ID: 969522807

View in Genome Browser
Species Human (GRCh38)
Location 4:7688691-7688713
Sequence CCCAAGTCAGGGAACTCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969522807_969522816 26 Left 969522807 4:7688691-7688713 CCTATGGAGTTCCCTGACTTGGG No data
Right 969522816 4:7688740-7688762 CATTACCCCACAAAGCCTTTTGG No data
969522807_969522813 -10 Left 969522807 4:7688691-7688713 CCTATGGAGTTCCCTGACTTGGG No data
Right 969522813 4:7688704-7688726 CTGACTTGGGGAAATTAGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969522807 Original CRISPR CCCAAGTCAGGGAACTCCAT AGG (reversed) Intronic