ID: 969517637

View in Genome Browser
Species Human (GRCh38)
Location 4:7656484-7656506
Sequence GAGGCTCGGGCACGCATTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969517627_969517637 22 Left 969517627 4:7656439-7656461 CCACAGCAGCCCATGCGGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 202
Right 969517637 4:7656484-7656506 GAGGCTCGGGCACGCATTCTAGG 0: 1
1: 0
2: 0
3: 3
4: 50
969517628_969517637 13 Left 969517628 4:7656448-7656470 CCCATGCGGGTCTCCCTCATGTC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 969517637 4:7656484-7656506 GAGGCTCGGGCACGCATTCTAGG 0: 1
1: 0
2: 0
3: 3
4: 50
969517632_969517637 0 Left 969517632 4:7656461-7656483 CCCTCATGTCACAGGGAAGAACT 0: 1
1: 0
2: 0
3: 14
4: 211
Right 969517637 4:7656484-7656506 GAGGCTCGGGCACGCATTCTAGG 0: 1
1: 0
2: 0
3: 3
4: 50
969517629_969517637 12 Left 969517629 4:7656449-7656471 CCATGCGGGTCTCCCTCATGTCA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 969517637 4:7656484-7656506 GAGGCTCGGGCACGCATTCTAGG 0: 1
1: 0
2: 0
3: 3
4: 50
969517633_969517637 -1 Left 969517633 4:7656462-7656484 CCTCATGTCACAGGGAAGAACTG 0: 1
1: 0
2: 2
3: 32
4: 252
Right 969517637 4:7656484-7656506 GAGGCTCGGGCACGCATTCTAGG 0: 1
1: 0
2: 0
3: 3
4: 50
969517626_969517637 23 Left 969517626 4:7656438-7656460 CCCACAGCAGCCCATGCGGGTCT 0: 1
1: 0
2: 0
3: 9
4: 148
Right 969517637 4:7656484-7656506 GAGGCTCGGGCACGCATTCTAGG 0: 1
1: 0
2: 0
3: 3
4: 50
969517625_969517637 24 Left 969517625 4:7656437-7656459 CCCCACAGCAGCCCATGCGGGTC No data
Right 969517637 4:7656484-7656506 GAGGCTCGGGCACGCATTCTAGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969517637 Original CRISPR GAGGCTCGGGCACGCATTCT AGG Intronic