ID: 969518718

View in Genome Browser
Species Human (GRCh38)
Location 4:7663534-7663556
Sequence CAGTGTACACAGAGGGTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969518718_969518723 4 Left 969518718 4:7663534-7663556 CCACGTACCCTCTGTGTACACTG 0: 1
1: 0
2: 0
3: 9
4: 101
Right 969518723 4:7663561-7663583 CTGCCTCCTCTGAACAGACCGGG 0: 1
1: 0
2: 2
3: 18
4: 271
969518718_969518727 11 Left 969518718 4:7663534-7663556 CCACGTACCCTCTGTGTACACTG 0: 1
1: 0
2: 0
3: 9
4: 101
Right 969518727 4:7663568-7663590 CTCTGAACAGACCGGGCAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 138
969518718_969518728 12 Left 969518718 4:7663534-7663556 CCACGTACCCTCTGTGTACACTG 0: 1
1: 0
2: 0
3: 9
4: 101
Right 969518728 4:7663569-7663591 TCTGAACAGACCGGGCAGGTGGG No data
969518718_969518725 8 Left 969518718 4:7663534-7663556 CCACGTACCCTCTGTGTACACTG 0: 1
1: 0
2: 0
3: 9
4: 101
Right 969518725 4:7663565-7663587 CTCCTCTGAACAGACCGGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 107
969518718_969518722 3 Left 969518718 4:7663534-7663556 CCACGTACCCTCTGTGTACACTG 0: 1
1: 0
2: 0
3: 9
4: 101
Right 969518722 4:7663560-7663582 TCTGCCTCCTCTGAACAGACCGG 0: 1
1: 0
2: 0
3: 22
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969518718 Original CRISPR CAGTGTACACAGAGGGTACG TGG (reversed) Intronic
902059588 1:13630932-13630954 AAGTGTATACAGAGGGCAGGTGG - Intergenic
902480868 1:16710835-16710857 CGGTGTACACAGCGGGTGGGGGG + Intergenic
906794836 1:48688597-48688619 CAGTGTAAGCAAAGGGAACGAGG - Intronic
908105567 1:60838356-60838378 CAGTGTTCTAAGAGGGTACGAGG - Intergenic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
918920583 1:190704309-190704331 CAGAGAACCCAGAGGGTAAGTGG + Intergenic
920544588 1:206804978-206805000 CAGTGTCCACAGAGGATCCAAGG - Intronic
1067143774 10:43678771-43678793 CAGTGAACACAGTGGGCAGGAGG - Intergenic
1072630087 10:97139799-97139821 CAGTGTGCACACAGGGCACTGGG + Intronic
1074310980 10:112323252-112323274 CAGTATACACAAAGGGTTTGGGG + Intergenic
1075419793 10:122292169-122292191 CAGTGTACATAGAGACTAAGGGG - Intronic
1075917828 10:126184825-126184847 AAGTGTACAACAAGGGTACGAGG + Intronic
1076059152 10:127400060-127400082 CAGTGTCCAGGGAGGGTAGGAGG - Intronic
1076086974 10:127641035-127641057 AAATGTACAAAGAGGGTACCTGG - Intergenic
1078101857 11:8334699-8334721 CAGGGAAGACAGAGGGTACAGGG - Intergenic
1083672642 11:64307536-64307558 CAGTGTACCCAGAGGGTGCAGGG - Intronic
1083687527 11:64385478-64385500 CACTGGACACAGAGGGGAGGTGG + Intergenic
1083715431 11:64572509-64572531 CAGTGTACACAGGGTGAAAGAGG - Exonic
1088241707 11:107779958-107779980 CAGTGTACCCAGACAGAACGAGG + Intergenic
1088692051 11:112336610-112336632 CAGTGTGCACAGAGGCAAAGGGG + Intergenic
1090094048 11:123726284-123726306 CAGTGAACACAGGCGGTACCTGG - Exonic
1091955391 12:4637273-4637295 CATTGTCGACAGAGGGTACTGGG + Intronic
1099880313 12:88459514-88459536 GAGTGTACACACAGGGTGGGAGG + Intergenic
1102972928 12:117185013-117185035 CAATGTAAACAGAGGGAATGGGG + Intronic
1103787553 12:123444619-123444641 CAGTGTACAGTGAGGAAACGAGG - Intergenic
1104616437 12:130273694-130273716 CTGTGGATACAGAGGGTACATGG - Intergenic
1104962221 12:132493702-132493724 CAGGGTACACAAAGGGGGCGGGG - Intronic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1108432763 13:50371031-50371053 CAGAGCACACAGAGGGGAGGAGG + Intronic
1111522999 13:89428898-89428920 CTGTGGATATAGAGGGTACGAGG - Intergenic
1111838298 13:93416730-93416752 CAGTGGACACAGAGAGTAGAAGG - Intronic
1112174155 13:97005295-97005317 CAGTGTACACAGAGCCCACCTGG - Intergenic
1122111832 14:99508682-99508704 AAGTGTACAGAGAGGGAATGGGG + Exonic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1122857690 14:104567771-104567793 CAGGGTCCAGAGAGGGTGCGTGG - Intronic
1132623910 16:881068-881090 CAGGGTCCAGAGAGGCTACGTGG + Intronic
1134807859 16:17140968-17140990 CAGTCTGCACAGAGGCTGCGTGG - Intronic
1137697797 16:50473872-50473894 CAGTGGAGACAGAGGTTAGGAGG + Intergenic
1143856833 17:9857582-9857604 CAGTGTAAACAGTGGGGAAGGGG - Intronic
1143898624 17:10156603-10156625 CACTGTAGCCAGAGGGTGCGAGG - Intronic
1143918825 17:10314776-10314798 CAGTGCACACAGTAGGTACTTGG - Intronic
1145276121 17:21431881-21431903 CAGTGTGCACAGAGGTCACAGGG - Intergenic
1145313965 17:21717795-21717817 CAGTGTGCACAGAGGTCACAGGG - Intergenic
1147899121 17:43772404-43772426 CAGTGCACACAGAGCCTACTGGG + Intronic
1151104232 17:71593993-71594015 CAGTGTATACAGAGGTTAGCGGG - Intergenic
1153734091 18:8046442-8046464 CAAGATACACAGAGGGTAAGTGG - Intronic
1155803551 18:30138985-30139007 CAGTTTACACAGAGAGAAAGAGG + Intergenic
1160480594 18:79236786-79236808 CCGTGTACACAGTGGGGAAGGGG - Intronic
1160480604 18:79236837-79236859 CCGTGTACACAGTGGGGAAGGGG - Intronic
1160480618 18:79236895-79236917 CTGTGTACACAGTGGGGAAGGGG - Intronic
1160480627 18:79236946-79236968 CTGTGTACACAGTGGGGAAGGGG - Intronic
1160480636 18:79236997-79237019 CCGTGTACACAGTGGGGAAGGGG - Intronic
1160480650 18:79237055-79237077 CTGTGTACACAGTGGGGAAGGGG - Intronic
1160480659 18:79237106-79237128 CCGTGTACACAGTGGGGAAGGGG - Intronic
1160480673 18:79237164-79237186 CTGTGTACACAGTGGGGAAGGGG - Intronic
1160480686 18:79237222-79237244 CCGTGTACACAGTGGGGAAGGGG - Intronic
1160480696 18:79237273-79237295 CCGTGTACACAGTGGGGAAGGGG - Intronic
1160480714 18:79237375-79237397 CCGTGTACACAGTGGGGAAGGGG - Intronic
1160946631 19:1646892-1646914 CAGTGCACACACAGGAAACGAGG - Intronic
1162380446 19:10328778-10328800 CAGTGCACGTAGAGGGTGCGTGG + Exonic
1162642022 19:12018417-12018439 GAGTGTAGACAGAGAGTATGAGG - Intronic
1162811236 19:13165326-13165348 CTGTGTAAACAGAGGGGACTTGG - Intergenic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1163536469 19:17879632-17879654 CAGAGTTAGCAGAGGGTACGGGG + Intronic
1164713758 19:30376910-30376932 CTGTGTGCACAGTGGGTACGGGG + Intronic
1166293649 19:41878645-41878667 CAGAGTACAAAGTGGGTATGCGG + Intronic
1167752213 19:51387953-51387975 CAGTCTGCACAGAGGGGCCGTGG - Exonic
1202714904 1_KI270714v1_random:36740-36762 CGGTGTACACAGCGGGTGGGGGG + Intergenic
929732003 2:44504975-44504997 CAGTGTGCACAGAGGTCATGTGG + Intronic
930990710 2:57650672-57650694 CAGTGTAGACAGAGGCAATGGGG + Intergenic
933096472 2:78189469-78189491 CAGTGTACACAGCCTGTATGAGG - Intergenic
942994738 2:182247556-182247578 CAGAGTACAAGGCGGGTACGAGG - Intronic
945180949 2:207090558-207090580 CTGTGTTCACAGAGGTTACTAGG + Intronic
949042994 2:241857991-241858013 CAGTGTACACAGAGGGCCCAGGG + Intronic
1179581707 21:42348510-42348532 CAGTGTAGAAACAGGGTAGGTGG + Intronic
1184859704 22:47166195-47166217 CAGTGTGCACAGAGGGTCCAGGG + Intronic
953851911 3:46471089-46471111 CAGTGTTGACAGAGGCTGCGGGG + Intronic
954223932 3:49171079-49171101 CAGTGTACACTGAGGCTAGCGGG - Intergenic
964627461 3:158772943-158772965 GAGTGTTCACAGGGGGTGCGAGG - Intronic
968654319 4:1772045-1772067 CTGTGTGCACAGAGGGGCCGGGG - Intergenic
969518718 4:7663534-7663556 CAGTGTACACAGAGGGTACGTGG - Intronic
970236431 4:13963224-13963246 CAGTGTACACAGATTTTAAGAGG - Intergenic
982070754 4:151692523-151692545 CAGTGTACACCTAGGCCACGTGG + Intronic
982257510 4:153465664-153465686 CAGTGTCCACAGAGGGTGCCGGG + Intergenic
985607348 5:865134-865156 CAGGGTCCACAGAGGGCACAGGG + Intronic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
996192910 5:120567434-120567456 CAGAGTACACAGAGGGTGGTAGG + Intronic
997098354 5:130939463-130939485 CACTGACCACAGAGGGTACAAGG + Intergenic
997775112 5:136597176-136597198 AAGTGTACCCAGAGAGTAGGGGG - Intergenic
1001057866 5:168464352-168464374 CAGTGTACAGAGAGGGCGGGTGG + Intronic
1003991667 6:11492719-11492741 CAGTGTAGAGAGAGATTACGTGG + Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1010631707 6:78206685-78206707 CAGTGTTCATAGAGGGTTCCTGG - Intergenic
1011995434 6:93581223-93581245 CAGAGTACACAGAGAATATGAGG + Intergenic
1013352411 6:109317709-109317731 CCCTGTACCCAGAGGGGACGGGG + Intergenic
1015765421 6:136711011-136711033 CAGTGTGCAGAAAGGGTACGGGG - Intronic
1018908042 6:168086561-168086583 CAGTGTCCACACTGGGCACGTGG - Intergenic
1027856027 7:83512331-83512353 CAGTGTACATACAGCTTACGTGG - Intronic
1032264351 7:130360446-130360468 GAATGTACACAGAGGGTGCAGGG + Intronic
1039477057 8:37844618-37844640 CAGTGGAGACAGGGGGTACAGGG + Exonic
1040779147 8:51086395-51086417 CAGTGTTCACAGAGGCTAGTGGG - Intergenic
1041945836 8:63441787-63441809 CATGGTAGACAGAGGGTAAGTGG + Intergenic
1045557529 8:103229024-103229046 CAGTGTACAGAGAGGCCAAGGGG - Exonic
1045588871 8:103570159-103570181 CATTGTATAATGAGGGTACGGGG - Intronic
1046137916 8:110054489-110054511 CATTGTAACCAGAGGGTATGAGG - Intergenic
1051397091 9:16634843-16634865 CAGTGTACACTGAGGGGAGGGGG + Intronic
1053536276 9:38929548-38929570 CAGTGTTCACTGAGGGGATGGGG - Intergenic
1054629859 9:67434400-67434422 CAGTGTTCACTGAGGGGATGGGG + Intergenic
1056667090 9:88589641-88589663 CTGTGCACACACAGGGTACAGGG + Intergenic
1187005038 X:15224469-15224491 CAGTGTCCACAGAGGGACTGTGG + Intergenic
1188303807 X:28537871-28537893 GAGTTTAAACAGAGGCTACGTGG - Intergenic