ID: 969529409

View in Genome Browser
Species Human (GRCh38)
Location 4:7722415-7722437
Sequence TTATGGGGTCCCTAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969529409_969529420 25 Left 969529409 4:7722415-7722437 CCTCCTTCCTAGGGACCCCATAA 0: 1
1: 0
2: 0
3: 16
4: 197
Right 969529420 4:7722463-7722485 GAACCCACACAAGTCTCCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 72
969529409_969529416 -4 Left 969529409 4:7722415-7722437 CCTCCTTCCTAGGGACCCCATAA 0: 1
1: 0
2: 0
3: 16
4: 197
Right 969529416 4:7722434-7722456 ATAACAAATTATCTCATGCCGGG 0: 1
1: 0
2: 2
3: 27
4: 372
969529409_969529417 -1 Left 969529409 4:7722415-7722437 CCTCCTTCCTAGGGACCCCATAA 0: 1
1: 0
2: 0
3: 16
4: 197
Right 969529417 4:7722437-7722459 ACAAATTATCTCATGCCGGGTGG 0: 1
1: 0
2: 0
3: 9
4: 138
969529409_969529415 -5 Left 969529409 4:7722415-7722437 CCTCCTTCCTAGGGACCCCATAA 0: 1
1: 0
2: 0
3: 16
4: 197
Right 969529415 4:7722433-7722455 CATAACAAATTATCTCATGCCGG 0: 1
1: 0
2: 1
3: 59
4: 511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969529409 Original CRISPR TTATGGGGTCCCTAGGAAGG AGG (reversed) Intronic
901530156 1:9847904-9847926 TGTTGGGGTGCCTAGGATGGCGG + Intergenic
902229435 1:15018507-15018529 TCATGGGGTCCCCTGGAAGAGGG + Intronic
903756566 1:25666138-25666160 TTACTGGGTTCATAGGAAGGAGG + Intronic
905977368 1:42186484-42186506 TCATCGGGACCCTAGAAAGGAGG + Intronic
909054252 1:70804047-70804069 TTCTGGGGTCTGGAGGAAGGTGG - Intergenic
909066276 1:70939390-70939412 TTCTGGGGTCTGGAGGAAGGTGG + Intronic
909534815 1:76724839-76724861 TTATGGGGGCAATAGGGAGGTGG - Intergenic
909810267 1:79924377-79924399 TTCTGGGGTCTCGAGGATGGTGG - Intergenic
911267647 1:95762116-95762138 TTCTGGGGTCTGGAGGAAGGTGG + Intergenic
912006165 1:104903818-104903840 TTCTGGGGTCTATAGGACGGTGG + Intergenic
915309698 1:155000972-155000994 TTAGGGGGGCTATAGGAAGGAGG - Intergenic
915557818 1:156670029-156670051 TCCTGGGGTCCCTGGGGAGGTGG - Exonic
915665411 1:157439919-157439941 TTATGGGGTCTGTAGGATGGGGG + Intergenic
920802087 1:209198982-209199004 TGATGAGATTCCTAGGAAGGGGG - Intergenic
922416223 1:225425708-225425730 TTTTGGGGGGCCTAGGGAGGAGG - Intronic
922979054 1:229809549-229809571 TGATGAGATCCCTAGGGAGGGGG + Intergenic
923599423 1:235388973-235388995 TTCTGTTGACCCTAGGAAGGGGG + Intronic
924152653 1:241144481-241144503 TTATGGCTTCCCAAGGAAGGGGG - Intronic
924904453 1:248436981-248437003 TTATGAGGTACCTAACAAGGTGG - Intergenic
1065158811 10:22897528-22897550 TGATGTGATTCCTAGGAAGGAGG + Intergenic
1069492667 10:68874738-68874760 TTGTAGGGTGCCAAGGAAGGAGG - Intronic
1070753904 10:78979891-78979913 CTATGGGGTCCCTATGGATGGGG - Intergenic
1072277005 10:93833421-93833443 TTCTGGGGTCTGGAGGAAGGTGG + Intergenic
1072880521 10:99222698-99222720 TTATAGTTTCTCTAGGAAGGAGG - Intronic
1073566661 10:104541155-104541177 TAATGGGGGCCATAGGAAGTAGG - Intergenic
1073880336 10:107973531-107973553 TTCTGGGGTCGGGAGGAAGGTGG - Intergenic
1073990930 10:109261514-109261536 TTCTGGGGTCTGTAGGATGGTGG + Intergenic
1074242169 10:111650313-111650335 TTCTGGGGTCTGTAGGATGGTGG - Intergenic
1074579834 10:114708446-114708468 TTTTGGGGTCCCAGGGAAGGAGG - Intergenic
1078426162 11:11253032-11253054 TTATGGGTTCTCTAGGAATCTGG - Intergenic
1080041026 11:27759559-27759581 TTTTGGGGTCACTAGGCAGTAGG + Intergenic
1080477420 11:32608598-32608620 TTATGGGGTCTAGAGGATGGTGG + Intronic
1081167067 11:39819959-39819981 TTATGGGGTCTGGAGGATGGTGG + Intergenic
1082255308 11:50027451-50027473 TTCTGGGGTCCGGAGGATGGTGG - Intergenic
1084445945 11:69203889-69203911 TTTTGGGGTCCCTGGGAAGCTGG + Intergenic
1088682105 11:112252262-112252284 TTGTGGGTTCCCTAGAAAAGAGG - Intronic
1092893874 12:12994663-12994685 TTTAGGGGTTCCTAGAAAGGAGG - Intronic
1096774521 12:53955863-53955885 TAATGGGGTCTGTGGGAAGGTGG - Intronic
1100159707 12:91843846-91843868 TTCTGGGGTCAGTAGGATGGTGG - Intergenic
1101434504 12:104653588-104653610 TTATGGGGTGGCTATGATGGTGG - Intronic
1103732370 12:123036436-123036458 TTATGGGATGCCAAGGCAGGTGG + Intronic
1104761715 12:131300814-131300836 TCCTGGAGTCCCTGGGAAGGAGG - Intergenic
1104818058 12:131659971-131659993 TCCTGGAGTCCCTGGGAAGGAGG + Intergenic
1106172195 13:27297707-27297729 TGATGGGATCCCTAGGCAGGAGG - Intergenic
1106847066 13:33748114-33748136 TTTTGGGGTCCTAATGAAGGAGG + Intergenic
1107234581 13:38153284-38153306 TTCTGGGGTCTGTAGGATGGTGG + Intergenic
1109297481 13:60552542-60552564 TTCTGGGGTCCAGAGGATGGTGG + Intronic
1110309078 13:74025893-74025915 TTATGGGGACTCTAGAGAGGTGG - Intronic
1116055946 14:39863946-39863968 TTATGTGGTTCCTAAAAAGGTGG + Intergenic
1117262744 14:54053424-54053446 GGGTGGGGTCCCTAGGCAGGGGG - Intergenic
1118524246 14:66621932-66621954 TTATGGGGTCTGGAGGATGGTGG + Intronic
1120216329 14:81684091-81684113 TTTTGGTGCTCCTAGGAAGGTGG + Intergenic
1122416292 14:101551208-101551230 GTAGGGGGTCCCTTGGAAGCAGG - Intergenic
1126116535 15:45212833-45212855 TTTTGGGGCCCTTAGGAAAGGGG + Intergenic
1127041386 15:54980942-54980964 TAATGGGGTCCCAAGGAATGGGG - Intergenic
1127051060 15:55084791-55084813 TTCTGGGGTCTGTAGGACGGTGG - Intergenic
1127716822 15:61656346-61656368 TCCTGGGGTCCCTAAGAAGTAGG + Intergenic
1130102460 15:80904280-80904302 TTTTGGGATCCCCAGGCAGGAGG + Intronic
1130210696 15:81919084-81919106 TTATGGGGTCTGGAGGATGGTGG - Intergenic
1131124481 15:89847131-89847153 TTTTGGGAGGCCTAGGAAGGAGG + Intronic
1135056243 16:19234080-19234102 CTATGGGGGGCCTAGGCAGGAGG + Intronic
1137711477 16:50569847-50569869 TGATGGGGTTCCTTGGATGGAGG + Intronic
1145900093 17:28485041-28485063 TTATGGGCTCCTGAGGACGGGGG - Intronic
1148212729 17:45818030-45818052 TTCTGGAGCCCCTAGGAAGGAGG + Intronic
1156202354 18:34848652-34848674 ATATGAAGTCCCAAGGAAGGGGG + Intronic
1156877005 18:42026678-42026700 TTTTGGGAGGCCTAGGAAGGAGG - Intronic
1157663601 18:49466960-49466982 TTTTGGGGTGCCGAGGCAGGCGG - Intergenic
1157995466 18:52549479-52549501 TTGTTGGGTCTTTAGGAAGGAGG - Intronic
1158941458 18:62409172-62409194 TCATGTGGTCCCTTCGAAGGTGG + Intergenic
1159640673 18:70859735-70859757 TTCTGGGGTCCAGAGGATGGTGG - Intergenic
1159770092 18:72538904-72538926 TTCTGGCTTCCCCAGGAAGGAGG + Intronic
1159833172 18:73303396-73303418 TTTTGGGAGCCCAAGGAAGGAGG - Intergenic
1160244117 18:77143594-77143616 TTATGGGGTCTGGAGGATGGTGG - Intergenic
1161934789 19:7364939-7364961 TGATGGGCTGCCCAGGAAGGGGG + Intronic
1162122387 19:8479417-8479439 TTATGAAGGCCCTAGAAAGGTGG + Intronic
1162916803 19:13878855-13878877 TTTTGGGATGCCTAGGCAGGAGG - Intronic
1165454729 19:35903936-35903958 GTATAGTGTCCCTAGGGAGGGGG + Intronic
1167873071 19:52389652-52389674 TTCTGGGGTCTATAGGAGGGTGG + Intergenic
1168297892 19:55386558-55386580 TTATTGGGCTCCTGGGAAGGAGG - Exonic
925155323 2:1644557-1644579 CTCTGGAGTCCCTAAGAAGGTGG + Intronic
925246609 2:2389048-2389070 TTCTGGGGTCTGTAGGAAGATGG + Intergenic
926694673 2:15763022-15763044 TATTGGGGTCCCAAGGAAGAAGG + Intergenic
926728401 2:16015609-16015631 GTATGGGGTACCAAGGCAGGGGG - Intergenic
927055174 2:19360228-19360250 TTCTGGAATCTCTAGGAAGGAGG - Intergenic
928466490 2:31527607-31527629 TTGGAGGGTCCCTGGGAAGGAGG - Intronic
928474667 2:31614542-31614564 TTCTGGGGTCCGTAGGACAGTGG + Intergenic
929058953 2:37903747-37903769 TGATGAGATCCCTAGGGAGGGGG + Intergenic
929920200 2:46166242-46166264 TCAGGTGGTCCCTAGGCAGGTGG - Intronic
930128448 2:47823510-47823532 CTTTGGGAGCCCTAGGAAGGTGG + Intronic
930514842 2:52393611-52393633 TTATGGGGTCTAGAGGATGGTGG + Intergenic
931300946 2:60977792-60977814 TTATGTGATCACTAGCAAGGTGG + Intronic
934059568 2:88281705-88281727 AGATGGGGTCCCTAGGAATGGGG - Intergenic
934548296 2:95237497-95237519 ATAGGGAGGCCCTAGGAAGGTGG - Intronic
934768299 2:96892824-96892846 TTATGGGGCCTCTAGAGAGGAGG - Intronic
937152927 2:119698243-119698265 TGATGAGATTCCTAGGAAGGGGG + Intergenic
938647311 2:133345050-133345072 TTAAGGGGCCCCTGGGGAGGAGG + Intronic
938948679 2:136237537-136237559 TTCTGTGGTCCCTGGGTAGGTGG - Intergenic
945593909 2:211768354-211768376 TTCTGGGGTCCAAAGGATGGTGG + Intronic
946028733 2:216688834-216688856 TTCTGGGATGCTTAGGAAGGAGG - Intronic
946478099 2:220028446-220028468 ATATGGGGACCCAGGGAAGGAGG + Intergenic
946562453 2:220928094-220928116 TTCTGGGGTCCAGAGGATGGCGG + Intergenic
948251665 2:236534870-236534892 TTAGTGGGTCCCGCGGAAGGAGG - Intergenic
948863599 2:240764474-240764496 CTGTGGGGTCCCTGGGCAGGAGG - Intronic
1172907622 20:38380609-38380631 TGATGAGATTCCTAGGAAGGGGG + Intergenic
1172986607 20:38996579-38996601 ATATGGAGTCTCTAGTAAGGAGG + Intronic
1177767375 21:25473973-25473995 TTCTGGGGTCTGTAGGATGGTGG - Intergenic
1180915100 22:19480223-19480245 TTCTGCGGACCCTAGGAGGGCGG + Intronic
1181965181 22:26651463-26651485 TTATGGAGTCAGTAGCAAGGTGG - Intergenic
1184451165 22:44583732-44583754 TTCAAGGGTCTCTAGGAAGGAGG - Intergenic
952480190 3:33753574-33753596 TTCTGGGGTCTGTAGGATGGTGG + Intergenic
952504492 3:33995667-33995689 TTCTGGGGTCTGTAGGATGGTGG + Intergenic
953061326 3:39430505-39430527 TTAGGGGGTGCCTATGAGGGTGG + Intergenic
953870863 3:46626723-46626745 TAATGGGTTCCCTAGGGATGTGG - Intergenic
954123863 3:48517352-48517374 TTCTGGGGTCCCTGGGAATGTGG - Intergenic
954913788 3:54131733-54131755 TTATTATGTCCCTAGGGAGGTGG + Intronic
955970675 3:64435607-64435629 TTCTGGGGTCTGGAGGAAGGTGG - Intronic
956344851 3:68267050-68267072 TAATGCGTTCCCTAGGGAGGAGG - Intronic
957115274 3:76016077-76016099 ATATGGGGTACCTAGAAATGAGG + Intronic
959104641 3:102051921-102051943 TTCTGGGGTCTGGAGGAAGGTGG - Intergenic
959695648 3:109246360-109246382 TTCTGGGGTCTGGAGGAAGGTGG + Intergenic
960541995 3:118871613-118871635 TTCTGGGGTCTATAGGATGGTGG - Intergenic
961781967 3:129325605-129325627 TTGTGGGGCCCCTAGGTGGGTGG - Intergenic
963572553 3:147015958-147015980 TTCTGGGGTCTGGAGGAAGGTGG - Intergenic
963996550 3:151716713-151716735 TTATGGGGTCTGGAGGATGGTGG + Intergenic
965052041 3:163663445-163663467 TTCTGGGGTCGGTAGGATGGTGG - Intergenic
965067799 3:163874879-163874901 TTCTGGGGTCTGTAGGACGGTGG - Intergenic
965608210 3:170517749-170517771 TAATGGAATCCCTAGGGAGGAGG - Intronic
966241308 3:177757741-177757763 TTATGGGGTCTGGAGGATGGTGG + Intergenic
967154957 3:186683743-186683765 TTCTGGGGTCTTTAGGATGGTGG + Intergenic
969529409 4:7722415-7722437 TTATGGGGTCCCTAGGAAGGAGG - Intronic
971703653 4:30012550-30012572 TTCTTGGGTCCCTGGGAAGCAGG + Intergenic
972063472 4:34910324-34910346 TTCTGGGGTCCGGAGGATGGTGG - Intergenic
974553909 4:63418481-63418503 ATAGTGGTTCCCTAGGAAGGGGG + Intergenic
975964264 4:79950980-79951002 TCATGGGGGCCCTAACAAGGTGG + Intronic
978265644 4:106821396-106821418 TTCTGGGGTCTGTAGGATGGTGG - Intergenic
981281639 4:142966033-142966055 TTATGGGGTCTGGAGGATGGTGG + Intergenic
981820335 4:148880088-148880110 TTCTGGGGTCTGGAGGAAGGTGG + Intergenic
981893211 4:149764283-149764305 TGATGAGATCCCTAGGGAGGGGG - Intergenic
982076045 4:151738062-151738084 TTCTGGGGTCTGGAGGAAGGTGG - Intronic
983431754 4:167659696-167659718 TTCTGGGGTCCAGAGGATGGTGG + Intergenic
986634518 5:9808166-9808188 TTATGTAGTCTCTAAGAAGGTGG - Intergenic
987498962 5:18681522-18681544 TTCTGGGGTCTGTAGGACGGTGG - Intergenic
990741017 5:58912888-58912910 TGATGAGATTCCTAGGAAGGAGG - Intergenic
993146163 5:84096214-84096236 TTTTGGGGTCTCTAGGATGGTGG - Intronic
993828198 5:92720027-92720049 ATATGAGATCCCAAGGAAGGGGG - Intergenic
995271801 5:110228160-110228182 TTCTGGGGCCCCTTGGAAGCTGG - Intergenic
996094511 5:119384161-119384183 TTACGGCAACCCTAGGAAGGAGG - Intronic
997056637 5:130451933-130451955 TTCTGGGGTCTGTAGGACGGTGG + Intergenic
997133283 5:131298675-131298697 TTATGGGGTACCAAAGATGGTGG - Intronic
998889390 5:146729961-146729983 TTATGGGGTCTAGAGGATGGTGG - Intronic
999503507 5:152170539-152170561 TTATGGCGTCCCTGGGCAGGAGG - Intergenic
1000434042 5:161185879-161185901 TTGTAGGGTCAATAGGAAGGAGG + Intergenic
1001323621 5:170703145-170703167 TTTTGGGGTCCCAAGCAATGTGG - Intronic
1004830808 6:19475126-19475148 TTCTGGGGTCTGTAGGACGGTGG + Intergenic
1006303466 6:33206191-33206213 TAGTGGGGTCCCTGGGAAGGGGG + Intronic
1006684131 6:35818191-35818213 TTAGGAGGTGGCTAGGAAGGAGG + Intronic
1007250406 6:40491252-40491274 TCGTGGGGTCCCAAGGAAAGAGG - Intronic
1008087433 6:47259616-47259638 TTTTGGGAAGCCTAGGAAGGTGG - Intronic
1009616117 6:66009594-66009616 TTCTTGGGTCCCTAGGCAGCTGG + Intergenic
1010061276 6:71625674-71625696 TTCTGGGGTCTGTAGGATGGTGG - Intergenic
1010865767 6:80975190-80975212 TTCTGGGGTCTGTAGGATGGTGG - Intergenic
1010920338 6:81673011-81673033 TTCTGGGGTCTGGAGGAAGGTGG + Intronic
1011630364 6:89317227-89317249 TTGTGAGATCCCTAGGTAGGGGG + Intergenic
1011751011 6:90454685-90454707 CTTTGGGGTGCCTAGGAGGGTGG + Intergenic
1012700489 6:102451192-102451214 TTATGGGGTCTGGAGGATGGTGG + Intergenic
1013935203 6:115586160-115586182 TTATGGGGTCTGGAGGATGGTGG + Intergenic
1014247443 6:119082817-119082839 TTATGGGATCTGTAGGATGGTGG + Intronic
1014418472 6:121212702-121212724 TTTTGGGGGCCCGAGGCAGGTGG - Intronic
1014691718 6:124570817-124570839 TTATGGGGTCTGGAGGATGGTGG - Intronic
1018575738 6:165258567-165258589 TTCTGGGGTCTGGAGGAAGGTGG + Intergenic
1020631807 7:10649272-10649294 TTCTGGGGTCTGGAGGAAGGTGG + Intergenic
1021651474 7:22837597-22837619 TTTTGGGGTCATAAGGAAGGTGG - Intergenic
1023259329 7:38342389-38342411 TTCTCGGGTCCCTGTGAAGGAGG + Intergenic
1024004894 7:45217892-45217914 GCATGGGGTCCCTTGGAAGGTGG + Intergenic
1029818436 7:103121446-103121468 TTCTGGGGTAAGTAGGAAGGTGG - Intronic
1030865055 7:114691659-114691681 TTATGAGGTCCCTTGGTTGGGGG - Exonic
1031283952 7:119841410-119841432 TTATGGGGTCTGGAGGATGGTGG - Intergenic
1031792019 7:126118341-126118363 TTCTGGGGTCCGGAGGATGGTGG - Intergenic
1034410676 7:150940318-150940340 TTTTGGGGGCCCGAGGCAGGTGG - Intergenic
1034573085 7:151972944-151972966 TTCTGGGGTCTGAAGGAAGGTGG - Intronic
1040696153 8:50001379-50001401 TTATGGTGAGCCTAGGAAGGTGG + Intronic
1040835932 8:51731525-51731547 TTTTGGGGTCCGGAGGACGGTGG + Intronic
1042057953 8:64786667-64786689 TTATGGGGTCTGGAGGATGGTGG + Intronic
1042633982 8:70852833-70852855 TTCTGGGGTCCATTGGCAGGTGG + Intergenic
1046159369 8:110339996-110340018 TTATGGAGTGCTTAGGAAGAAGG + Intergenic
1047149190 8:122241497-122241519 TTATGGGGTCTGGAGGATGGTGG - Intergenic
1048498424 8:134955018-134955040 TTTTGGGGTGCCTAGGTGGGTGG + Intergenic
1053625663 9:39868025-39868047 TTCTGGGGTCCAGAGGACGGTGG - Intergenic
1053893461 9:42719155-42719177 TTCTGGGGTCCGGAGGACGGTGG - Intergenic
1054218225 9:62382676-62382698 TTCTGGGGTCCAGAGGACGGTGG + Intergenic
1055499073 9:76885446-76885468 TTAGTGGGTGCCTAGGAATGGGG - Intronic
1057317141 9:93976858-93976880 TTATGGTGGCCCTAGGAAACTGG + Intergenic
1058149953 9:101452917-101452939 TTATGGGGTCTGGAGGATGGTGG - Intergenic
1058323119 9:103658732-103658754 TTCTGGGGTCTGGAGGAAGGTGG - Intergenic
1059911994 9:119054908-119054930 TTATGAGTTTCCTGGGAAGGGGG + Intergenic
1061538706 9:131265847-131265869 CTTTGGGGTCCCTAGGAGGATGG - Intronic
1061884388 9:133584245-133584267 TCCTGGGGTCCCCAGGGAGGAGG - Intronic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1186673685 X:11793584-11793606 TGATGAGATCCCTAGGGAGGCGG - Intergenic
1187663175 X:21573330-21573352 TTCTGGGGTCTGTAGGATGGTGG + Intronic
1188333740 X:28902405-28902427 TTCTGGGTTCCCTAGGAAGTAGG - Intronic
1191923190 X:66279127-66279149 TTCTGGGGTCTCGAGGATGGTGG + Intergenic
1192525278 X:71837536-71837558 TTATGGGGTACCTAGGCACAAGG - Intergenic
1192580706 X:72278669-72278691 TTAGGTGGTACCCAGGAAGGGGG - Intronic
1193498426 X:82241088-82241110 TTCTGGGGTCTGGAGGAAGGTGG - Intergenic
1194144354 X:90244740-90244762 TTCTGGGGTCCAGAGGATGGTGG + Intergenic
1194224342 X:91237180-91237202 TGATGGGGTCCAAAGGAAAGAGG + Intergenic
1194300627 X:92181976-92181998 TTATGGGGTCTGGAGGATGGTGG - Intronic
1194843649 X:98776285-98776307 TTCTGGGGTCTGTAGGACGGTGG - Intergenic
1196555416 X:117079392-117079414 TGATGTGGTCCCCATGAAGGAGG + Intergenic
1197744247 X:129920359-129920381 CAATGGGTTCCCTAGGCAGGGGG - Intronic
1199060527 X:143350724-143350746 TTCTGGGGTCCGAAGGAAGGTGG + Intergenic
1199136235 X:144255906-144255928 TTATTGGGCCCCTGGGAAGCAGG - Intergenic
1200560804 Y:4700543-4700565 TGATGGGGTCCAAAGGAAAGAGG + Intergenic