ID: 969533144

View in Genome Browser
Species Human (GRCh38)
Location 4:7740519-7740541
Sequence CGGCCGTGTGTGGGGTCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 232}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969533144_969533157 19 Left 969533144 4:7740519-7740541 CCCCCAGACCCCACACACGGCCG 0: 1
1: 0
2: 1
3: 11
4: 232
Right 969533157 4:7740561-7740583 GCCCGAGGCCTGACTTCTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 141
969533144_969533162 29 Left 969533144 4:7740519-7740541 CCCCCAGACCCCACACACGGCCG 0: 1
1: 0
2: 1
3: 11
4: 232
Right 969533162 4:7740571-7740593 TGACTTCTCTGGGCTGAGGCTGG 0: 1
1: 0
2: 1
3: 34
4: 370
969533144_969533155 4 Left 969533144 4:7740519-7740541 CCCCCAGACCCCACACACGGCCG 0: 1
1: 0
2: 1
3: 11
4: 232
Right 969533155 4:7740546-7740568 ACGTGCTGTCGCTCAGCCCGAGG 0: 1
1: 0
2: 1
3: 0
4: 38
969533144_969533160 25 Left 969533144 4:7740519-7740541 CCCCCAGACCCCACACACGGCCG 0: 1
1: 0
2: 1
3: 11
4: 232
Right 969533160 4:7740567-7740589 GGCCTGACTTCTCTGGGCTGAGG 0: 1
1: 0
2: 2
3: 39
4: 380
969533144_969533156 18 Left 969533144 4:7740519-7740541 CCCCCAGACCCCACACACGGCCG 0: 1
1: 0
2: 1
3: 11
4: 232
Right 969533156 4:7740560-7740582 AGCCCGAGGCCTGACTTCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969533144 Original CRISPR CGGCCGTGTGTGGGGTCTGG GGG (reversed) Exonic
900083553 1:876095-876117 TGGGCGAGTGTGGGGTGTGGGGG - Intergenic
900083572 1:876162-876184 TGGGCGAGTGTGGGGTGTGGGGG - Intergenic
900780645 1:4615278-4615300 CAGCCAGGTGTGGGGTGTGGAGG - Intergenic
902884973 1:19398188-19398210 CCTCCGTGTGTGGGCCCTGGAGG - Intronic
904050855 1:27637388-27637410 GGGCCTTGTGTGGGTACTGGAGG - Intergenic
904466682 1:30712298-30712320 CAGCCCTATGTGGGGTCTGCAGG - Exonic
905375073 1:37514583-37514605 CGGCCGGGCTTGGGGCCTGGAGG + Intronic
905626030 1:39491276-39491298 CGGCCGCGTGTCGGGCCCGGTGG + Intergenic
906951526 1:50338012-50338034 AGGCTGTGTGTGGGGGCAGGGGG - Intergenic
907326544 1:53642022-53642044 CTGCCAAGTGTGGGGCCTGGAGG + Intronic
907435999 1:54448650-54448672 CGGCCGTGTGAGGTGTCAGTCGG + Intergenic
912754167 1:112310487-112310509 CGTTAGTGTGTGGGGTGTGGTGG - Intergenic
914332199 1:146682810-146682832 CTGCAGTGTGTGGGGCCTGCTGG + Intergenic
919927431 1:202199502-202199524 CGGCCGGGTGGGGCGGCTGGCGG + Intronic
922870289 1:228897322-228897344 AGGCCGTGTGTTGGGACTGGTGG - Intergenic
924937275 1:248782747-248782769 CAGCTGTGTGTGGGATCTGCTGG + Intergenic
924946115 1:248848006-248848028 CGCCCGTGTGTGTGCGCTGGTGG - Exonic
1065318464 10:24486660-24486682 AGGCCATGTGTGCTGTCTGGAGG - Intronic
1067037239 10:42929835-42929857 ATGCCCTGGGTGGGGTCTGGGGG - Intergenic
1067148040 10:43707803-43707825 CCGCACTGTGTGGGGACTGGCGG + Intergenic
1075778489 10:125002740-125002762 GGCCCTTGTGTGGGGTCTGCGGG - Intronic
1076071847 10:127496719-127496741 CGGCTGTTGCTGGGGTCTGGAGG - Intergenic
1076309435 10:129493692-129493714 AGGCCCAGTGTGGGATCTGGGGG + Intronic
1076993966 11:289420-289442 CGGGCGTGTGTGGAGGGTGGGGG - Intronic
1077029712 11:459539-459561 AGGCAGTGGCTGGGGTCTGGTGG + Intronic
1077048387 11:555950-555972 CGGCCGGGGCTGGGGTGTGGGGG - Intronic
1077327934 11:1971699-1971721 AGGCTGGGTGTGGGGTCTGTTGG - Intronic
1081611525 11:44565899-44565921 CGGCCGAGTGTGAGAACTGGGGG - Intronic
1083476019 11:62916174-62916196 GGGTCGTGCCTGGGGTCTGGAGG - Intronic
1084319200 11:68364042-68364064 CGGGCGTGGGTGGGGTGGGGGGG + Intronic
1085399308 11:76226041-76226063 TGGCCGTGCATGGGGCCTGGGGG - Intergenic
1086685642 11:89730455-89730477 CTGCCCTGTGCGGGGCCTGGAGG + Intergenic
1089596653 11:119584992-119585014 CGACCCTGGCTGGGGTCTGGTGG + Intergenic
1090285524 11:125496058-125496080 CTGCTGGGGGTGGGGTCTGGTGG - Intronic
1090359115 11:126160488-126160510 GGGCTGTGTTTGGAGTCTGGTGG + Intergenic
1202810914 11_KI270721v1_random:26879-26901 AGGCTGGGTGTGGGGTCTGTTGG - Intergenic
1091771323 12:3153052-3153074 TGCGCGTGTGTGGGGTGTGGTGG + Intronic
1097180311 12:57168008-57168030 CTGCCGTGTGTGGTGTCTCAGGG + Intronic
1097374136 12:58819870-58819892 CTGCTGTGTGTTGGGTCTGGAGG + Intergenic
1098887527 12:75975446-75975468 GGGCTGGGTGTGGGGTGTGGTGG - Intergenic
1100282393 12:93130399-93130421 TGGCAGTGGATGGGGTCTGGGGG - Intergenic
1102259562 12:111435951-111435973 AGGCCTGGAGTGGGGTCTGGTGG + Intronic
1102505340 12:113381087-113381109 AGGCCCTGTGCGGGGCCTGGGGG - Intronic
1104477416 12:129082086-129082108 GGGCCGTGTGTGGAGCCTGGTGG + Intronic
1104933408 12:132352252-132352274 CGGCCGTGCAGGGGGTGTGGGGG - Intergenic
1105849856 13:24323735-24323757 GGACCCTGTGTGGGATCTGGCGG + Intergenic
1112504568 13:99968437-99968459 CGCGCGTGCGTGGGGTCGGGGGG - Intronic
1115478571 14:33839743-33839765 CGGCCCTGCGTGGGGTTTCGTGG + Intergenic
1117635695 14:57740885-57740907 CGGCCGTGTGAGGTGTCAGTCGG - Intronic
1119893306 14:78199312-78199334 AGGCTGTGTGTTGGGTGTGGGGG - Intergenic
1121050593 14:90816715-90816737 AGGGCGGGTGAGGGGTCTGGTGG + Intergenic
1121412490 14:93757550-93757572 CGGCCTGGGGTGGGGGCTGGAGG + Intronic
1121587107 14:95069845-95069867 GGGCCCTGTGTGGGGGTTGGTGG - Intergenic
1122283141 14:100636021-100636043 GGGCTGTGGGTGGGGGCTGGAGG + Intergenic
1126572684 15:50168828-50168850 GGGCCGTTGGTGGGGTATGGTGG + Intronic
1127225139 15:56919535-56919557 CGGCCGCGGCTGGGGTCTCGAGG - Intronic
1127449590 15:59103887-59103909 GGGCCGTGTGTTGGGGCAGGAGG - Intergenic
1129385424 15:75193558-75193580 GGGCCGTGTGTGGAGTGTGGAGG - Intergenic
1129516689 15:76161532-76161554 AGTCCGGGTGTGGGGTGTGGTGG + Intronic
1129573414 15:76715165-76715187 CGGGGGTGTATGTGGTCTGGGGG - Intronic
1130730975 15:86491849-86491871 TGGCTGTGTGTGGGGGGTGGGGG + Intronic
1132726028 16:1338726-1338748 CGGCCATGTGTGAAGTCTGGCGG - Intronic
1132766843 16:1538734-1538756 GGGACGTGTGTGAGCTCTGGAGG - Intronic
1134070587 16:11257209-11257231 CGGCCGTGTGTGTGGTGGGAAGG - Intronic
1138318211 16:56088639-56088661 TGGCCGTTTGTGGGGTGTGAAGG + Intergenic
1138445445 16:57060356-57060378 AGGGCGTGTGTGTGGTGTGGGGG - Intronic
1138646824 16:58431693-58431715 AAGCCGTGTGTGGGGTAGGGAGG - Intergenic
1139211444 16:65081965-65081987 TGGCCCTGTGCAGGGTCTGGAGG - Intronic
1139527444 16:67525593-67525615 GTGCCGTGTGTGAGGACTGGGGG + Intronic
1139602059 16:67993048-67993070 CGGCATGGTGTGGGCTCTGGGGG + Exonic
1140001353 16:71028108-71028130 CTGCAGTGTGTGGGGCCTGCTGG - Intronic
1141178279 16:81734891-81734913 CGGGCGTGTGTGTGGTGGGGTGG + Intergenic
1141844128 16:86595594-86595616 TGGGCGTGTCAGGGGTCTGGCGG - Intergenic
1142010194 16:87709958-87709980 GCCCTGTGTGTGGGGTCTGGTGG - Intronic
1142179125 16:88658791-88658813 GGGCCGTGGGTGGGGGGTGGGGG - Intronic
1142266389 16:89065738-89065760 CTGCCGTGGGTAGGGTCTGGTGG + Intergenic
1142284429 16:89165946-89165968 GGGCCGTGGGTGGGATCTGCTGG + Intergenic
1142284450 16:89166028-89166050 CTGCCGTGGGTGGGATCTGCTGG + Intergenic
1142284470 16:89166106-89166128 GGGCCGTGGGTGGGATCTGCTGG + Intergenic
1142284491 16:89166188-89166210 CTGCCGTGGGTGGGATCTGCTGG + Intergenic
1142284512 16:89166270-89166292 CTGCCGTGGGTGGGATCTGCTGG + Intergenic
1142284569 16:89166508-89166530 GGGCCGTGGGTGGGATCTGCTGG + Intergenic
1142284590 16:89166590-89166612 CTGCCGTGGGTGGGATCTGCTGG + Intergenic
1142308576 16:89299373-89299395 CTGCCCTGTGTGGGGTGTGTGGG + Intronic
1142308601 16:89299463-89299485 CTGCCCTGTGTGGGGTGTGTGGG + Intronic
1142308712 16:89299850-89299872 CTGCCCTGTGTGGGGTGTGTGGG + Intronic
1142308744 16:89299967-89299989 CTGCCCTGTGTGGGGTGTGTGGG + Intronic
1142308809 16:89300192-89300214 CTGCCCTGTGTGGGGTGTGTGGG + Intronic
1143407346 17:6686178-6686200 GGGCTGTGTGTGTGGTCTTGTGG + Exonic
1146062400 17:29614146-29614168 AGGACGGGTGTGGGGGCTGGGGG - Exonic
1147428480 17:40357306-40357328 CGCATGTGTGTGGTGTCTGGGGG - Intronic
1147453681 17:40521327-40521349 AGGCTGTGTGTGGGGCGTGGCGG + Intergenic
1148842998 17:50511143-50511165 CTGCCTTGTATGGGGGCTGGGGG - Intronic
1149031988 17:52094138-52094160 CTGCGGGGTGTGGGGGCTGGGGG + Intronic
1149576995 17:57720946-57720968 TGGCCCTGTGTGTGGGCTGGGGG + Intergenic
1151681206 17:75623850-75623872 CGGCCGTGAGTGGGGACCGGTGG + Intergenic
1152077576 17:78168813-78168835 CGGCCGCGTCCGGGGCCTGGCGG + Intronic
1152089909 17:78240587-78240609 CGGCCCCGTTTGGGGTTTGGGGG + Exonic
1152851615 17:82639838-82639860 GGGCTGTGTGTCGGGTCAGGTGG + Intronic
1153935284 18:9914765-9914787 CGGCGGGGAGTGGGCTCTGGAGG + Intronic
1154286163 18:13058728-13058750 CAGCAGTGGGTGGGGGCTGGGGG - Intronic
1156178893 18:34580458-34580480 TGGCTGTGTGTGGGGTCGGGGGG + Intronic
1158526724 18:58221145-58221167 CTGCCGAGTGTGGGGCCTCGAGG + Intronic
1160400351 18:78606326-78606348 CGGGTGTGTGTGGGGTGTGGGGG - Intergenic
1160557737 18:79736883-79736905 CAGGCGTGTGTGGGTTCTGCAGG + Intronic
1160577900 18:79867473-79867495 CGGCGTTGTGTCGTGTCTGGGGG + Intronic
1160577911 18:79867509-79867531 CCGGCGTGTGTCGTGTCTGGGGG + Intronic
1160578938 18:79872918-79872940 CGGCCGTGGGGAGGGTCTGTGGG + Intronic
1160631055 18:80246876-80246898 GGGCCGTGGGGGGGCTCTGGGGG - Intronic
1161088168 19:2344504-2344526 CGGCCGGGTGAGGGTCCTGGAGG + Intronic
1161112380 19:2477481-2477503 CGTCCGTGTGAGGGTTCTGTAGG - Exonic
1161389027 19:4011680-4011702 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389032 19:4011697-4011719 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389037 19:4011714-4011736 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389042 19:4011731-4011753 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389047 19:4011748-4011770 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389052 19:4011765-4011787 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389057 19:4011782-4011804 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389062 19:4011799-4011821 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389067 19:4011816-4011838 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389072 19:4011833-4011855 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389091 19:4011899-4011921 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389096 19:4011916-4011938 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389101 19:4011933-4011955 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389106 19:4011950-4011972 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389111 19:4011967-4011989 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389116 19:4011984-4012006 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389121 19:4012001-4012023 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389126 19:4012018-4012040 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389131 19:4012035-4012057 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1161389136 19:4012052-4012074 TGGAGGTGTGTGGGGTGTGGAGG + Intronic
1162196298 19:8987586-8987608 TGGCTGTGTGTGGTGTGTGGTGG - Intergenic
1163217711 19:15893297-15893319 GGGCGTTGTGTGAGGTCTGGGGG - Intronic
1165831625 19:38733488-38733510 GGGGCGTGTGTGGGGTGGGGAGG - Intronic
1166536982 19:43580617-43580639 TGGCCGTGGGTGGGGTGGGGTGG + Intronic
1167725950 19:51212540-51212562 GGGTTGTGTGTGGGGTCTGAGGG - Intergenic
1168349285 19:55666878-55666900 CAGCTGAGTGTGGGCTCTGGAGG + Intronic
925034851 2:677169-677191 CGGCCGTGGGCGGGGCCTTGTGG - Intronic
925362968 2:3292379-3292401 CGGCTGTCTGTGAGGTGTGGGGG - Intronic
925388355 2:3479123-3479145 GGGCCGTGTTAGGGGCCTGGGGG - Intronic
925390218 2:3489356-3489378 CGGCCGGGTGAGGGGTACGGGGG - Intergenic
925928064 2:8685003-8685025 CGGAGGTGGGTGGGGTGTGGCGG - Intergenic
926123182 2:10255855-10255877 GGCCCGTGTGTGGGTGCTGGGGG - Intergenic
926741394 2:16114370-16114392 AGGCCTTGTGTGGGGTGTCGCGG + Intergenic
928511791 2:32010127-32010149 CGGCCGGGCGTGGGGCCAGGCGG + Intronic
928898978 2:36297535-36297557 TGGCTCTGTGTAGGGTCTGGAGG + Intergenic
937983702 2:127629160-127629182 AGGCTGTGTGTGGGGTCTTTGGG + Intronic
938349532 2:130589155-130589177 TGGCCCTGTGTGGGGTGGGGTGG - Intergenic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
941075595 2:161002915-161002937 CGGCCGTGTGAGGTGTCAGTCGG - Intergenic
941911775 2:170771019-170771041 CAGCCGAGGGTGGGGGCTGGGGG - Intergenic
946138653 2:217669203-217669225 AGGCTATTTGTGGGGTCTGGGGG - Intronic
947819530 2:233060420-233060442 CGGTGGTGTGTGGGTCCTGGGGG + Exonic
948216467 2:236237036-236237058 CGCCCGGGCGCGGGGTCTGGGGG - Intronic
948478842 2:238238501-238238523 CAGCCCTGTGCGGGCTCTGGGGG - Exonic
948803134 2:240441815-240441837 CGCCTGGGTGTGGGGCCTGGAGG - Intronic
1173183632 20:40822531-40822553 CGGCAGAGTCTGGGGTCTGCAGG + Intergenic
1174082777 20:47982947-47982969 AGGCCGTGTCAGGGGTCAGGAGG + Intergenic
1174133179 20:48360035-48360057 AGGCCGTGTCAGGGGTCAGGAGG - Intergenic
1175530703 20:59672785-59672807 CTGCGGTGTGTGGGGTCAAGGGG - Intronic
1175830585 20:61963291-61963313 CGGCGGTGGGTGTGGTTTGGTGG - Intronic
1176084938 20:63291549-63291571 TGGCCATGGGTGGGGTGTGGTGG + Intergenic
1177783511 21:25644458-25644480 GGGCCGTGAGTGGGGACAGGTGG - Intronic
1179541045 21:42083450-42083472 AGGCCTGGTGTGGGGTGTGGTGG - Intronic
1181025075 22:20123315-20123337 TGGGTGTGTGTGGTGTCTGGGGG + Intronic
1181025114 22:20123434-20123456 GGGGGGTGTGTGGTGTCTGGGGG + Intronic
1181084795 22:20434872-20434894 CGGGCTGGTGTGGGGTCTGAAGG - Intronic
1184120452 22:42446372-42446394 CCGCCGTGCCTGAGGTCTGGGGG + Intergenic
1184132159 22:42523269-42523291 CCGCCGTGCCTGAGGTCTGGGGG + Intergenic
1184175816 22:42788226-42788248 CCAGCGTGTGTGGGGTCGGGAGG - Intergenic
1184204699 22:42994584-42994606 AGGCCATGTAAGGGGTCTGGGGG + Intronic
1184792458 22:46708508-46708530 CAGCCGTGTGGGTGGTCTTGAGG + Intronic
952216914 3:31287372-31287394 CTGCAGTGTGTGGGGGCTGTGGG + Intergenic
952222750 3:31341305-31341327 CAGCAGTGTGTGAGGTCCGGAGG + Intergenic
952686767 3:36159151-36159173 AGACAGTGTGTGGGGCCTGGGGG - Intergenic
953555690 3:43945394-43945416 CGGCCGTGTGAGGTGTCAGTCGG + Intergenic
953561373 3:43995806-43995828 CGGCGGAGTGCGGGGTTTGGCGG + Intergenic
953614382 3:44477449-44477471 CGCCCGTGGCGGGGGTCTGGCGG - Intronic
954495953 3:50962153-50962175 GGGCCTGTTGTGGGGTCTGGGGG - Intronic
956604960 3:71064880-71064902 GGGCCGGGCGTGGGGTCCGGCGG + Intronic
957026894 3:75192568-75192590 CAGCCGTGTGTGGCGAGTGGTGG + Intergenic
958001982 3:87761963-87761985 CGGGCGTCTGTGGTGTCTGTCGG + Intergenic
962249931 3:133829625-133829647 CAGGGGTGTGTGGGGTGTGGTGG + Intronic
968541645 4:1171227-1171249 CGGCCGGGGGCGGGGTCCGGGGG - Intronic
968553125 4:1234185-1234207 GGGCTGTGTGTGGAGTCTGCAGG - Intronic
968660984 4:1798600-1798622 TGGCCGTGTGGACGGTCTGGGGG - Intronic
968746252 4:2362107-2362129 CGGCTGAGTGTGGGGGCTGTAGG - Intronic
968878796 4:3288193-3288215 GGCGGGTGTGTGGGGTCTGGTGG + Intergenic
969325466 4:6441489-6441511 TGCTCGTGTGTGGGGACTGGTGG - Intronic
969439776 4:7210149-7210171 CAGCCTTGTGTGGGGCCAGGTGG + Intronic
969457057 4:7306225-7306247 CAGCCGACTGTGGGCTCTGGAGG - Intronic
969533144 4:7740519-7740541 CGGCCGTGTGTGGGGTCTGGGGG - Exonic
974460097 4:62176136-62176158 TGGGGGTGTGTGGGGTGTGGGGG + Intergenic
975444303 4:74445043-74445065 CGGCCGTGGGTGGAGGCAGGCGG - Intergenic
982113898 4:152081306-152081328 AGACCGTGTGTGGGCTCAGGGGG + Intergenic
982549175 4:156775868-156775890 CCACTGTGTGTGGGGTGTGGTGG - Intronic
985522128 5:379050-379072 CGGCCGTGGCTGGGGGCAGGGGG - Intronic
988547888 5:32174643-32174665 CGGCGGTGTCTGGGGCGTGGAGG - Intergenic
988940272 5:36138952-36138974 CCGCAGTGTGGGGGGACTGGCGG + Intronic
997454372 5:134006116-134006138 AGGCCCTGTGTAGGGGCTGGGGG + Intergenic
999858664 5:155621794-155621816 GAGCCGTGGGTGGGGTGTGGTGG - Intergenic
1005193837 6:23259663-23259685 CGGCCGTGTGTGGTGTCAGTTGG + Intergenic
1007142468 6:39589609-39589631 CAGCCCTATGTGGGGTTTGGAGG + Intronic
1007397435 6:41585782-41585804 CCCCCGTGTGTGGTGTCTGCCGG + Intronic
1010636016 6:78260228-78260250 AAGCTGTTTGTGGGGTCTGGAGG + Intergenic
1016199752 6:141394085-141394107 CGGGGGTGTGTGGGGAGTGGCGG + Intergenic
1017065438 6:150524466-150524488 CTGCCTTGTGTGGGGACTTGAGG - Intergenic
1017616457 6:156251742-156251764 CGGCCGGGGGTGGGGTGGGGTGG - Intergenic
1017875310 6:158519542-158519564 CGGCTGTGTGTGGTGTGTGCTGG + Intergenic
1018384111 6:163287435-163287457 TGGCCGTGTGTGCGGCCTGTGGG - Intronic
1019214454 6:170434354-170434376 CAGCCGTCTGTGAGGTCTGTGGG + Intergenic
1019446522 7:1074207-1074229 CGGCGGGGTGCGGGGTCGGGGGG - Intronic
1019622413 7:1999010-1999032 CAGCAGTGTGTGGGGTTAGGGGG - Intronic
1022603231 7:31781693-31781715 GGGCAGTGTGTGGGGGGTGGGGG - Intronic
1032398545 7:131607982-131608004 CGGGCAGGCGTGGGGTCTGGTGG + Intergenic
1034547234 7:151797038-151797060 GGGCCGGGTGTGGGGCCTCGGGG - Intronic
1035381583 7:158444368-158444390 TGGCCGTGGGTGGGGACTTGGGG - Intronic
1035886156 8:3294205-3294227 AGGCCGTGTGAGGTGTCTGTTGG + Intronic
1035924199 8:3709954-3709976 CAGCTGTGTGTGGGGGTTGGGGG - Intronic
1036045005 8:5130125-5130147 CACCTCTGTGTGGGGTCTGGAGG - Intergenic
1039441506 8:37598453-37598475 CCTCTGTGTGTGGGGGCTGGGGG - Intergenic
1040523612 8:48198736-48198758 CAGCCCTGTGTGGGGCTTGGGGG + Intergenic
1040663090 8:49598099-49598121 CAGCCTTGTGTGGGACCTGGAGG + Intergenic
1042121035 8:65488671-65488693 CAGCCGTGAATGGGGTTTGGGGG + Intergenic
1044476563 8:92633316-92633338 TGGCCATGTGTGGGGCATGGGGG - Intergenic
1047676827 8:127211860-127211882 GGGCCATGGGTGGGGTTTGGGGG - Intergenic
1049197668 8:141324540-141324562 CTGCCATGAGTGGGGTGTGGTGG + Intergenic
1049330115 8:142045908-142045930 CGGGCTTGGGTGGGGGCTGGAGG + Intergenic
1050652833 9:7791540-7791562 CAGCTGTGTGTGGGGGCTGCCGG - Intergenic
1053161297 9:35815032-35815054 CGGCCGTGGGTGGGGACTCCGGG + Intronic
1053188273 9:36037193-36037215 CGGACGTGGGCAGGGTCTGGGGG - Intronic
1057921903 9:99104886-99104908 GGGCCGGGGCTGGGGTCTGGCGG + Intronic
1060549404 9:124477956-124477978 GGGCCGGGTGGGGGGTCCGGAGG - Intronic
1061230292 9:129311988-129312010 CTGCCTTTTCTGGGGTCTGGGGG + Intergenic
1061393610 9:130331517-130331539 GGGCTGTGTGTGAGGTCAGGTGG + Intronic
1061570837 9:131476617-131476639 CCGCCGTGTGTCGGGGCTGGGGG + Intronic
1062277148 9:135736499-135736521 CGGCCGGGTGCCGGGGCTGGGGG - Intronic
1062294888 9:135819184-135819206 CGGCCGTGTCCGGCGTCTGAGGG - Intronic
1062322025 9:135994721-135994743 TGGCCGTGAGTGGGGTCTGGGGG - Intergenic
1190131833 X:47755004-47755026 AAGCCCTGTATGGGGTCTGGTGG - Intergenic
1197737068 X:129859027-129859049 CGGCCGTGTGAGATGTCTGTAGG + Intergenic
1200251722 X:154557611-154557633 CAGCCGTGTGTGGGAGCTGCCGG + Intronic
1200253929 X:154569295-154569317 CAGCCGTGTGTGGGAGCTGCCGG + Intergenic
1200263840 X:154635113-154635135 CAGCCGTGTGTGGGAGCTGCCGG - Intergenic
1200266045 X:154646805-154646827 CAGCCGTGTGTGGGAGCTGCCGG - Intergenic