ID: 969517632

View in Genome Browser
Species Human (GRCh38)
Location 4:7656461-7656483
Sequence AGTTCTTCCCTGTGACATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 211}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969517632_969517641 26 Left 969517632 4:7656461-7656483 CCCTCATGTCACAGGGAAGAACT 0: 1
1: 0
2: 0
3: 14
4: 211
Right 969517641 4:7656510-7656532 CATGTCACAGGAGGGAACTGAGG No data
969517632_969517637 0 Left 969517632 4:7656461-7656483 CCCTCATGTCACAGGGAAGAACT 0: 1
1: 0
2: 0
3: 14
4: 211
Right 969517637 4:7656484-7656506 GAGGCTCGGGCACGCATTCTAGG 0: 1
1: 0
2: 0
3: 3
4: 50
969517632_969517639 17 Left 969517632 4:7656461-7656483 CCCTCATGTCACAGGGAAGAACT 0: 1
1: 0
2: 0
3: 14
4: 211
Right 969517639 4:7656501-7656523 TCTAGGTCTCATGTCACAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 84
969517632_969517640 18 Left 969517632 4:7656461-7656483 CCCTCATGTCACAGGGAAGAACT 0: 1
1: 0
2: 0
3: 14
4: 211
Right 969517640 4:7656502-7656524 CTAGGTCTCATGTCACAGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 121
969517632_969517638 14 Left 969517632 4:7656461-7656483 CCCTCATGTCACAGGGAAGAACT 0: 1
1: 0
2: 0
3: 14
4: 211
Right 969517638 4:7656498-7656520 CATTCTAGGTCTCATGTCACAGG 0: 1
1: 0
2: 0
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969517632 Original CRISPR AGTTCTTCCCTGTGACATGA GGG (reversed) Intronic