG - Intergenic
1075073321 10:119333533-119333555 GGGACCTGGCTCTCCTGGGCGGG - Intronic
1075318173 10:121468603-121468625 GGGAGCAGGCACCCCTGGGGTGG + Intergenic
1075584914 10:123650682-123650704 GGGCCCTGGCTCCCCTGGGCTGG - Intergenic
1076734317 10:132451965-132451987 GGGTGCCGGGACCCCTGCGCTGG + Intergenic
1076798642 10:132810727-132810749 GGGACCCGGCTCCCGTGGGCTGG + Intronic
1077247441 11:1546569-1546591 GGGACCCGCAAGCCCAGAGCAGG + Intergenic
1078180142 11:9004256-9004278 GGGCCCCGCATCCCCTGGACTGG + Intergenic
1078407201 11:11080763-11080785 GTGACTCAGAACCACTGGGCTGG + Intergenic
1079602153 11:22322893-22322915 GGGACTCGAAACCCCAGGGGAGG - Intergenic
1081485159 11:43521746-43521768 GGGACCTGGCTCCCCGGGGCCGG + Intergenic
1081576043 11:44319154-44319176 GGGAGCCGGCCGCCCTGGGCTGG - Intergenic
1081619224 11:44609146-44609168 GGGCCCCTGAATCCCAGGGCTGG - Intronic
1083994838 11:66266766-66266788 GGCAGCCGGAATCCCTGAGCTGG - Intronic
1084146289 11:67266898-67266920 GCGACCTGGACCCCCGGGGCCGG + Intronic
1084656447 11:70522581-70522603 GGGACTCGGAGGCCCTGGGTAGG - Intronic
1084689285 11:70715831-70715853 TGGACCCGGCAGCCCAGGGCTGG + Intronic
1084749232 11:71193259-71193281 CGGCCCCAGAACCCATGGGCTGG - Intronic
1085393534 11:76194697-76194719 GGGCCCGGGAACCGCTGGGGAGG - Exonic
1088796895 11:113272606-113272628 GGGATCAGGAAGCCCTAGGCAGG + Intronic
1090828178 11:130402466-130402488 GGGACCAGGGGCACCTGGGCAGG + Intergenic
1096526347 12:52212459-52212481 GGGACCAGGGCCCCCAGGGCTGG + Intergenic
1096771748 12:53939694-53939716 GGGGCGCGGAGCCCCGGGGCAGG - Intronic
1103626319 12:122222915-122222937 GGGGTCCCCAACCCCTGGGCTGG - Intronic
1104924256 12:132305875-132305897 GGGACCAGGGAGCCCTGGGTGGG + Intronic
1106553873 13:30793819-30793841 GGGACCCGGAAACCCAGGCAGGG + Intergenic
1107707462 13:43122049-43122071 GGGGCCCAGAACCCCAGGACAGG - Intergenic
1112494686 13:99895624-99895646 GGGACCCGGCAGCTCTGCGCGGG + Exonic
1113572797 13:111370733-111370755 GGGACGGAGAACCCCAGGGCTGG - Intergenic
1113854486 13:113436142-113436164 GGGACCCGGCACCCAGGCGCAGG + Intronic
1113854564 13:113436436-113436458 GGGACCCGGCACCCAGGTGCAGG + Intronic
1113854590 13:113436520-113436542 GGGACCCGGCACCCAGGCGCAGG + Intronic
1113854616 13:113436604-113436626 GGGACCCGGCACCCAGGTGCAGG + Intronic
1113854655 13:113436730-113436752 GGGACCCGGCACCCAGGTGCAGG + Intronic
1113854681 13:113436814-113436836 GGGACCCGGCACCCAGGCGCAGG + Intronic
1118621724 14:67620098-67620120 GGCACCTGGAACCGCCGGGCAGG + Intronic
1119100020 14:71871044-71871066 GTCAGCTGGAACCCCTGGGCTGG - Intergenic
1119404660 14:74390172-74390194 GGCTCCTGGAAGCCCTGGGCAGG - Intergenic
1119802537 14:77458311-77458333 GGAACCCTGAAACCCTGGCCCGG - Intronic
1121245413 14:92458304-92458326 GGAGGCCTGAACCCCTGGGCTGG - Intronic
1121333591 14:93063286-93063308 GGGACCAGGGGTCCCTGGGCAGG - Intronic
1121685565 14:95832553-95832575 GGTACCCGGATCCCCTGGCTTGG - Intergenic
1122086443 14:99310011-99310033 GGGTCCCCAAACCCCTGTGCTGG - Intergenic
1122978703 14:105181540-105181562 GGGACTCGGGACCTCTTGGCTGG + Intergenic
1123119485 14:105910131-105910153 GGGCCCAGGACCCTCTGGGCAGG + Intergenic
1126510999 15:49474631-49474653 GGAGCCCCCAACCCCTGGGCTGG + Intronic
1126777550 15:52112609-52112631 GGAACCCGGCACCCCCGAGCCGG - Exonic
1130152835 15:81324326-81324348 GGGTCCCGGACGCCTTGGGCGGG + Intergenic
1133276015 16:4638879-4638901 GGGACCCGGGACACCAGGGGTGG - Intronic
1133781160 16:8940508-8940530 GGGACCAGGCAACCCAGGGCGGG + Intronic
1133812241 16:9169795-9169817 GGAACCCTCAGCCCCTGGGCTGG + Intergenic
1139594261 16:67948901-67948923 GGGGCCCTGTACCCCTGAGCAGG - Intronic
1139691864 16:68646316-68646338 GGGCCCTGGCACACCTGGGCTGG + Intronic
1140886649 16:79250170-79250192 GGGACCCAGAATCCCTGGATTGG - Intergenic
1142032749 16:87846654-87846676 GGGACCCTGATGCCCTGGGCGGG - Intronic
1142211633 16:88811335-88811357 GGGACCCGGAACCTGCGGGAAGG + Intronic
1143105033 17:4525277-4525299 AGGAGCTGGAAGCCCTGGGCTGG - Intronic
1143106205 17:4531733-4531755 GGGACTGGGAGCCCCTGGGTTGG - Intronic
1144738536 17:17568433-17568455 GGGACCCTGCCCTCCTGGGCTGG - Intronic
1145249230 17:21288267-21288289 TGGGCTGGGAACCCCTGGGCAGG + Intronic
1146454904 17:33001904-33001926 GGGACCCTGAAGGCCTGGGCTGG + Intergenic
1147313070 17:39606447-39606469 TGGCCCCGGAGCCCCTGGCCCGG + Exonic
1148216790 17:45837705-45837727 TGGAGGCGGAATCCCTGGGCAGG + Intergenic
1148623129 17:49049531-49049553 GGAATCCGGGACACCTGGGCCGG + Exonic
1149304441 17:55334696-55334718 GGGATCCTGATCCCATGGGCAGG - Intergenic
1150130335 17:62665741-62665763 GGGACACAGAGCCCATGGGCTGG + Intronic
1151454066 17:74215585-74215607 GGGACCAGGAGCCAGTGGGCAGG - Intronic
1151959177 17:77396506-77396528 AGGACCTGCTACCCCTGGGCAGG + Intronic
1152231684 17:79117135-79117157 GGGCCCAGGACCCCCTGAGCAGG + Intronic
1152942110 17:83178193-83178215 GGGTCCCGGCCCCCCTGGCCTGG + Intergenic
1153701490 18:7698945-7698967 GGGGTCCCCAACCCCTGGGCTGG + Intronic
1154387693 18:13910670-13910692 GGGACCAGCAGCCCCTGGTCAGG - Intronic
1157123751 18:44936171-44936193 GGGTCCTGGGAGCCCTGGGCTGG - Intronic
1157566592 18:48682797-48682819 GGGTCCCGACAGCCCTGGGCGGG + Intronic
1160100535 18:75916354-75916376 GGGACCCCGAACCCCAGCTCCGG - Intergenic
1160845450 19:1164157-1164179 AGGCCCCGGAAGCCATGGGCAGG - Intronic
1161016277 19:1985342-1985364 GGGGCCCTGAACCCCGGGTCTGG - Intergenic
1161045185 19:2130767-2130789 GGGACCCAGGACCCTGGGGCAGG - Intronic
1161323019 19:3649931-3649953 GGGACCCAGACCCGCTGGGCTGG + Intronic
1161575846 19:5053842-5053864 GGGACGCTGGGCCCCTGGGCTGG - Intronic
1161794838 19:6380726-6380748 AGGAGGCAGAACCCCTGGGCAGG + Intronic
1162019212 19:7861057-7861079 GGAACCCAGAAGCCCTGGGATGG - Intronic
1162127656 19:8507985-8508007 GACACCAGTAACCCCTGGGCGGG - Intergenic
1163103297 19:15109934-15109956 GGCACCCGGAGCCCGAGGGCCGG + Exonic
1163661016 19:18577538-18577560 GAGACCAGGAACCCATCGGCAGG + Exonic
1163862047 19:19747787-19747809 GGGAAGCCGGACCCCTGGGCTGG - Intergenic
1164621518 19:29698271-29698293 GGGTCCCAGCACCCCTGGGCAGG + Intergenic
1165418848 19:35712612-35712634 GGGACCTTGACCCCTTGGGCAGG + Intronic
1165858324 19:38893602-38893624 GAGGCCGGGAACCCCAGGGCTGG - Intronic
1166942747 19:46376597-46376619 GGCACCCGGGAACCCTGGGATGG + Intronic
1166965177 19:46525618-46525640 GGCACCCGGGAACCCTGGGATGG - Intronic
1167521713 19:49959459-49959481 GGGCCCCAGAACCCTGGGGCTGG - Exonic
1167523670 19:49971263-49971285 GGGCCCCAGAACCCTGGGGCTGG + Intergenic
1168464434 19:56590180-56590202 TGGACTCGGCACCCCTGAGCTGG + Intergenic
1168637787 19:58009846-58009868 GGGTCCAGGACCCGCTGGGCTGG - Exonic
1202712550 1_KI270714v1_random:26080-26102 GGGACCCTGTGCCCCTTGGCCGG - Intergenic
927646429 2:24879877-24879899 AGGACCTGGAACATCTGGGCAGG + Intronic
928411354 2:31056567-31056589 AAGACCCAGAACCCCTGGGCTGG - Intronic
928435426 2:31251692-31251714 GGGAGCTGGAACCCCTGGCCTGG + Intronic
932279013 2:70473360-70473382 GGGATCCTGCTCCCCTGGGCAGG + Intronic
935165128 2:100563270-100563292 GGGACCCGGCACACCGAGGCGGG - Intronic
940316872 2:152335748-152335770 GGGACCCGGGGCCCCGGGCCGGG + Intronic
941666239 2:168246799-168246821 GGGCCCTGGAAACCCAGGGCGGG + Intronic
947834103 2:233163000-233163022 GGGTGCCCGAACCCCCGGGCTGG - Intronic
947992169 2:234496701-234496723 GGGACGCCGAGCCCCGGGGCCGG - Exonic
948047027 2:234952419-234952441 GGCGCCCGGAACCCCGGGCCGGG - Intronic
948090807 2:235293244-235293266 GGAACCGGGAAGCCCTGAGCTGG - Intergenic
948564608 2:238875989-238876011 GGGACCCCGAGGCCCTGGCCAGG + Intronic
948874954 2:240821163-240821185 GCCACCCTGAACCCCGGGGCTGG + Intergenic
949042917 2:241857755-241857777 GGCACCAGGACCCCCGGGGCAGG + Intronic
1169213593 20:3781307-3781329 GGGACCCGGCACCGCTGGGGCGG - Exonic
1171263206 20:23750603-23750625 GGGACCCAGGACCCCTGGGGTGG + Intronic
1172618828 20:36306784-36306806 GGGGCCCGGAACCCCTGTCCGGG + Intronic
1173704782 20:45101592-45101614 GGAATCAGGAACCCGTGGGCAGG - Intergenic
1174042376 20:47709099-47709121 GGGCCCCGGGGCTCCTGGGCTGG + Intronic
1175133356 20:56805985-56806007 GGGGCTCGACACCCCTGGGCAGG + Intergenic
1175795469 20:61767760-61767782 GGGACACTGCAGCCCTGGGCAGG + Intronic
1176138241 20:63534391-63534413 GGGACCCAGAAACTCTGCGCAGG - Intronic
1176856580 21:13979823-13979845 GGTACCCGGAACCCGTGTACAGG + Intergenic
1180032978 21:45224658-45224680 GGGTTCCGGGAGCCCTGGGCCGG + Exonic
1180149634 21:45940988-45941010 GGGCCCTGGAACCCCTGTCCCGG + Intronic
1180954854 22:19737019-19737041 GGCACCCTGGACCCCTGGGCAGG - Intergenic
1181162075 22:20965215-20965237 GGGACCAGGGTCCCCGGGGCGGG - Intronic
1181410082 22:22712494-22712516 TGGACCCAGAACCCTTGGGCTGG - Intergenic
1181469787 22:23131000-23131022 GGTACCAGGAAGCCCTGGGCAGG + Intronic
1181519687 22:23438092-23438114 GGCACCCGCAGCCCCTGGGATGG - Intergenic
1182067693 22:27442304-27442326 GGAGCCCAGAAACCCTGGGCAGG + Intergenic
1183201370 22:36387623-36387645 GGGTCCCGGTCCCCCTGGGAAGG + Intronic
1183253252 22:36744751-36744773 GGGAGCTGGAACCCCTAGCCTGG - Intergenic
1184041965 22:41949657-41949679 GGGACCAGGGTCCCCAGGGCAGG - Intergenic
1184087053 22:42271199-42271221 GACACCTGGAACCCATGGGCGGG - Intronic
1184478876 22:44735966-44735988 GGGACCCGCATCCTCTGGTCTGG + Intronic
949892054 3:8740640-8740662 GGGACCTAGGACACCTGGGCTGG - Intronic
950450620 3:13063095-13063117 GAGAGCCGGGACTCCTGGGCTGG + Intronic
950509221 3:13415772-13415794 GGGACCCTGAGCCTCTGGGACGG - Intronic
955387716 3:58492373-58492395 GGGCCCCGGAACCCCCGCCCAGG - Intronic
958070865 3:88609353-88609375 GACACCTGGAACCCCTAGGCAGG - Intergenic
961869562 3:129977559-129977581 GGGACAGGGAGCCCCTGGGAGGG + Exonic
963882954 3:150548521-150548543 GGGTCCCCAACCCCCTGGGCCGG + Intronic
968485709 4:860210-860232 GGGGCCGTCAACCCCTGGGCTGG - Intronic
968597663 4:1493617-1493639 CAGACCCTGGACCCCTGGGCTGG - Intergenic
968697766 4:2041261-2041283 GGGCCCCGGACGCCCTGGGAGGG - Intronic
969514427 4:7638579-7638601 GGGACCCGGAACCCCTGGGCTGG + Intronic
970333189 4:15004366-15004388 GGGACCGGGAGACCATGGGCGGG + Intronic
980122504 4:128742378-128742400 GAGACCCAGAACCCACGGGCAGG + Intergenic
984862539 4:184253275-184253297 GGGACCCGGTGCCCCTGAGCAGG - Intergenic
985128931 4:186723262-186723284 GGGACCCGGCAGCCCCGCGCAGG + Intronic
985784553 5:1887014-1887036 GGGTCTCGGAACCCCGGGGCGGG + Exonic
986733179 5:10649793-10649815 GGGCCCCGGGACCCCAGGGCGGG - Exonic
997955537 5:138275749-138275771 GGAACCAGCACCCCCTGGGCAGG - Intergenic
999113482 5:149141742-149141764 GGGCTCCGGAGCCGCTGGGCAGG + Exonic
999322588 5:150624692-150624714 GGGAGCCGGGAGCGCTGGGCGGG - Intronic
1000398114 5:160797126-160797148 GGGCCCAGGAACCCCTGGCTGGG + Intronic
1002139935 5:177132579-177132601 GGGACTCGGCCTCCCTGGGCGGG + Intergenic
1004426224 6:15509083-15509105 GGGACCCAGAACACCTCGCCAGG - Intronic
1005979388 6:30824795-30824817 GTGAACCAGAATCCCTGGGCTGG + Intergenic
1006897999 6:37483003-37483025 GAGACCCGGAACCCCCCAGCAGG + Exonic
1006899971 6:37493661-37493683 GGGACCCTGAACCCCAAGCCAGG - Intronic
1007389927 6:41545323-41545345 GGGACCCGGCATCACTGAGCTGG + Intergenic
1007842341 6:44727222-44727244 GGGAAACGGAGGCCCTGGGCAGG - Intergenic
1013111501 6:107068671-107068693 GTGACCCCGAATCTCTGGGCAGG + Exonic
1019164058 6:170087442-170087464 GGGACCCGGAGGCCGTGGGGTGG + Intergenic
1019164075 6:170087482-170087504 GGGACCCGGAGGCCGTGGGGTGG + Intergenic
1019164105 6:170087562-170087584 GGGACCCGGAGACCCTGCGGTGG + Intergenic
1019164155 6:170087685-170087707 GGGACCCGGAGGCCCTGCGGTGG + Intergenic
1019164174 6:170087726-170087748 GGGACCCGGAGGCCGTGGGGTGG + Intergenic
1019164235 6:170087868-170087890 GGGACCCGGAGGCCGTGGGGTGG + Intergenic
1019164253 6:170087909-170087931 GGGACCCGGAGGCCGTGGGGTGG + Intergenic
1019246625 6:170713826-170713848 GAAAGCCTGAACCCCTGGGCCGG - Intergenic
1019457500 7:1138118-1138140 GAGACCCAGAGCCCCGGGGCGGG - Exonic
1019479639 7:1260541-1260563 GAGACCCGTGACCCCTGGTCAGG + Intergenic
1019538549 7:1541184-1541206 GGGGGCCGGATCCCGTGGGCAGG - Exonic
1019591575 7:1838181-1838203 GGCACCCGCAGCCCCTGGGATGG + Intronic
1024030526 7:45456308-45456330 GGAACCTGGAGCCCGTGGGCCGG - Intergenic
1029441079 7:100586889-100586911 GGGTCTCGGGACCCCCGGGCTGG + Intronic
1029445939 7:100612827-100612849 GGGTCCGGGGCCCCCTGGGCGGG + Exonic
1032706348 7:134423799-134423821 GGGACCCGGCCCCGCTGAGCAGG + Intergenic
1034493608 7:151407486-151407508 GGCCCCGGGAGCCCCTGGGCTGG - Intronic
1036749689 8:11435981-11436003 GGGACCCGGCACCCAGGAGCTGG - Intronic
1036769179 8:11566967-11566989 CGGATTGGGAACCCCTGGGCAGG + Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1039101184 8:33943532-33943554 GGGAGTCTGAACCCCTGGGGAGG - Intergenic
1039320501 8:36424987-36425009 GGGACCCTGAATCCTTGGGCAGG - Intergenic
1041535759 8:58923776-58923798 GGGACCCGGAACCCAGGTCCTGG - Intronic
1042092424 8:65173145-65173167 GTGACACTGAACCCCTGGGATGG + Intergenic
1053054555 9:34986783-34986805 GGGAACCGGAACCCGTGGGCAGG - Intergenic
1053412277 9:37923447-37923469 GGGACCTCGGACCCCTGGGGGGG - Intronic
1057220630 9:93256078-93256100 GTGCCCGGGCACCCCTGGGCTGG + Intronic
1058986490 9:110212758-110212780 GAGACCCACAACTCCTGGGCCGG + Intergenic
1060152734 9:121299262-121299284 GGGACCCGGCTCCCGTGGGCAGG - Intronic
1061168831 9:128940396-128940418 TGTACACGGAGCCCCTGGGCCGG + Exonic
1061859447 9:133460444-133460466 GGGACCAGAAACCCCAGGGCGGG + Intronic
1062269226 9:135701076-135701098 GGGTCCCACCACCCCTGGGCGGG - Intergenic
1062280863 9:135751059-135751081 GGGACCCGGGACCCCGCGCCCGG - Intronic
1062335395 9:136063207-136063229 AGCTCCCGGGACCCCTGGGCTGG + Intronic
1062405282 9:136393271-136393293 GGGACCCGGGACCCCTGGCATGG + Intronic
1062555437 9:137111697-137111719 GGGAACCTGGACCCCTGGGCAGG - Exonic
1062581215 9:137230087-137230109 GGCACCAGCAGCCCCTGGGCAGG + Intergenic
1185459392 X:327929-327951 GGGCCCCGGAACCCCGGGATGGG + Intergenic
1186463355 X:9765640-9765662 GGGACCCGGGGCCCGCGGGCCGG + Exonic
1187176615 X:16901904-16901926 GGGACGCAGAAGCCATGGGCTGG - Intergenic
1192496127 X:71617690-71617712 CGGCCCAGGGACCCCTGGGCAGG + Exonic
1194849969 X:98858003-98858025 GGAACCCAGTACCCCTGAGCAGG + Intergenic
1199627954 X:149757978-149758000 GGGACCCAGCACCCCAGGACAGG - Intergenic
1199628719 X:149761866-149761888 GGGACCCAGCACCCCAGGACAGG - Intergenic
1199643039 X:149881788-149881810 GGGACCCAGGACCCCAGGACAGG + Intronic