ID: 969517641

View in Genome Browser
Species Human (GRCh38)
Location 4:7656510-7656532
Sequence CATGTCACAGGAGGGAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969517632_969517641 26 Left 969517632 4:7656461-7656483 CCCTCATGTCACAGGGAAGAACT 0: 1
1: 0
2: 0
3: 14
4: 211
Right 969517641 4:7656510-7656532 CATGTCACAGGAGGGAACTGAGG No data
969517633_969517641 25 Left 969517633 4:7656462-7656484 CCTCATGTCACAGGGAAGAACTG 0: 1
1: 0
2: 2
3: 32
4: 252
Right 969517641 4:7656510-7656532 CATGTCACAGGAGGGAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969517641 Original CRISPR CATGTCACAGGAGGGAACTG AGG Intronic