ID: 969526885

View in Genome Browser
Species Human (GRCh38)
Location 4:7708393-7708415
Sequence CGTTATTCCCAAGAAGGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969526878_969526885 4 Left 969526878 4:7708366-7708388 CCAGCTGGGGTCCCGGGTGGGTG 0: 1
1: 0
2: 35
3: 530
4: 739
Right 969526885 4:7708393-7708415 CGTTATTCCCAAGAAGGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 41
969526877_969526885 5 Left 969526877 4:7708365-7708387 CCCAGCTGGGGTCCCGGGTGGGT 0: 1
1: 0
2: 0
3: 22
4: 195
Right 969526885 4:7708393-7708415 CGTTATTCCCAAGAAGGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 41
969526882_969526885 -8 Left 969526882 4:7708378-7708400 CCGGGTGGGTGGGAGCGTTATTC 0: 1
1: 0
2: 0
3: 6
4: 49
Right 969526885 4:7708393-7708415 CGTTATTCCCAAGAAGGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 41
969526881_969526885 -7 Left 969526881 4:7708377-7708399 CCCGGGTGGGTGGGAGCGTTATT 0: 1
1: 0
2: 0
3: 6
4: 76
Right 969526885 4:7708393-7708415 CGTTATTCCCAAGAAGGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969526885 Original CRISPR CGTTATTCCCAAGAAGGCGA GGG Intronic
900871291 1:5305453-5305475 CACTGTTCCCAAGAAGGGGAAGG + Intergenic
911568049 1:99487854-99487876 CATTATTCCCATTAAGGCTACGG - Intergenic
916661509 1:166926179-166926201 CGTTAGTTCCAAGAAGAGGAGGG + Intronic
923448068 1:234091169-234091191 AGTTATTTCCAAGAAGGTGTAGG - Intronic
1069529962 10:69210271-69210293 CTTTACTCCCATGAAGGCAAAGG - Intergenic
1070424442 10:76271830-76271852 ATTAATTCACAAGAAGGCGAGGG - Intronic
1076049863 10:127323820-127323842 TGTTCTTCCCATGAAGGAGAAGG - Intronic
1076773421 10:132679537-132679559 TGTTATTCCCAAGTAGGAGGAGG + Intronic
1099996939 12:89788194-89788216 AGTTATGCCCATGAAGGCAAAGG - Intergenic
1106217763 13:27718416-27718438 CATTTTTCCCAAGAAGGCCAGGG - Intergenic
1117735612 14:58765606-58765628 AGCTATTTCCAGGAAGGCGAGGG + Intergenic
1121340072 14:93099851-93099873 CGTTGTTCCCAAGAAGGGAGTGG - Intronic
1122790531 14:104182447-104182469 GGTTGTTCCCGAGAAGCCGAGGG + Intergenic
1126447294 15:48762525-48762547 TGTTATTTCCAAGAAAGAGATGG - Exonic
1128199469 15:65792275-65792297 CGTCATTGCCAAGATGGCGCCGG - Intronic
1131469004 15:92679610-92679632 CCTTATTCACCAGAAGGGGAAGG + Intronic
1131614825 15:94005210-94005232 GTTTATTCCCAAAAAGGTGAAGG + Intergenic
1138290472 16:55842451-55842473 CATTATTCCCAAGGACGGGAAGG - Intergenic
1141473915 16:84259045-84259067 CCCTATTCCCAAGAAAGAGATGG - Intergenic
1145777622 17:27540404-27540426 AGATATTCCCAAGGAGGCCAGGG - Intronic
928437728 2:31266488-31266510 CGCTAATGCCAAGAAGGAGATGG + Exonic
937112576 2:119377900-119377922 GGTTGTTACCAAGAAGGGGATGG - Intergenic
937936270 2:127248123-127248145 CATTATGCCCAAGAAGAGGAAGG - Intergenic
941935053 2:170975480-170975502 TGTTTTTCCCAACAAGGAGATGG + Intergenic
943292782 2:186096228-186096250 CTTTATTCCAAATAAGGCAAGGG + Intergenic
958642822 3:96829561-96829583 AGTAATTCCCAAGAAGAGGAGGG - Intronic
963150950 3:142044850-142044872 GGTTATTCCCAAGAACACGGAGG - Intronic
969526885 4:7708393-7708415 CGTTATTCCCAAGAAGGCGAGGG + Intronic
969713980 4:8859760-8859782 CGGTATTCCCACGATGACGAAGG - Intronic
970315552 4:14825547-14825569 CCTCATTCCCAGGAAGGCAATGG - Intergenic
983760222 4:171395988-171396010 TGTTTTTCCCAAGAAGTCGCAGG - Intergenic
986964578 5:13254918-13254940 CCATTTTCCCAAGAAGGCTATGG + Intergenic
1008951697 6:57167745-57167767 CATCATTCCCAAGGAGGAGATGG + Intronic
1011169750 6:84492367-84492389 TGCTATTCCCAAGAAGGTCAAGG + Intergenic
1029147595 7:98457936-98457958 TCTTCTTCCCAAGAAGGCGCTGG + Intergenic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1031440415 7:121787899-121787921 TGTTATTCCCAAGAAGTTGAAGG - Intergenic
1037080965 8:14785787-14785809 CTTTATTCCTAAGCAGGCGTAGG + Intronic
1051305533 9:15704866-15704888 CATTAGTCACAAGAAGGCCAGGG - Intronic
1056567947 9:87791429-87791451 GCTTATTCCCAAGTAGGTGAGGG + Intergenic
1057599797 9:96448454-96448476 TGTTATTCCCAAGGAGGACAGGG - Intergenic
1186452505 X:9685235-9685257 CATTATTCCCCAGAAGTCAAGGG - Intronic
1188938033 X:36201469-36201491 CGTCAGTCCCAGGAGGGCGATGG - Intergenic
1192124432 X:68488747-68488769 CGTCCTTCTCAAGAAAGCGATGG + Intergenic