ID: 969517633

View in Genome Browser
Species Human (GRCh38)
Location 4:7656462-7656484
Sequence CAGTTCTTCCCTGTGACATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 252}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969517633_969517642 30 Left 969517633 4:7656462-7656484 CCTCATGTCACAGGGAAGAACTG 0: 1
1: 0
2: 2
3: 32
4: 252
Right 969517642 4:7656515-7656537 CACAGGAGGGAACTGAGGCTTGG No data
969517633_969517640 17 Left 969517633 4:7656462-7656484 CCTCATGTCACAGGGAAGAACTG 0: 1
1: 0
2: 2
3: 32
4: 252
Right 969517640 4:7656502-7656524 CTAGGTCTCATGTCACAGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 121
969517633_969517641 25 Left 969517633 4:7656462-7656484 CCTCATGTCACAGGGAAGAACTG 0: 1
1: 0
2: 2
3: 32
4: 252
Right 969517641 4:7656510-7656532 CATGTCACAGGAGGGAACTGAGG No data
969517633_969517637 -1 Left 969517633 4:7656462-7656484 CCTCATGTCACAGGGAAGAACTG 0: 1
1: 0
2: 2
3: 32
4: 252
Right 969517637 4:7656484-7656506 GAGGCTCGGGCACGCATTCTAGG 0: 1
1: 0
2: 0
3: 3
4: 50
969517633_969517639 16 Left 969517633 4:7656462-7656484 CCTCATGTCACAGGGAAGAACTG 0: 1
1: 0
2: 2
3: 32
4: 252
Right 969517639 4:7656501-7656523 TCTAGGTCTCATGTCACAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 84
969517633_969517638 13 Left 969517633 4:7656462-7656484 CCTCATGTCACAGGGAAGAACTG 0: 1
1: 0
2: 2
3: 32
4: 252
Right 969517638 4:7656498-7656520 CATTCTAGGTCTCATGTCACAGG 0: 1
1: 0
2: 0
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969517633 Original CRISPR CAGTTCTTCCCTGTGACATG AGG (reversed) Intronic