ID: 969517639

View in Genome Browser
Species Human (GRCh38)
Location 4:7656501-7656523
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969517629_969517639 29 Left 969517629 4:7656449-7656471 CCATGCGGGTCTCCCTCATGTCA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 969517639 4:7656501-7656523 TCTAGGTCTCATGTCACAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 84
969517632_969517639 17 Left 969517632 4:7656461-7656483 CCCTCATGTCACAGGGAAGAACT 0: 1
1: 0
2: 0
3: 14
4: 211
Right 969517639 4:7656501-7656523 TCTAGGTCTCATGTCACAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 84
969517633_969517639 16 Left 969517633 4:7656462-7656484 CCTCATGTCACAGGGAAGAACTG 0: 1
1: 0
2: 2
3: 32
4: 252
Right 969517639 4:7656501-7656523 TCTAGGTCTCATGTCACAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 84
969517628_969517639 30 Left 969517628 4:7656448-7656470 CCCATGCGGGTCTCCCTCATGTC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 969517639 4:7656501-7656523 TCTAGGTCTCATGTCACAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type