ID: 969517642

View in Genome Browser
Species Human (GRCh38)
Location 4:7656515-7656537
Sequence CACAGGAGGGAACTGAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969517633_969517642 30 Left 969517633 4:7656462-7656484 CCTCATGTCACAGGGAAGAACTG 0: 1
1: 0
2: 2
3: 32
4: 252
Right 969517642 4:7656515-7656537 CACAGGAGGGAACTGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969517642 Original CRISPR CACAGGAGGGAACTGAGGCT TGG Intronic