ID: 969517640

View in Genome Browser
Species Human (GRCh38)
Location 4:7656502-7656524
Sequence CTAGGTCTCATGTCACAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969517632_969517640 18 Left 969517632 4:7656461-7656483 CCCTCATGTCACAGGGAAGAACT 0: 1
1: 0
2: 0
3: 14
4: 211
Right 969517640 4:7656502-7656524 CTAGGTCTCATGTCACAGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 121
969517633_969517640 17 Left 969517633 4:7656462-7656484 CCTCATGTCACAGGGAAGAACTG 0: 1
1: 0
2: 2
3: 32
4: 252
Right 969517640 4:7656502-7656524 CTAGGTCTCATGTCACAGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 121
969517629_969517640 30 Left 969517629 4:7656449-7656471 CCATGCGGGTCTCCCTCATGTCA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 969517640 4:7656502-7656524 CTAGGTCTCATGTCACAGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969517640 Original CRISPR CTAGGTCTCATGTCACAGGA GGG Intronic