ID: 969517638

View in Genome Browser
Species Human (GRCh38)
Location 4:7656498-7656520
Sequence CATTCTAGGTCTCATGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969517629_969517638 26 Left 969517629 4:7656449-7656471 CCATGCGGGTCTCCCTCATGTCA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 969517638 4:7656498-7656520 CATTCTAGGTCTCATGTCACAGG 0: 1
1: 0
2: 0
3: 8
4: 111
969517633_969517638 13 Left 969517633 4:7656462-7656484 CCTCATGTCACAGGGAAGAACTG 0: 1
1: 0
2: 2
3: 32
4: 252
Right 969517638 4:7656498-7656520 CATTCTAGGTCTCATGTCACAGG 0: 1
1: 0
2: 0
3: 8
4: 111
969517628_969517638 27 Left 969517628 4:7656448-7656470 CCCATGCGGGTCTCCCTCATGTC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 969517638 4:7656498-7656520 CATTCTAGGTCTCATGTCACAGG 0: 1
1: 0
2: 0
3: 8
4: 111
969517632_969517638 14 Left 969517632 4:7656461-7656483 CCCTCATGTCACAGGGAAGAACT 0: 1
1: 0
2: 0
3: 14
4: 211
Right 969517638 4:7656498-7656520 CATTCTAGGTCTCATGTCACAGG 0: 1
1: 0
2: 0
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969517638 Original CRISPR CATTCTAGGTCTCATGTCAC AGG Intronic