ID: 969517629

View in Genome Browser
Species Human (GRCh38)
Location 4:7656449-7656471
Sequence TGACATGAGGGAGACCCGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969517629_969517638 26 Left 969517629 4:7656449-7656471 CCATGCGGGTCTCCCTCATGTCA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 969517638 4:7656498-7656520 CATTCTAGGTCTCATGTCACAGG 0: 1
1: 0
2: 0
3: 8
4: 111
969517629_969517639 29 Left 969517629 4:7656449-7656471 CCATGCGGGTCTCCCTCATGTCA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 969517639 4:7656501-7656523 TCTAGGTCTCATGTCACAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 84
969517629_969517637 12 Left 969517629 4:7656449-7656471 CCATGCGGGTCTCCCTCATGTCA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 969517637 4:7656484-7656506 GAGGCTCGGGCACGCATTCTAGG 0: 1
1: 0
2: 0
3: 3
4: 50
969517629_969517640 30 Left 969517629 4:7656449-7656471 CCATGCGGGTCTCCCTCATGTCA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 969517640 4:7656502-7656524 CTAGGTCTCATGTCACAGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 121
969517629_969517634 -7 Left 969517629 4:7656449-7656471 CCATGCGGGTCTCCCTCATGTCA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 969517634 4:7656465-7656487 CATGTCACAGGGAAGAACTGAGG 0: 1
1: 0
2: 10
3: 101
4: 370
969517629_969517636 -1 Left 969517629 4:7656449-7656471 CCATGCGGGTCTCCCTCATGTCA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 969517636 4:7656471-7656493 ACAGGGAAGAACTGAGGCTCGGG 0: 1
1: 0
2: 7
3: 71
4: 618
969517629_969517635 -2 Left 969517629 4:7656449-7656471 CCATGCGGGTCTCCCTCATGTCA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 969517635 4:7656470-7656492 CACAGGGAAGAACTGAGGCTCGG 0: 1
1: 0
2: 5
3: 60
4: 548

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969517629 Original CRISPR TGACATGAGGGAGACCCGCA TGG (reversed) Intronic