ID: 969518208

View in Genome Browser
Species Human (GRCh38)
Location 4:7660500-7660522
Sequence TGGGACTCTGCCTCCTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969518208_969518217 11 Left 969518208 4:7660500-7660522 CCCCCAAAGGAGGCAGAGTCCCA 0: 1
1: 1
2: 0
3: 14
4: 194
Right 969518217 4:7660534-7660556 ACATCTAGACTCGTGGTATTAGG 0: 1
1: 0
2: 0
3: 4
4: 59
969518208_969518218 17 Left 969518208 4:7660500-7660522 CCCCCAAAGGAGGCAGAGTCCCA 0: 1
1: 1
2: 0
3: 14
4: 194
Right 969518218 4:7660540-7660562 AGACTCGTGGTATTAGGAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 147
969518208_969518219 23 Left 969518208 4:7660500-7660522 CCCCCAAAGGAGGCAGAGTCCCA 0: 1
1: 1
2: 0
3: 14
4: 194
Right 969518219 4:7660546-7660568 GTGGTATTAGGAGAAGGCCTTGG 0: 1
1: 0
2: 2
3: 13
4: 148
969518208_969518216 4 Left 969518208 4:7660500-7660522 CCCCCAAAGGAGGCAGAGTCCCA 0: 1
1: 1
2: 0
3: 14
4: 194
Right 969518216 4:7660527-7660549 AGATGGGACATCTAGACTCGTGG 0: 1
1: 0
2: 1
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969518208 Original CRISPR TGGGACTCTGCCTCCTTTGG GGG (reversed) Intronic
901457421 1:9371276-9371298 TGGAACTCCGCTTCCTTTGAAGG + Intergenic
902368811 1:15993115-15993137 GGGGTCTGTGCCTCCTGTGGTGG - Intergenic
904075823 1:27841439-27841461 TGGGACTCAGCCTCCTTGTTAGG - Intronic
904771021 1:32881503-32881525 GGGGCCTCAGCCTCCTTTGGTGG + Intergenic
910456117 1:87399094-87399116 TGGGACTCCACCCCCTGTGGAGG + Intergenic
912274612 1:108243036-108243058 TGGGACACTCCCTGCTTTGAAGG + Intronic
912286655 1:108376822-108376844 TGGGACACTCCCTGCTTTGAAGG - Intronic
912586784 1:110774249-110774271 AGGGACCCTGCCTCCTGTGTTGG + Intergenic
914196534 1:145450790-145450812 CAGGACTCTGCCTCCTTTCCAGG - Intergenic
916500769 1:165384869-165384891 TGGGAATATGCCCCCTTTGTGGG - Intergenic
917627289 1:176859310-176859332 TGGGTCTCTGCCTCCATGGAGGG - Intronic
917943641 1:179947726-179947748 TGGTAGGCTGCCTCCTTAGGGGG + Intergenic
919430723 1:197487892-197487914 TGTGACTCTGCCTCTTGTGCAGG - Intergenic
919661072 1:200248005-200248027 TTGGACGCTGCCTGCTTTGCAGG - Intergenic
919794299 1:201311949-201311971 GGGGAGTCGGCCTCCTTGGGAGG - Intronic
920647677 1:207815403-207815425 TGGGACTCTCCCTAATTTTGGGG - Intergenic
921985792 1:221310414-221310436 TGGGAATTTGCCACCTTTGTTGG - Intergenic
1067054139 10:43041506-43041528 TGGGACTCAGCCTCAGCTGGTGG - Intergenic
1067142960 10:43671514-43671536 TGGTGCTCTGCCTACATTGGAGG - Intergenic
1068532852 10:58209099-58209121 TGTGACTCTGCCTCTTGTGCAGG + Intronic
1069761924 10:70816703-70816725 TGGTTCTCTCCCTCCTTTGAAGG - Intronic
1070320618 10:75352173-75352195 TGCATCTCTGCCTCCTTTTGGGG - Intergenic
1070429949 10:76327726-76327748 GGAGACCCTGCTTCCTTTGGGGG + Intronic
1070450513 10:76552907-76552929 TGGGAATCAGCCTCCTTTCTTGG - Intronic
1072483687 10:95833796-95833818 TTGAACTCTGCATCCTCTGGAGG + Intronic
1072627975 10:97126408-97126430 TTGGACTCTGCCACTTTTGGTGG - Intronic
1073094782 10:100972861-100972883 TGTGACTCTGGCTCCCTTTGGGG + Exonic
1073601133 10:104847157-104847179 TGTGTCTCTGCCTCAGTTGGTGG + Intronic
1073940410 10:108691581-108691603 TTGTACTCTGCATCCTCTGGAGG + Intergenic
1074661076 10:115658572-115658594 TGGAACTCTCCCTCCTTCAGTGG - Intronic
1075194789 10:120346972-120346994 TGGGACTGTCCTTCCTCTGGGGG - Intergenic
1075979557 10:126724850-126724872 TGGGACTCAGGCTTCTCTGGTGG + Intergenic
1076910437 10:133385439-133385461 TGGGACCCTGAGTGCTTTGGTGG + Intronic
1077139882 11:1019601-1019623 CGGGACTCAGCCTCCTTGGAGGG + Intronic
1081661798 11:44892946-44892968 TGGGAGGCTGCCTCAATTGGTGG + Intronic
1083777870 11:64903006-64903028 TGGGAATCAGCCACCTTTGTAGG - Intronic
1083806800 11:65079275-65079297 TGGGGCTCTGGCTCTTTTGGGGG - Intronic
1083924456 11:65797580-65797602 TGGGACTGTGGCTCCTTCTGTGG - Intergenic
1084396371 11:68913453-68913475 AGAGACTCTGCCTCCTCTGCTGG + Intronic
1084800144 11:71538257-71538279 GGGGACTGTGGCTCCTGTGGGGG + Exonic
1085455562 11:76663565-76663587 TGTGAAGCTGCCTCCCTTGGAGG - Intronic
1086834958 11:91609398-91609420 TGGGACTCAGTCTCCTGAGGAGG + Intergenic
1086975554 11:93128696-93128718 GGAGAATTTGCCTCCTTTGGCGG - Intergenic
1087517760 11:99186215-99186237 TGGAACTCTTCCTCCTTCTGTGG - Intronic
1089010678 11:115129353-115129375 CTGGATTCTGCCTGCTTTGGAGG - Intergenic
1089129874 11:116203209-116203231 TGGGATTCTGCTCCATTTGGAGG - Intergenic
1092170177 12:6369460-6369482 TGGAACCCAGCCTCCTCTGGAGG - Intronic
1092280731 12:7096180-7096202 TGGGACTCTGCTTCCTGTCTGGG + Exonic
1094582062 12:31742619-31742641 TGGGACTTTGCCTCATCTGAAGG + Intergenic
1097066860 12:56326959-56326981 TGGGTTTCTTCCTCCTTTGTAGG - Exonic
1097087229 12:56477544-56477566 TGGGGCTCTGATTCCTTTGAGGG - Exonic
1101660403 12:106760061-106760083 TGGGAGGCTGCCTCCTGTGAGGG - Intronic
1102804213 12:115764988-115765010 TGGGTCTCTGACTCATATGGTGG + Intergenic
1103898432 12:124289874-124289896 TGGGACTCTGCATCCTCAGCAGG - Intronic
1103915056 12:124371915-124371937 TCTGGCTCTGCCTGCTTTGGGGG - Intronic
1104921999 12:132295390-132295412 TGGGACTCTGCCTGTTTTTCTGG - Intronic
1105995255 13:25665093-25665115 GGGGACTCTGCCTTCGTTGCTGG - Intronic
1107821340 13:44288552-44288574 TGGAACTCAGACTCCTGTGGAGG + Intergenic
1111003422 13:82215830-82215852 TGGGAGTCTCCCTGCTTAGGTGG + Intergenic
1112084285 13:96013130-96013152 TGGGATTCTGTCTCTTCTGGGGG - Intronic
1113773880 13:112931174-112931196 TGGCTCTCTGCCTCCTGTGCAGG - Intronic
1115962741 14:38853998-38854020 TGGGACTCCGCCTGCTTGGCTGG + Intergenic
1117339147 14:54778989-54779011 TAGGAGGCTGCCTCCTTGGGAGG - Intronic
1118821893 14:69351119-69351141 TGGGAAGCTGCCTTCTTTGTAGG - Intronic
1120299033 14:82681861-82681883 TGTGAGTCTGCCTGGTTTGGGGG + Intergenic
1122214295 14:100193077-100193099 TGGGACTTTGCCTCCCTCGCTGG - Intergenic
1124155200 15:27219321-27219343 TTGGACTCTGCCTACCTTGGAGG - Intronic
1124374930 15:29123890-29123912 TGGGTCGCTGCCTGCTGTGGTGG - Intronic
1126692339 15:51297385-51297407 TGGGACTCTGTCTCCCCCGGTGG - Intronic
1127320514 15:57840717-57840739 TGGGACTCTGGATGCTTGGGTGG + Intergenic
1128930724 15:71702844-71702866 ACGGACTCTGCCTCCTTTGAGGG - Intronic
1129186625 15:73911212-73911234 TGGGACTCTTCCTCCTGTTCTGG - Intergenic
1129329965 15:74821986-74822008 TGGGCCTCTGCTTCCTTCAGGGG + Intronic
1129612945 15:77074770-77074792 TGGGTCTGTGCTTCCTTGGGAGG - Intronic
1129760906 15:78128883-78128905 TGTGACTCAGCCTCTTTTGTGGG - Intronic
1131806885 15:96131824-96131846 TGGGACCCAGCCTCCCTTGAAGG - Intergenic
1131859395 15:96636480-96636502 TGGGACTCTGCCTCCCTCCAGGG + Intergenic
1132029125 15:98426356-98426378 TTGGACTCTGCCACATCTGGTGG - Intergenic
1132235999 15:100222211-100222233 TGGCACTCTGCTTCCTTTCTGGG - Intronic
1132587768 16:713703-713725 TGGGAGTCTTCCACCTTTTGGGG + Intronic
1133115361 16:3575443-3575465 TGGGACTCGGGTTGCTTTGGGGG + Intronic
1135087346 16:19486091-19486113 TGGGAATCTGCCTAATTTGCTGG + Intronic
1136041603 16:27583859-27583881 CTTGACTCTGCCTTCTTTGGTGG + Intronic
1136230579 16:28883180-28883202 TGGGATTCTGCCCCCTTCAGCGG + Intronic
1139692817 16:68651852-68651874 TGGAGCTCTGCCTCCTTCTGGGG + Intronic
1140262087 16:73389169-73389191 TGTGCCACTGCCTGCTTTGGAGG - Intergenic
1142054212 16:87982537-87982559 AGGGACCGTGCCTCCTTTGTAGG + Intronic
1143541336 17:7571255-7571277 TGGGACCCTGGCTCCCTTTGGGG + Intronic
1145050953 17:19660140-19660162 AGGGCCTCTGCCTCCCTTTGAGG + Intronic
1146044326 17:29490834-29490856 TTTAACTCTGCATCCTTTGGAGG + Intronic
1146287972 17:31587181-31587203 CGGGACTCTGCGTCCTGTGCTGG - Intergenic
1148860063 17:50600064-50600086 TGCGGCTCTGCCACCCTTGGTGG + Intronic
1154195564 18:12263677-12263699 TGGGATTCTTCCTTATTTGGTGG - Intronic
1156913087 18:42434416-42434438 TGGGACTCTCCCACATTTAGAGG + Intergenic
1157522112 18:48352493-48352515 TGAGACTGTGCCTCCTCTTGGGG - Intronic
1158881623 18:61784368-61784390 GGGGACTCTGCCTCTCTTAGGGG - Intergenic
1159239852 18:65728265-65728287 TGGGACTTTTCCTGCTTTGGAGG - Intergenic
1160015638 18:75138320-75138342 TGGAACGCTGCCTTCTCTGGAGG + Intergenic
1160134305 18:76259476-76259498 TGGGCCTCTGCATCCCTTCGAGG - Intronic
1160438620 18:78870900-78870922 TGTAACTCTGCCTCCCGTGGGGG + Intergenic
1160819427 19:1051105-1051127 TGGGACTCTGCCTGCCATGTGGG + Intronic
1162088512 19:8262530-8262552 TGGGGCCCTGCATCCTTGGGTGG - Intronic
1162834887 19:13309937-13309959 GGGGACAGGGCCTCCTTTGGGGG - Intronic
1166893926 19:46011622-46011644 TGGCAAGATGCCTCCTTTGGTGG + Intronic
1166918552 19:46212894-46212916 TGGGACTCACACTCCTCTGGGGG - Intergenic
1168565301 19:57417354-57417376 AGGGACTATCCCTCCTTTTGTGG + Intronic
925459297 2:4045956-4045978 AGTGACTTTGACTCCTTTGGGGG + Intergenic
926037231 2:9645366-9645388 TGGGACTCTGCCACGTTGGGTGG + Intergenic
926433836 2:12818102-12818124 TGGCACTGTGGCTTCTTTGGGGG - Intergenic
929563725 2:42971576-42971598 CGGAACTCTGCCTCTTCTGGAGG + Intergenic
929775271 2:44927097-44927119 TGGGACTCTGCAGCCTGCGGAGG - Intergenic
933703656 2:85273965-85273987 GTGGACTCTGCATCCTGTGGGGG + Intronic
935701973 2:105820569-105820591 TCTGACCCTGCCTTCTTTGGGGG + Intronic
940049770 2:149449995-149450017 TGGTATTCTGCCTCTTGTGGAGG + Intronic
940753099 2:157649784-157649806 TGGGAGGCCGCCTCCTTGGGGGG - Intergenic
941392131 2:164927178-164927200 TTGAACTCTGCTTCCTCTGGAGG - Intronic
941683666 2:168426190-168426212 TGGGTCTCTGCCTCCTCTTTGGG + Intergenic
942990986 2:182202508-182202530 GGTGACTCAGTCTCCTTTGGGGG - Intronic
943795414 2:191986929-191986951 TGGGATTTTGTCTCCTTTTGGGG + Intronic
944034372 2:195275976-195275998 TGGAACTCAGCCTCCTTCGCTGG - Intergenic
947654008 2:231810784-231810806 TAAGACTCGGCCCCCTTTGGAGG + Intergenic
948752704 2:240141727-240141749 TGGGACTCAGCATCCTCTCGAGG + Intronic
1169028365 20:2388436-2388458 TGGGAATCTGCCTCCTGAGTTGG - Intronic
1171245152 20:23604749-23604771 TGGTTCTCTGCCTCCTGGGGTGG - Intronic
1173818195 20:46003659-46003681 TGGGACTGCGCCTGCTTTGCTGG + Intergenic
1174173878 20:48632934-48632956 GCGGACTCTGCCTACTTAGGGGG + Intronic
1177076334 21:16579186-16579208 CAGGACTCTGGCTCCTTTGAGGG + Intergenic
1178258882 21:31080431-31080453 GGAGACTGTGTCTCCTTTGGTGG + Intergenic
1179989084 21:44937035-44937057 TGGGTCTTTGCTTCCTTAGGAGG + Intronic
1181048645 22:20228343-20228365 TGGGACTCTGGGGCCTTTGGGGG + Intergenic
1181952457 22:26564302-26564324 AGGAACTCTGCTTCCTTTGCTGG - Intronic
1182397546 22:30047090-30047112 TGGAGCTCTGCCTCCTTCTGGGG + Intergenic
1182467239 22:30525149-30525171 TGGGACTCTGACTTCCATGGTGG + Intronic
950449026 3:13055209-13055231 TGGAACACTCCCTCCTCTGGGGG + Intronic
951697843 3:25464322-25464344 TGGGATTCTGACTCCTTTTTAGG + Intronic
952206138 3:31182576-31182598 TGGAGCTCTGCCTCCTTCTGGGG + Intergenic
953846933 3:46435012-46435034 TGAAACTCTGCCTCCATTGTGGG - Intergenic
954596650 3:51830757-51830779 TGGAACTCTGGCTGCTTTGAAGG - Exonic
956644638 3:71443967-71443989 TGGCACTCAGCCTCCTTCAGAGG + Intronic
959925452 3:111916223-111916245 TAAGACTCTGCATCCTTTAGAGG + Intronic
961482992 3:127196078-127196100 TCAGACACTGCATCCTTTGGAGG + Intronic
962285710 3:134084274-134084296 TGTGCCTGTGCCTACTTTGGGGG - Intronic
963669795 3:148236874-148236896 AGAGACTCTGGCTCCTGTGGAGG + Intergenic
965653128 3:170953978-170954000 TGGATGTCTGCCTTCTTTGGGGG - Intergenic
966678559 3:182616098-182616120 TGGGACTCTGCCACGTTTCATGG - Intergenic
968188057 3:196646723-196646745 TGAGGCTCTGCCTCCATCGGGGG - Intronic
968673284 4:1863792-1863814 TGGGGCTCTGCTTGCTTGGGTGG + Intergenic
969518208 4:7660500-7660522 TGGGACTCTGCCTCCTTTGGGGG - Intronic
977624842 4:99179222-99179244 TGTGACTCTGCCTCCTGTGTAGG + Intergenic
983816009 4:172127375-172127397 TGGGCCTGTGCCTGCTATGGTGG - Intronic
984244896 4:177263558-177263580 AGGGGCTCTGCGTCCTTTGCAGG - Intergenic
984466787 4:180109995-180110017 GGGGACTCTGCATCCCTGGGTGG + Intergenic
984879244 4:184396199-184396221 TTCTGCTCTGCCTCCTTTGGTGG + Intronic
985831999 5:2240691-2240713 TGGGACGCTGGCTCCTGTGGAGG - Intergenic
986889056 5:12277675-12277697 TGGCAATCTGCATCCTTTGGTGG + Intergenic
987690947 5:21265983-21266005 TGGGAGTCTGTGTCCTTTGTAGG - Intergenic
988837068 5:35044197-35044219 TGAGACACTGCCTCCCATGGAGG + Intronic
989352197 5:40499333-40499355 TGGGAATGTGTCTCCTTTGAAGG - Intergenic
995796686 5:115948661-115948683 TAGGATTCTTCCTCCTTGGGTGG + Intergenic
996023093 5:118613386-118613408 TGGGACTCTGAATCCTTGGAAGG - Intergenic
997735862 5:136212346-136212368 TGGGACTCAGCGCCCTCTGGTGG + Intergenic
999388745 5:151174606-151174628 TGGGACTCTGCCTCCTTTGTGGG + Intergenic
1002139934 5:177132578-177132600 GGGGACTCGGCCTCCCTGGGCGG + Intergenic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1007446006 6:41906780-41906802 TTGGACCTTGCCTCCTTTAGGGG - Exonic
1011249514 6:85356238-85356260 TGGAACACTGCATCCTCTGGAGG + Intergenic
1011264625 6:85502300-85502322 TGGGAATCTGCCTACTTGGGAGG + Intergenic
1012358099 6:98341268-98341290 TTGGACTGTGCATTCTTTGGAGG + Intergenic
1015996039 6:138996055-138996077 TAGGACTCTGCCTCCATCCGGGG - Intergenic
1016394657 6:143610654-143610676 TGGGACTCCGGCCCTTTTGGTGG + Intronic
1018486696 6:164247439-164247461 TGGATCTCTGCCTCCTACGGAGG + Intergenic
1019671788 7:2283789-2283811 TGGGAATCTGCTTTTTTTGGAGG + Intronic
1022027534 7:26462819-26462841 AGGAACTCTGCATCCTTTGTTGG - Intergenic
1023381670 7:39614334-39614356 TGGGACTCTGAATGGTTTGGTGG - Intergenic
1026233638 7:68507483-68507505 GTGGACTCTGCCTCCTTTGTGGG - Intergenic
1028811263 7:95089610-95089632 TGGGACTCCGCTCCCTGTGGTGG - Intronic
1030166665 7:106562303-106562325 TGGGACTTAGCCTCCATTGATGG + Intergenic
1032276351 7:130459536-130459558 CGGGACTCTGCCCTCTCTGGTGG + Intergenic
1036215680 8:6877896-6877918 GGAGACGCTGGCTCCTTTGGAGG + Exonic
1039198466 8:35059849-35059871 TGTGACTCTGCCTCTTGTGCAGG + Intergenic
1042084264 8:65090018-65090040 TGTGACTCTGCCTCTTGTGCAGG - Intergenic
1046381137 8:113452646-113452668 TGGGACTGTTACTACTTTGGGGG - Intergenic
1047402113 8:124556434-124556456 AGGGCCTCTGCCTCCACTGGAGG + Intronic
1047996588 8:130342516-130342538 TGGGCCTCTGCTTCCCTAGGGGG - Intronic
1048672561 8:136739390-136739412 TGGGACTATGACACATTTGGCGG - Intergenic
1048672565 8:136739410-136739432 GGGAAATCTGCTTCCTTTGGTGG - Intergenic
1049270228 8:141691618-141691640 TGCGACCCTGCCTTCTTTGAGGG + Intergenic
1049493539 8:142917481-142917503 CGGCACTCTGCATCCTTTGGAGG - Intronic
1050274944 9:3986798-3986820 TGGGTCTTTGCCTACTTTAGTGG - Intronic
1051065617 9:13098928-13098950 TGAGCCTCTGCCTGCTTTGTTGG - Intergenic
1058712751 9:107695181-107695203 TGGGACTCTGCCTAATTAGATGG + Intergenic
1059493886 9:114693555-114693577 TGGGTCTCTGCTTCCTTAGATGG + Intergenic
1060672584 9:125482981-125483003 TGGGGCTCTGCATCATTTGCCGG + Intronic
1061057569 9:128232604-128232626 TGGGCCTCTTCCTCCACTGGGGG + Intronic
1061346515 9:130030569-130030591 TAGGCTTCTGCCTCCTCTGGAGG - Intronic
1062286643 9:135776015-135776037 TGGGACTCTGCCTGCATGTGGGG + Intronic
1062637030 9:137497008-137497030 CCGGGCTCTGCCTCCATTGGGGG - Intronic
1062698198 9:137886044-137886066 CAGGACTCTGCCTCCTTTCCAGG + Intronic
1187511651 X:19925098-19925120 TGGGAATCTGACTACTTTGTAGG + Intronic
1187874812 X:23795475-23795497 TGAGAGTCTGACGCCTTTGGAGG + Intergenic
1189712174 X:43824724-43824746 TGTTACTCTGCTTTCTTTGGGGG - Intronic
1189726468 X:43972259-43972281 TGGGAGTCTGCCTCTCATGGAGG + Intronic
1189802787 X:44707348-44707370 TAGCACTCTGCCTTCTATGGGGG - Intergenic
1190456827 X:50635254-50635276 TGGGCCCCTGACTGCTTTGGCGG + Exonic
1193875758 X:86861065-86861087 GGGGAGTCTGCTTCCATTGGAGG - Intergenic
1199509106 X:148600097-148600119 TGTGACTCTTCCACATTTGGTGG + Intronic
1199565435 X:149210932-149210954 TGGTACCCTGGCCCCTTTGGTGG - Intergenic
1199593127 X:149486511-149486533 AGGGACTCAGCCTTCTTTGTGGG - Intronic
1200708764 Y:6465316-6465338 TGATATTCTTCCTCCTTTGGTGG - Intergenic
1201025348 Y:9699393-9699415 TGATATTCTTCCTCCTTTGGTGG + Intergenic