ID: 969527928

View in Genome Browser
Species Human (GRCh38)
Location 4:7713476-7713498
Sequence GGTCCCTGTACCCACCGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969527928_969527934 18 Left 969527928 4:7713476-7713498 CCATCACGGTGGGTACAGGGACC 0: 1
1: 0
2: 1
3: 11
4: 138
Right 969527934 4:7713517-7713539 GGCTCAACTTGAATTCAGCATGG 0: 1
1: 0
2: 0
3: 15
4: 117
969527928_969527935 19 Left 969527928 4:7713476-7713498 CCATCACGGTGGGTACAGGGACC 0: 1
1: 0
2: 1
3: 11
4: 138
Right 969527935 4:7713518-7713540 GCTCAACTTGAATTCAGCATGGG 0: 1
1: 0
2: 1
3: 8
4: 97
969527928_969527931 -3 Left 969527928 4:7713476-7713498 CCATCACGGTGGGTACAGGGACC 0: 1
1: 0
2: 1
3: 11
4: 138
Right 969527931 4:7713496-7713518 ACCCTCTCAAAGGAGAGATTGGG 0: 1
1: 0
2: 1
3: 16
4: 154
969527928_969527936 26 Left 969527928 4:7713476-7713498 CCATCACGGTGGGTACAGGGACC 0: 1
1: 0
2: 1
3: 11
4: 138
Right 969527936 4:7713525-7713547 TTGAATTCAGCATGGGCAAATGG No data
969527928_969527937 27 Left 969527928 4:7713476-7713498 CCATCACGGTGGGTACAGGGACC 0: 1
1: 0
2: 1
3: 11
4: 138
Right 969527937 4:7713526-7713548 TGAATTCAGCATGGGCAAATGGG 0: 1
1: 1
2: 14
3: 85
4: 451
969527928_969527930 -4 Left 969527928 4:7713476-7713498 CCATCACGGTGGGTACAGGGACC 0: 1
1: 0
2: 1
3: 11
4: 138
Right 969527930 4:7713495-7713517 GACCCTCTCAAAGGAGAGATTGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969527928 Original CRISPR GGTCCCTGTACCCACCGTGA TGG (reversed) Intronic
900804025 1:4755699-4755721 GGTCCCTGTACTTGCTGTGATGG - Intronic
901221078 1:7584184-7584206 GGTCCCTGAACCTACAGTCATGG - Intronic
901380649 1:8871600-8871622 GGTTCCTGTCCTAACCGTGAAGG + Intronic
901781812 1:11599206-11599228 GTGCGCTGTACCCACCCTGAGGG - Intergenic
909611070 1:77552333-77552355 AGTCCCTATACCCATCGTAATGG + Intronic
918601951 1:186375025-186375047 GGTCCCTGGCCCCACCGACATGG - Exonic
922784640 1:228276858-228276880 TGTCCCTGTCCCCATCCTGAAGG + Intronic
924653426 1:245950367-245950389 GGTCCCTGTACCTATCGCCATGG + Intronic
1071040671 10:81305971-81305993 GGTACATGTACACACCGTGCAGG + Intergenic
1073539246 10:104305033-104305055 GGCCCCGATACCTACCGTGATGG - Intergenic
1074778339 10:116782925-116782947 GCTTCCAGTACCCTCCGTGAGGG - Intergenic
1075121622 10:119668832-119668854 GGTCCCTGTGCCTATCTTGATGG - Intronic
1076103157 10:127798455-127798477 CGCCCCTGTATCCACGGTGAAGG - Intergenic
1076244275 10:128933949-128933971 GGTCCCTGTACCTATGGAGATGG + Intergenic
1076483667 10:130801883-130801905 GGTCCCTGCACAGACCGTGCTGG + Intergenic
1076614459 10:131746693-131746715 GGGCCATGTGCCCACCGTGGGGG + Intergenic
1077244340 11:1528848-1528870 GTTCCCTCTACCCACCCTGTGGG + Intergenic
1078649984 11:13181025-13181047 GGTACCTGTACACAACGTGCAGG - Intergenic
1079231177 11:18650012-18650034 GGTCCCTGCACACACAGTGCCGG - Intergenic
1083511444 11:63212761-63212783 GGTACATGTACACAACGTGAAGG - Intronic
1090945903 11:131429322-131429344 GGTCCTTGTGCACACTGTGAAGG - Intronic
1093019185 12:14187416-14187438 GGTCCCTGTAGCTATCGTGATGG - Intergenic
1093210210 12:16298970-16298992 GTTCCCTGTAACCACCGGGGAGG + Intergenic
1096882920 12:54687218-54687240 GGACCCTGGACCCACTCTGAAGG + Intergenic
1097328892 12:58311963-58311985 GGTCCCTATACCAATCATGATGG - Intergenic
1098194065 12:67980994-67981016 GTTCCCTGTACCCTCCTAGAAGG + Intergenic
1098598983 12:72307067-72307089 TGTCCCTATACCCACCTAGAAGG - Intronic
1099834723 12:87895110-87895132 GGTCCCTGTACCTATCATGATGG - Intergenic
1100989210 12:100234211-100234233 GGTCCCTGTACCTATTTTGATGG - Intronic
1101420582 12:104547467-104547489 GCTCCCTGCACCCACAGTCATGG - Intronic
1104048387 12:125180288-125180310 TTTTCCTGAACCCACCGTGATGG + Intergenic
1104912900 12:132248157-132248179 GGTCCCTGTGCTCAAGGTGAGGG + Intronic
1109593918 13:64524636-64524658 AGTCCCTATACCTATCGTGATGG + Intergenic
1112175432 13:97018775-97018797 GGGCCCTGTGCTCACCCTGAAGG + Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1114377558 14:22164603-22164625 GGTCTCTGTACCTATCATGATGG - Intergenic
1114676830 14:24446814-24446836 GGTACCTGTACCTATTGTGATGG + Intergenic
1118757784 14:68857779-68857801 GGTTCCTGTGGCCACCTTGAGGG - Intergenic
1121037180 14:90716051-90716073 GGTCCCTCTGCCTATCGTGACGG - Intronic
1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG + Intergenic
1126839559 15:52703800-52703822 GGTACATGTACACAACGTGAAGG - Intronic
1128483003 15:68055189-68055211 GGTCTCTGCACACACCATGATGG + Intronic
1130686216 15:86040035-86040057 GGTCCCGGTACCTATCATGATGG + Intergenic
1132526943 16:421606-421628 GGGCACTGTTCCCATCGTGAGGG - Intergenic
1133110591 16:3545838-3545860 GGTCCCAGAAGCCACCCTGAGGG + Intronic
1135054629 16:19220645-19220667 GGTCCCTGTACATATCATGATGG - Intronic
1135390716 16:22091087-22091109 GGTCCTTGTGCCCATCTTGATGG - Intergenic
1140954175 16:79847096-79847118 GGCTCCTGTAGCCACCGTGGAGG + Intergenic
1144566583 17:16364413-16364435 GGTTCCTATACCCATCTTGATGG - Intergenic
1145815390 17:27791654-27791676 GGTCCCTGTACCTATTGAGATGG + Intronic
1151571319 17:74927298-74927320 GATGCCTGTACCCAGCGTGCTGG + Intronic
1152559491 17:81070838-81070860 GGTCCTTGATCCCAGCGTGATGG + Intronic
1153134908 18:1905700-1905722 GGCCCCTGTACCAAACATGATGG - Intergenic
1153767049 18:8384915-8384937 GGTCCCTGCACCTATCGTGATGG - Intronic
1153944022 18:10003145-10003167 GGTCCCTATACCTATTGTGATGG + Intergenic
1157944768 18:51966937-51966959 GGTACATGTACACAACGTGAAGG + Intergenic
1161720212 19:5898115-5898137 GGTCCCTTCACCTCCCGTGAAGG - Intronic
1162250619 19:9440093-9440115 GGTCCCTATACCTAACGTGATGG - Intergenic
1162352351 19:10158400-10158422 GGTTCCTGTACCCACTGGGAGGG - Intronic
1165950912 19:39473514-39473536 GAACCCTGGACTCACCGTGACGG - Exonic
1166541665 19:43609847-43609869 GGTCCCTGTGACCACGGTGTGGG + Intronic
1168135941 19:54351999-54352021 GGTCCTGGTACCTACAGTGATGG + Exonic
1202649276 1_KI270706v1_random:165990-166012 TTTCCCTGTCCTCACCGTGATGG + Intergenic
926144344 2:10387476-10387498 TGTCCCTGTGCCCACCTAGATGG - Intronic
928245083 2:29619904-29619926 GGTGCCCATACCCACAGTGAGGG + Intronic
928675920 2:33651197-33651219 GGTCCCTGTACCTATCTTGATGG - Intergenic
930176290 2:48304626-48304648 GGTCCCTATACCTATCATGATGG + Intergenic
932263232 2:70344320-70344342 AGTTCCTGTCCCCACCCTGAAGG - Intergenic
935788367 2:106569408-106569430 CGTGCCTGTGCCCACCCTGAAGG + Intergenic
936781071 2:116033376-116033398 ACTCCCTGTACCCATCCTGATGG + Intergenic
939100637 2:137891109-137891131 GCTCCATATACCCACTGTGATGG - Intergenic
942368208 2:175252408-175252430 GGTACCTGCACACAACGTGAAGG + Intergenic
945067882 2:205962296-205962318 GGTCCCTGTACCTATCACGATGG + Intergenic
948384079 2:237570932-237570954 GGTCCATGTACCCACTGTCCAGG - Intergenic
1169830362 20:9818416-9818438 GGTCCCTCTACCTATCATGATGG + Intronic
1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG + Intronic
1171452387 20:25245410-25245432 GGTCCCTGTACCTATCATGATGG - Intergenic
1173447674 20:43134624-43134646 AGTCCCTATACCCATCATGATGG + Intronic
1174168694 20:48603349-48603371 GGGCCCTGTTCCCACCCTCAGGG - Intergenic
1175304241 20:57965098-57965120 GGTCCCTGTACCCCCTGGGATGG - Intergenic
1176602543 21:8806556-8806578 TTTCCCTGTCCTCACCGTGATGG - Intergenic
1178609911 21:34071997-34072019 GATCCCTGTACCCATCGCGTTGG - Intergenic
1178664127 21:34531967-34531989 GGTCTCTATACCCATCGTGGTGG - Intronic
1179117813 21:38510019-38510041 CGTCCCTGTGCCCACAGCGAAGG - Intronic
1180344829 22:11698109-11698131 TTTCCCTGTCCTCACCGTGATGG - Intergenic
1180352655 22:11817103-11817125 TTTCCCTGTCCTCACCGTGATGG - Intergenic
1180352894 22:11818743-11818765 TTTCCCTGTCCTCACCGTGATGG + Intergenic
1180385345 22:12173614-12173636 TTTCCCTGTCCTCACCGTGATGG - Intergenic
1180385597 22:12175254-12175276 TTTCCCTGTCCTCACCGTGATGG + Intergenic
1181108291 22:20587377-20587399 GGGCCGTGTCCCCACTGTGAAGG + Exonic
1181549337 22:23628015-23628037 GGCCCCTCTACCCACCCTGTGGG + Intronic
1181646738 22:24235423-24235445 GGTCCCTGCACCCACCCCGTGGG + Intronic
1184910725 22:47532221-47532243 GGCCCCTATACCTATCGTGATGG - Intergenic
950475249 3:13210769-13210791 TCTCCCTGTGCCCACCCTGATGG + Intergenic
951864784 3:27295491-27295513 GGTCCCTGTACTGACTATGAGGG - Intronic
954698629 3:52440435-52440457 GGGCCCTTTGCCCACCGAGATGG - Exonic
955094718 3:55785897-55785919 AGTCCCTGTAACCACCGAGTTGG - Intronic
964344714 3:155744475-155744497 GGTCCCGGGACCCCGCGTGAGGG + Intronic
968521600 4:1036902-1036924 GGTCCCTGCACCCCCCCTGCTGG + Intergenic
969527928 4:7713476-7713498 GGTCCCTGTACCCACCGTGATGG - Intronic
973376092 4:49287439-49287461 TTTCCCTGTCCTCACCGTGATGG - Intergenic
973377936 4:49299757-49299779 TTTCCCTGTCCTCACCGTGATGG - Intergenic
973378879 4:49306037-49306059 TTTCCCTGTCCTCACCGTGATGG - Intergenic
973379339 4:49309617-49309639 TTTCCCTGTCCTCACCGTGATGG + Intergenic
973380211 4:49315613-49315635 TTTCCCTGTCCTCACCGTGATGG + Intergenic
973381131 4:49321779-49321801 TTTCCCTGTCCTCACCGTGATGG + Intergenic
973385753 4:49513436-49513458 TTTCCCTGTCCTCACCGTGATGG + Intergenic
977993624 4:103476075-103476097 GGTCCCTGTACTTACCATGATGG - Intergenic
990276419 5:54201735-54201757 GGTCCCTATACCTATGGTGATGG + Intronic
991257762 5:64634019-64634041 GGTCCCTGTACCTACCATGATGG - Intergenic
991915519 5:71600997-71601019 GGTCCCTGTGCCCCCCTTTAAGG + Intronic
999253277 5:150195175-150195197 GCTCCCTCTGCCCACCGTGCAGG - Intronic
1002206783 5:177568501-177568523 GGCCCCTGTCCTCACCGTGTGGG + Intergenic
1005215001 6:23515462-23515484 GGTCCCTATACCTATCATGATGG + Intergenic
1006297901 6:33178181-33178203 GGTCCCTGCATTCACGGTGAGGG + Exonic
1006844168 6:37051113-37051135 GGACCCTGTCCCCACAGTGGTGG - Intergenic
1007309564 6:40934692-40934714 GCCCCCTGCACACACCGTGAAGG - Intergenic
1008308368 6:49933848-49933870 CGTCCCCGCACTCACCGTGAAGG + Intergenic
1010621250 6:78078545-78078567 GGTACATGTACCCAACGTGCAGG + Intergenic
1012497064 6:99844976-99844998 GGTCCCTATACCTATCGTGCTGG + Intergenic
1013609998 6:111785702-111785724 GGTACATGTACACAACGTGAAGG + Intronic
1016443488 6:144108995-144109017 CATCCCTGTACCTACCTTGATGG - Intergenic
1017284438 6:152658199-152658221 GGGCCCTTAACCCACTGTGATGG - Intergenic
1018612858 6:165661481-165661503 GGTCCCTGTAGCCGGGGTGAGGG - Intronic
1026874498 7:73871584-73871606 TGTCCCTGTTCCCGCCATGAGGG + Intergenic
1028517822 7:91697823-91697845 GGTCCCTGGAAGCACCATGAAGG - Intronic
1029490257 7:100866805-100866827 GGTGGCTGTCCCCACCGTGCAGG + Exonic
1035597162 8:867109-867131 GGTCACTTTGCCCACGGTGACGG - Intergenic
1036396968 8:8377957-8377979 GGTCCCTCTACCTCCCCTGATGG - Exonic
1039626671 8:39061341-39061363 GGTCCCTGAACCCACCTTGTGGG - Intronic
1040532823 8:48279510-48279532 GGTCCCTGTTACCAACCTGAAGG + Intergenic
1046830572 8:118741467-118741489 GGAGCATGTACCCACCCTGATGG + Intergenic
1049583942 8:143424436-143424458 GGTCCTTGGAGCCACCGTGAGGG - Intronic
1049804098 8:144531128-144531150 CGTCTGTGTAGCCACCGTGAGGG + Intronic
1051437958 9:17053047-17053069 TGTCTCTTTACCCACCGAGAGGG + Intergenic
1057915761 9:99053908-99053930 GTTCCCTTTCCCCACCTTGATGG - Intronic
1060140871 9:121208897-121208919 GGTCCCTGTCCTCACCTTGGTGG - Intronic
1203698910 Un_GL000214v1:119666-119688 TTTCCCTGTCCTCACCGTGATGG - Intergenic
1203699867 Un_GL000214v1:125964-125986 TTTCCCTGTCCTCACCGTGATGG - Intergenic
1203700768 Un_GL000214v1:131956-131978 TTTCCCTGTCCTCACCGTGATGG - Intergenic
1203731796 Un_GL000216v2:98543-98565 GGTCCCTGGAGCCCCCCTGACGG - Intergenic
1203479601 Un_GL000224v1:554-576 TTTCCCTGTCCTCACCGTGATGG - Intergenic
1203480568 Un_GL000224v1:6850-6872 TTTCCCTGTCCTCACCGTGATGG - Intergenic
1203549089 Un_KI270743v1:153351-153373 TTTCCCTGTCCTCACCGTGATGG - Intergenic
1203549361 Un_KI270743v1:155198-155220 TTTCCCTGTCCTCACCGTGATGG + Intergenic
1203550320 Un_KI270743v1:161510-161532 TTTCCCTGTCCTCACCGTGATGG + Intergenic
1203569207 Un_KI270744v1:115912-115934 TTTCCCTGTCCTCACCGTGATGG - Intergenic
1203570156 Un_KI270744v1:122201-122223 TTTCCCTGTCCTCACCGTGATGG - Intergenic
1189995415 X:46632691-46632713 GGTCCCTATTCCAATCGTGATGG + Intronic
1190464012 X:50707929-50707951 GGGCCCTGGACCCACCCTGCAGG + Intronic
1201579465 Y:15495622-15495644 GGTCCCTGCACCTGTCGTGATGG - Intergenic