ID: 969533180

View in Genome Browser
Species Human (GRCh38)
Location 4:7740665-7740687
Sequence GGCCCCGGCCTCTGCGGGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 332}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969533180_969533188 12 Left 969533180 4:7740665-7740687 CCTTCCCCGCAGAGGCCGGGGCC 0: 1
1: 0
2: 3
3: 44
4: 332
Right 969533188 4:7740700-7740722 CTTCTTCACTCCCACCTGTGCGG 0: 1
1: 1
2: 3
3: 37
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969533180 Original CRISPR GGCCCCGGCCTCTGCGGGGA AGG (reversed) Exonic
900513583 1:3071162-3071184 GGCCCCGGCGTCAGCGCGGCCGG - Intronic
900519903 1:3100508-3100530 GGCCCCGTCCACTGAGGGCAGGG - Intronic
900546965 1:3234653-3234675 GGCCCTGGCCTGTGGGTGGAGGG - Intronic
900569748 1:3352398-3352420 GGCGCCGGCTTCGGAGGGGAGGG - Intronic
900582355 1:3415426-3415448 GGGCCCGTCCACGGCGGGGAAGG - Intronic
900949992 1:5853182-5853204 CTCCCCGGCCTCAGTGGGGAAGG - Intergenic
901047354 1:6405220-6405242 GGCTCCGGCCTCTGCTGGGTGGG - Intergenic
901050821 1:6425134-6425156 GGCGCGGGCCGCGGCGGGGAGGG - Exonic
901251578 1:7783892-7783914 GGACCCGGGCTCTGTGGGGCGGG - Intergenic
901816425 1:11796132-11796154 GCCCCCAGCCTGTGCGAGGACGG + Intronic
902444307 1:16452216-16452238 AGCCCTGGCCTCTCAGGGGAGGG - Intronic
902552994 1:17230314-17230336 GGGCCAGGCCTCTGGGGCGAGGG + Intronic
904120331 1:28193961-28193983 GCCCCCGGGCTCTGCTGGGTGGG + Intergenic
904415453 1:30358753-30358775 GGCCTTGGCCTGTGCTGGGAAGG - Intergenic
905038110 1:34930180-34930202 GGCCCCAGCCCCTGCCAGGATGG + Intergenic
905166968 1:36088564-36088586 GGTCCCGGCCTCGGTGGGGAGGG + Intergenic
905714147 1:40133489-40133511 CGCCCCGGCGTCTGCCGGGTGGG + Intergenic
907272516 1:53299192-53299214 GACCCCTGCCTGTGTGGGGAGGG + Intronic
912474230 1:109925408-109925430 GTCCCTGGCCTCAGCGGGGGTGG - Intronic
912764510 1:112396386-112396408 GGCCCCGCCCCCTCAGGGGATGG - Intronic
913163937 1:116168337-116168359 GGCCGAGCCTTCTGCGGGGATGG + Intergenic
913521313 1:119647989-119648011 AGACCCGACCGCTGCGGGGATGG - Intergenic
915544909 1:156591721-156591743 TGGCCCGGCCTCTTCGGGGGCGG + Intergenic
916720597 1:167482422-167482444 TGCCCTGGCCTCTGTGGGGGTGG + Intronic
919430585 1:197486864-197486886 TGCCACGGCCACTGTGGGGATGG - Intergenic
922505043 1:226121543-226121565 ACCCCCGGCCCCTGCGGGGGGGG - Intergenic
922782922 1:228268113-228268135 AGCGTTGGCCTCTGCGGGGAAGG - Intronic
922797963 1:228350948-228350970 GGCCCAGGCCTGCCCGGGGATGG + Intronic
923527044 1:234780569-234780591 GGCCCGGGCCTCTCCGGGGCTGG - Intergenic
923591712 1:235326761-235326783 GACCCCGGTCTCTCTGGGGAAGG + Intronic
924775259 1:247111638-247111660 GGCCCCGGCACCGGCGGGGAGGG - Exonic
1062767488 10:76542-76564 AGCCCCGGCCCCTCCGGGGTGGG + Intergenic
1062774754 10:135642-135664 GGCCGCGGCCTCTGGGGCGGCGG + Intronic
1062829112 10:593561-593583 GGCCCCTGCCTCTGCTGGAGAGG - Intronic
1062857106 10:784840-784862 TGCCCCGGGCGCTGCGGGGGCGG - Intergenic
1063392836 10:5661326-5661348 GGCCCCAGGCTCGGCGGGGCGGG - Intronic
1063636445 10:7787630-7787652 GGGCCCGGGGGCTGCGGGGAGGG + Intronic
1063995155 10:11611737-11611759 GGCTGCGGCCGCTGCGGTGACGG - Intronic
1064164949 10:12977921-12977943 GGCCCGGGCTTGTGCGTGGATGG + Intronic
1064354278 10:14603974-14603996 GGCGGGGGCCGCTGCGGGGAAGG - Intronic
1067457257 10:46427866-46427888 GGCCCTGGGCTGTGCGAGGAAGG + Intergenic
1067629945 10:47956772-47956794 GGCCCTGGGCTGTGCGAGGAAGG - Intergenic
1069024142 10:63521661-63521683 GGCCTGGGCCTGGGCGGGGACGG + Intronic
1069581882 10:69572239-69572261 GGCCCAGGCCTCCACGGGGGCGG - Exonic
1069773162 10:70912024-70912046 AGCCCAGACCTCTGAGGGGAGGG + Intergenic
1069942361 10:71964402-71964424 GGCTCGGGCCTGAGCGGGGAGGG + Exonic
1070593408 10:77816467-77816489 GGGCCTGGGCTCTGCAGGGAAGG - Intronic
1072612884 10:97030895-97030917 GGCCCAGCCCTCTGCAGAGAGGG + Intronic
1073325968 10:102644122-102644144 GGCTCCGGCCCCTGCGAGGGAGG + Intergenic
1073379485 10:103066854-103066876 GGGCCCTGCCTGTGTGGGGAAGG + Intronic
1073428894 10:103473277-103473299 TCCCCCGGGCTCTGCGGGGGTGG - Exonic
1074165857 10:110872607-110872629 AGGCCCGGCCGCTGTGGGGAGGG + Intronic
1074687707 10:115975269-115975291 GGCCTTGGCCTTGGCGGGGAGGG + Intergenic
1076146416 10:128126018-128126040 CCCCCCGAGCTCTGCGGGGACGG - Intronic
1076185158 10:128440869-128440891 GGCCTCAGCCTCTAGGGGGAGGG + Intergenic
1076708937 10:132320524-132320546 TGCCCCAGCCTCTGCGGGGGTGG - Intronic
1076935545 10:133566092-133566114 GGCCTCGGCCACTGTGGGCATGG - Intronic
1077055900 11:592978-593000 GGTCCCGGCCTTTGTGGGGGAGG + Intronic
1077095926 11:799098-799120 AGGCCTGGCCCCTGCGGGGAGGG - Exonic
1077247501 11:1546752-1546774 GGCCCCAGCCTCGGCGGGCGCGG + Intergenic
1077330680 11:1982651-1982673 GGACCCAGCCTCTGCCGGGAGGG + Intronic
1078567984 11:12433734-12433756 GGCCCCGGCCTCTCTGGGTTTGG + Intronic
1079101441 11:17544445-17544467 GGGCCAGGCCTCTGTGGGGCGGG + Intergenic
1080223559 11:29934464-29934486 TGCCCCAGCCTCTGCGGCGCCGG + Intergenic
1081528523 11:43942879-43942901 GCCTCCGGCGTCTGCGGGGCCGG - Exonic
1081608178 11:44540636-44540658 GGCCCCGGCCCCTGCTGTCATGG - Intergenic
1082807086 11:57458381-57458403 GGGCCCGCGCTCTTCGGGGAGGG - Intergenic
1083667568 11:64284276-64284298 GGGCCCGTCCCCTGCGGGGCTGG + Exonic
1083775602 11:64893106-64893128 CGCCCAGGCCTCTGTGGGAAGGG - Intergenic
1083869611 11:65478836-65478858 AGCCCCTGCTGCTGCGGGGAGGG - Intergenic
1083923028 11:65790586-65790608 AGCTCCGGCCTCTGATGGGATGG + Intronic
1084487065 11:69454692-69454714 GGCCCCAGCCTCTGCGTGGATGG - Intergenic
1084611008 11:70203090-70203112 GGCCCAGCTCTCTGCGGTGAGGG - Intergenic
1085705966 11:78787017-78787039 GGCACCTGCCGCTGCGAGGATGG - Exonic
1087168983 11:95031240-95031262 GGCCCCTGCCTCTGAGGCCATGG + Intergenic
1088707222 11:112474709-112474731 GTCACCGGCTTCAGCGGGGATGG + Intergenic
1089353345 11:117833825-117833847 GGCCCCTTCCTCTGGGAGGAGGG - Intronic
1089683101 11:120130418-120130440 GGCCCTGGCCTATGGTGGGAGGG - Intronic
1202813658 11_KI270721v1_random:37830-37852 GGACCCAGCCTCTGCCGGGAGGG + Intergenic
1091582274 12:1797117-1797139 GGCTGCGGCCTCGGCGGGGTGGG + Intronic
1092104373 12:5911002-5911024 GACCCCAGCATCTGCGGGCAGGG + Intronic
1092791232 12:12072418-12072440 GACCCCGGCCACCTCGGGGAGGG + Intronic
1095971245 12:47903357-47903379 GGCCACGGACTCTGCAGGGAGGG + Intronic
1096849742 12:54427999-54428021 AGCCCCGGCCTCTGCCATGAAGG + Intergenic
1097050773 12:56221843-56221865 GGTCCCAGCCTCTCCCGGGAAGG + Exonic
1098403955 12:70104176-70104198 TGCCCCTGCCTGTGCAGGGAGGG - Intergenic
1101791867 12:107934919-107934941 GGCTCCGGGCTGTACGGGGAAGG + Intergenic
1102261227 12:111444727-111444749 GGCTCTGGCCACTGCAGGGAAGG - Intronic
1103410806 12:120710391-120710413 GGCCCGGGGCCCGGCGGGGAAGG - Intergenic
1103576051 12:121878005-121878027 GCTGCCGGGCTCTGCGGGGAGGG + Intergenic
1103592840 12:122004445-122004467 GGCCCCGGCCTCTGCTGGGCGGG - Intergenic
1103968632 12:124655771-124655793 AGCCCCGGCCTCAGCTGGGGAGG - Intergenic
1105016116 12:132787603-132787625 GGTCCCGGGGTCTCCGGGGAAGG - Intronic
1105016137 12:132787647-132787669 GGTCCCGGGGTCTCCGGGGAGGG - Intronic
1105016149 12:132787669-132787691 GGTCCCGGGGTCTCCGGGGAGGG - Intronic
1105016161 12:132787691-132787713 GGTCCCGGGGTCTCCGGGGAGGG - Intronic
1105016173 12:132787713-132787735 GGTCCCGGGGTCTCCGGGGAGGG - Intronic
1105016185 12:132787735-132787757 GGTCCCGGGGTCTCCGGGGAGGG - Intronic
1105016217 12:132787801-132787823 GGTCCCGGGGTCTCCGGGGAGGG - Intronic
1105016229 12:132787823-132787845 GGTCCCGGGGTCTCCGGGGAGGG - Intronic
1105016241 12:132787845-132787867 GGTCCCGGGGTCTCCGGGGAGGG - Intronic
1105447493 13:20470328-20470350 GGCAGCGGCCGCTGCAGGGAAGG + Intronic
1106264857 13:28100664-28100686 GGTCCCTGCCTCTGGGGAGAGGG - Intergenic
1107722882 13:43267398-43267420 GGCCCCAGCCCCTCCAGGGAAGG - Intronic
1108321549 13:49295419-49295441 GGCCCGGGCCTCTCTGGGTACGG - Intergenic
1112352340 13:98646648-98646670 TGCCCAGGCCTGGGCGGGGAAGG - Intergenic
1112506589 13:99979914-99979936 GGCAGCGGCCCCTGCGTGGAAGG - Intergenic
1113378491 13:109784291-109784313 GGCACCGGCCGCTGCCGGGCTGG + Exonic
1113417413 13:110138855-110138877 GGCCCCGGCCTCTGGAGGGATGG - Intergenic
1113751266 13:112777937-112777959 GGCCCAGGCCTCTCCGTGCAGGG - Intronic
1113839158 13:113348801-113348823 GGTCGCGGCGTCTGCGGGGCGGG - Intronic
1113839165 13:113348827-113348849 GGTCGCGGCATCTGCGGGGCAGG - Intronic
1118373394 14:65156738-65156760 GGCCACGGCTTTTGCTGGGAGGG - Intergenic
1119418688 14:74493481-74493503 GGGTCAGGCCTCTGAGGGGATGG - Exonic
1121050386 14:90816116-90816138 CGCCGCGGCCTCCGCGGGAACGG - Intronic
1121336995 14:93083635-93083657 GGCCCTGCCCTCTGCAGGCAGGG - Intronic
1121776217 14:96592773-96592795 TGCTCCGGCTCCTGCGGGGATGG + Intergenic
1122125205 14:99575081-99575103 GGTCCCAGCCTCCACGGGGATGG + Intronic
1122226861 14:100285452-100285474 GGCCGCGTCCGCTGTGGGGAGGG + Intergenic
1122270766 14:100567682-100567704 GGCCCGGGCCGCTGCGGCGGGGG - Intronic
1122843514 14:104478000-104478022 GGCCGCCGCCTCTGAGTGGAGGG - Intronic
1202860828 14_GL000225v1_random:80010-80032 TCCCCGGGCTTCTGCGGGGAGGG + Intergenic
1123457636 15:20440394-20440416 GGCCCCTGACTCTGAGGGCAGGG + Intergenic
1123632103 15:22268653-22268675 GGCCTCGGCCTCTGGCTGGAGGG - Intergenic
1123660435 15:22560028-22560050 GGCCCCTGACTCTGAGGGCAGGG - Intergenic
1123697872 15:22892031-22892053 GTCCCCGGGCTCTGCGGTGGGGG - Intronic
1124314290 15:28654513-28654535 GGCCCCTGACTCTGAGGGCAGGG - Intergenic
1125647447 15:41284220-41284242 GGCCTCGGCCTCGGCTGGGCGGG + Intergenic
1126800908 15:52295696-52295718 GCGCCCGGCCTCTGCGGCGCAGG - Exonic
1130995198 15:88899574-88899596 GGCCTGGGGCTCTGAGGGGAGGG - Intronic
1131096130 15:89655313-89655335 GGCCCAGGCCTGCGCGAGGAGGG + Intronic
1131150834 15:90046417-90046439 GGCCCTGGGCTCTGCGGGGCAGG - Intronic
1132346968 15:101114321-101114343 GGCCCCCGCCTCTTGGTGGATGG + Intergenic
1132698859 16:1213768-1213790 GCGCTGGGCCTCTGCGGGGAGGG - Exonic
1132721877 16:1320624-1320646 GGTCCACGCCTCTGTGGGGAAGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132983898 16:2753367-2753389 GGCCCCCGGCGCTGCGGGGAGGG + Intronic
1134121234 16:11586539-11586561 GGGGCCGTCCTCTCCGGGGAGGG + Intronic
1136800133 16:33062394-33062416 GGCCCGGGCCTTGGTGGGGATGG - Intergenic
1138507976 16:57487602-57487624 GGCCCAGGCGTCTCCGGGGCAGG - Intergenic
1140738294 16:77918573-77918595 GGCCCCAGTGTCTGCTGGGAGGG + Intronic
1141140957 16:81496702-81496724 GACCCCCGCCTCTACTGGGATGG - Intronic
1141677913 16:85527315-85527337 GGCCACTGCCCCTGCCGGGAGGG + Intergenic
1141689224 16:85587100-85587122 GGCCTCGGCCTCTGGCGGGAGGG + Intergenic
1142077490 16:88128611-88128633 AGCCCCTGCCTCTGCGGGAGGGG - Intergenic
1142282465 16:89155613-89155635 GGTCCAGGCCTCTGGCGGGAGGG - Exonic
1142343978 16:89542238-89542260 AGCCCTGGCCTCTGCAAGGAAGG + Intronic
1142354789 16:89597273-89597295 GGCCCAGCCCTCTGGGGGGTTGG - Intergenic
1143110040 17:4548006-4548028 AGCCCTGGCCTCTGCGGAGTGGG + Exonic
1143140444 17:4739347-4739369 CTCCGCGGACTCTGCGGGGATGG + Exonic
1143597295 17:7922995-7923017 GGCTCCGGCCGCTGCGTGGAGGG + Exonic
1143620934 17:8079931-8079953 GGCCACGTACTCTGCGAGGACGG + Exonic
1143680437 17:8472155-8472177 AGCACCGGCCTCTGGGGAGAAGG + Intronic
1145112470 17:20175782-20175804 GGCCTGGGCCTCTGCCGGGTGGG + Intronic
1145249343 17:21288835-21288857 GGTCCTGGGCTCTGCTGGGATGG + Intronic
1145279424 17:21457084-21457106 GGGCCCGGCGACTGAGGGGAGGG - Intergenic
1145279436 17:21457110-21457132 GGGCCAGGCGCCTGCGGGGAGGG - Intergenic
1146061853 17:29612011-29612033 GGCCCCTGCCGGTGCTGGGAAGG + Intronic
1146329690 17:31917220-31917242 GGCCCCGGCCGCCGCCGGGCAGG - Intergenic
1146446488 17:32936721-32936743 GGCCACGGGCTCTGCAGGGCAGG - Intronic
1147400621 17:40178190-40178212 GGCCCGGGCCTCTCGGGGGAGGG + Intronic
1148206610 17:45783922-45783944 GGCCCCGACCTCGGCCGGGCGGG + Intergenic
1148836598 17:50468999-50469021 GCCCCCGCCCTCCACGGGGAAGG + Intronic
1148851760 17:50559078-50559100 CGCCCCGGCCGATGGGGGGAGGG - Intergenic
1148858297 17:50591063-50591085 GGCCCCAGGCCTTGCGGGGACGG - Intronic
1149610333 17:57954791-57954813 AGGCCCGGGCACTGCGGGGAGGG + Intronic
1151569965 17:74921258-74921280 GGCCTTGGCCTGGGCGGGGAGGG + Intronic
1151671343 17:75573308-75573330 GGCCCCGGGCACTGCACGGACGG + Intronic
1152068009 17:78121987-78122009 GGCCCCTGCCCCAGCGGGCAGGG - Intronic
1152244084 17:79176241-79176263 GGCCCAGACCTCTGTGGGGCAGG - Intronic
1152594040 17:81229567-81229589 GGCCCTGCCCTCTGGGTGGAGGG - Intronic
1152717104 17:81905472-81905494 GGCCGCTGCCTCCCCGGGGAGGG - Intronic
1152960323 18:75888-75910 AGCCCCGGCCCCTCCGGGGTGGG + Intergenic
1153530619 18:6042097-6042119 GGCCACATCCTCTGTGGGGAGGG - Intronic
1158150007 18:54357628-54357650 GGCCCCGGGGTCTGCGGGAGGGG - Intronic
1158236593 18:55322578-55322600 GGCCCCGGCCTCCCCGGAGCTGG + Intronic
1159897673 18:74012344-74012366 GGCCCAGGCCTCTGCTCAGAGGG - Intergenic
1160234880 18:77077994-77078016 TGCCCCGGCCTCTCCAGGGAGGG + Intronic
1160500366 18:79398637-79398659 GGCCGCGGGCCCTGCAGGGATGG - Intronic
1160527937 18:79548179-79548201 GGCCCAGGCCAGTGCGGAGAAGG - Intergenic
1160792576 19:929439-929461 GGGGGCGGCCCCTGCGGGGAGGG - Exonic
1161065712 19:2236292-2236314 GGCCCCAGCCTGAGCGGGGACGG - Exonic
1161072919 19:2271255-2271277 GGCCCCTGCCTGGGCGGGGCGGG + Intronic
1161364137 19:3868650-3868672 GGCCTGGGCCTGTGCGGGGTCGG - Intronic
1161620081 19:5293099-5293121 GGCCCGGGCCTCGGGGTGGAAGG + Intronic
1161702364 19:5802512-5802534 GCCCCCAGCCGCGGCGGGGAGGG + Intergenic
1162301209 19:9846208-9846230 GGCCCCAGCTTCTGTTGGGATGG - Intronic
1162567350 19:11451680-11451702 GGCCTGGCCCCCTGCGGGGAGGG + Exonic
1162706035 19:12555520-12555542 GGCCCCGGTGTCTGCGGGGCAGG - Intronic
1163557632 19:18001591-18001613 GGTCCCGGCTGCTGCGGGGGCGG - Intronic
1163680245 19:18677309-18677331 GGCCCTGGCCTCTTTGGGAAAGG + Intergenic
1163806886 19:19405235-19405257 GGCCCCGGTGTCTGTGGGGAGGG - Intronic
1164616069 19:29667466-29667488 GGCCCAGGTCCCTGCAGGGAAGG + Intronic
1164916021 19:32052972-32052994 TGGCCCGGCCTCTGAGGGGAAGG + Intergenic
1165363839 19:35352073-35352095 GGACCCGGCCTCTGCCGGCCCGG + Exonic
1165389979 19:35533324-35533346 GTCCCATGCCTCTACGGGGATGG + Intergenic
1167078042 19:47260758-47260780 GGCCCCGGCCCCTCCGGCCACGG - Exonic
1167095612 19:47373546-47373568 GGGCCTGGCCAGTGCGGGGAGGG - Intronic
1167679301 19:50909565-50909587 GGCCCAGGGCTCTTGGGGGAGGG + Intronic
1168242672 19:55095300-55095322 GGCTCCGGCAGCTTCGGGGAGGG + Exonic
1168289983 19:55352913-55352935 GACAGCGGCCTCTGCGGGGTGGG + Intronic
925159880 2:1676498-1676520 GGCCCTGACCTCTGCTGGGACGG - Intronic
927210455 2:20635993-20636015 CGCCGCGGCCACGGCGGGGAAGG + Intronic
927935021 2:27071548-27071570 GGCCACGGCCACGGCGGGGCTGG + Intronic
928114415 2:28536943-28536965 GTCCCCCGCCTCTCCAGGGACGG + Intronic
928793850 2:34992129-34992151 GGCCCCGCACTCTGCAGGGCTGG + Intergenic
929346881 2:40895291-40895313 TGCCCCTGCCTCTGGGGTGAGGG - Intergenic
929889418 2:45906807-45906829 GCCCCAGGCCTCTGCAGGGTAGG - Intronic
929929292 2:46239647-46239669 GGTCCAGGCCTCTGTGGGAATGG - Intergenic
930730690 2:54724995-54725017 AGCCCCAGCCTCGGCGAGGACGG + Exonic
931304677 2:61017157-61017179 GGCTCCGGCGTCTGGGGAGAAGG - Intronic
932773895 2:74515772-74515794 GTACCTGGCCTCTGCGGAGAGGG + Exonic
934978548 2:98822665-98822687 GGCGGCGGCCTCTGCGTCGAGGG + Exonic
936522501 2:113220054-113220076 TGCCCAGGCCTCTGCTGGGCAGG - Intronic
937679349 2:124627091-124627113 AGACCCAGCATCTGCGGGGAGGG + Intronic
938093994 2:128449943-128449965 GGCCTGGGCCTCTGAAGGGAAGG - Intergenic
940615876 2:156047941-156047963 GGCCTGAGCCTCTACGGGGAGGG + Intergenic
942240807 2:173963720-173963742 GCGCCCGGCCTCGGCGGGGGCGG + Intronic
944159484 2:196643266-196643288 TGGCCCAGCCTCTGAGGGGAAGG - Intronic
946202993 2:218082036-218082058 GGCCCCTGGCTCAGCTGGGAGGG - Intronic
948502683 2:238406731-238406753 GGCCTCGGCCTCTGGTGGGGTGG + Intergenic
948728244 2:239947600-239947622 GGCCTGGGGCTCGGCGGGGAGGG - Intronic
948806585 2:240455827-240455849 GGCCCCGGCCTGCGCCGGGCCGG + Intronic
948892929 2:240915981-240916003 GCCCGGGGCCTCTGCGGGGTGGG - Intergenic
949064669 2:241982859-241982881 GGCCCCACCCTGTGCCGGGAGGG + Intergenic
1169113102 20:3045865-3045887 GGCCCCGGGCCCTGGCGGGAAGG + Intergenic
1169426963 20:5504232-5504254 GGACCCGGCCTGAGCCGGGAGGG + Intergenic
1171459198 20:25289079-25289101 GGCCCCGGCCTTGCCGTGGAGGG - Intronic
1172442895 20:34978226-34978248 GGCCCCAGACTCTGCAGGAAAGG - Intronic
1172620707 20:36316571-36316593 GGCCCCAGCCTCTGCCCGGTGGG - Intronic
1173454084 20:43189758-43189780 GGCCCCGGCCCCCGCGGGAAGGG - Exonic
1173843563 20:46174450-46174472 GGCCCCGGCGTGTGCTGGGCGGG + Exonic
1173880304 20:46406634-46406656 GGGCCCGGCCTGTGCGGGGCGGG - Intronic
1174136623 20:48384667-48384689 GGTCCCGGCCCCAGCGGTGAAGG + Intergenic
1175415420 20:58797548-58797570 GCCCCCGCCCTCTGCAAGGATGG + Intergenic
1175532442 20:59683195-59683217 GGTCCTGGCCTATGAGGGGAAGG + Intronic
1175966592 20:62662834-62662856 GGTCCCGGCGTGTGGGGGGATGG - Intronic
1176074610 20:63242807-63242829 GTCCTCGGCCTGTGCGGGGACGG + Intronic
1176074650 20:63242919-63242941 GTCCTCGGCCTATGTGGGGATGG + Intronic
1176232952 20:64041376-64041398 GCCCTGGGCCTCTGCAGGGAAGG - Intronic
1178719185 21:34992931-34992953 CGCCCAGGCCTCAGCAGGGAGGG + Intronic
1179548752 21:42129492-42129514 GGCCCAGGCGTCAGCGGGGAAGG - Intronic
1179674385 21:42972128-42972150 GGCCCCTGCCCCTGCTGAGAAGG + Intergenic
1179710198 21:43208891-43208913 TGCCCCCGGCTCTGCGGGGGTGG + Intergenic
1182622539 22:31625925-31625947 GGCCTCTGCCTCTGCGAGGCTGG + Exonic
1182742695 22:32580063-32580085 GGCCCTGGCCTAGGCGGGGAGGG + Intronic
1183370141 22:37427513-37427535 TGCCCCTGCCTCGGCGGGGAGGG + Intergenic
1184034267 22:41911085-41911107 AGCCGCGGCCTCTGCGGGTGAGG - Intronic
1184037811 22:41926741-41926763 GGCCCCGGAGCCTGCGGGGCAGG - Exonic
1184149053 22:42628050-42628072 GGCCCCTGGCTCTGTGTGGATGG - Intronic
1184646701 22:45899111-45899133 GGCCCCTGCCTCTGGGTGGGAGG - Intergenic
949920277 3:8994594-8994616 GGCCCTGGCTTCTCTGGGGAAGG + Intronic
950460980 3:13122117-13122139 GGGCCCGGCCCCTTCGGGGGTGG - Intergenic
950658256 3:14450679-14450701 GGCCTCGGCCTGTGCTGTGAAGG - Intronic
950658673 3:14453072-14453094 GGCCCCGTGCTCTGGGCGGACGG + Intronic
952884891 3:38006273-38006295 AGCCCAGGCCACTGTGGGGAAGG - Intronic
953061799 3:39434043-39434065 GGCACAGGCCTGTTCGGGGAAGG - Intergenic
953773445 3:45796420-45796442 GGCCCCGGCCTCGGCGCGCTCGG + Exonic
954316924 3:49806327-49806349 GGCCCCGGCCTGGACGGGGAGGG - Intronic
954329355 3:49881276-49881298 GGCCCCAACCTCTGCAGAGAGGG + Intergenic
954717530 3:52533918-52533940 GGCCCCGGACCCGGCGGGGCGGG + Intronic
954795905 3:53161283-53161305 GGCCCGGGCCTCCGCGCGGCGGG - Exonic
961340274 3:126212963-126212985 GGCCCCGGCCTGTGGAGGGTGGG + Intergenic
961472063 3:127121576-127121598 GGCCCTGGCCTCAGAGGGGATGG + Intergenic
961603361 3:128076893-128076915 GACGCCGGCAGCTGCGGGGAGGG - Intronic
962797691 3:138863256-138863278 GGCCCTGGCCCCTGCAGGAAGGG + Intergenic
966724761 3:183099416-183099438 GGCGGCGGCCTCTGCGGTGTCGG - Exonic
968445975 4:652216-652238 GGGCCGGGCCTCAGCAGGGAGGG + Intronic
968521538 4:1036708-1036730 GGCCCCGGCCTCACCAGGGAAGG - Intergenic
968570806 4:1339577-1339599 GGCCCTGGCCTGGCCGGGGAAGG + Exonic
968803039 4:2755786-2755808 GGCCCCGGCTCCTGAGGGGTTGG - Intronic
968812072 4:2804637-2804659 GGCCCTGGCCTCTGTGGAGGGGG - Intronic
968835790 4:2963575-2963597 TGCCCCGGCCGCGGCGGCGAGGG + Intergenic
969350112 4:6593483-6593505 GGCCCAGGGGTCTGCAGGGAAGG - Intronic
969414213 4:7048218-7048240 GGCTCCTGCCCCGGCGGGGAAGG - Intronic
969533180 4:7740665-7740687 GGCCCCGGCCTCTGCGGGGAAGG - Exonic
971235377 4:24837194-24837216 GGCCCAGGCCTGTGCGTGGGAGG - Intronic
972396465 4:38663559-38663581 GGCCCCGGGCGCGGCGGGAAGGG - Intergenic
974260371 4:59518331-59518353 GGCCCCTGCCCCTGCAGGGCTGG - Intergenic
975166927 4:71187412-71187434 GGCCCCGGCAGCTGCCGGGAGGG + Intronic
982264742 4:153527810-153527832 GGCCCCTGACTCTGAGGTGAAGG + Intronic
984772164 4:183445146-183445168 GGGACCGGCCTCGGCGGGGAGGG + Intronic
985025768 4:185737657-185737679 GGCGGCTGCCTCTGCGGGGATGG + Intronic
985504521 5:271507-271529 CGCCCTGGCGCCTGCGGGGAGGG - Intergenic
986559994 5:9050849-9050871 GGGCCCTCCCTCTGCCGGGAAGG - Intronic
986695942 5:10354133-10354155 GGCCCCGGCCCCTGCCCGGCAGG - Intronic
987054548 5:14179037-14179059 AGTCCCGGCTTCTGCGGGGGTGG - Intronic
988835659 5:35029902-35029924 GCCCCCTGCCTCTGTTGGGAGGG + Intronic
990955154 5:61332814-61332836 GGCCCCGGCCCCCGCGGCGGCGG - Exonic
994197185 5:96934895-96934917 GGCGGCGGCCTCTGCAGCGAGGG + Intronic
997388575 5:133495225-133495247 CGACCAGGCCTCTGCGGGGAAGG + Intronic
998164065 5:139831967-139831989 GCCCCTGGCCACTGCTGGGAAGG + Intronic
998465620 5:142341568-142341590 GGCCTCTGCCTCTGCTGGGAGGG - Intergenic
999462612 5:151770643-151770665 GGCCTCGGCCTCTGGGGAGCCGG - Exonic
1002029346 5:176416464-176416486 GGAGCCGGCGTCGGCGGGGACGG + Exonic
1002075598 5:176706421-176706443 GGCCTAGGCCACTGCGGGGCGGG + Intergenic
1002077704 5:176718738-176718760 GGCCCTGGACTCTGCAGTGAAGG - Intergenic
1002187119 5:177459570-177459592 GCCCCAGGCCTCGGCGGGGGTGG - Intronic
1003277203 6:4662817-4662839 GGGCTTGGCCTCTGAGGGGAAGG - Intergenic
1003313308 6:4987632-4987654 GCGCCCAGCCTCTGCTGGGAAGG - Intergenic
1003645593 6:7910840-7910862 GGGCGCGGCCTCTCCGGGGCGGG - Intronic
1003874885 6:10426360-10426382 CGCTCGGGCCTCTGCCGGGAGGG + Intergenic
1005989712 6:30895453-30895475 GGCCCGGGCCTCGAGGGGGACGG - Exonic
1006171560 6:32096231-32096253 GGGCACGGCCTTTGCGAGGATGG - Intronic
1006171651 6:32096696-32096718 GGCCGCGGGCGCTGCGAGGACGG - Intronic
1007427420 6:41756598-41756620 AGCCCAGGCCTCTGCCGAGACGG + Intergenic
1007723734 6:43901560-43901582 GGCCCTGGCCTCTGGGGAGAAGG - Intergenic
1007789421 6:44300676-44300698 TGCCCAGGCCTCTGCTGTGAAGG + Exonic
1017842412 6:158232407-158232429 GGCCCCGGGGTCTGCGCGGCGGG + Intronic
1018453073 6:163926904-163926926 GGCAGCTGCCTCTGCTGGGAAGG + Intergenic
1019536167 7:1530921-1530943 GGCCCGGGCCGCGGCGGGGACGG + Intronic
1019639678 7:2096798-2096820 GCCCCCAGCCTCTGCTGGGCGGG - Intronic
1019733163 7:2638417-2638439 GGGCCCGGCCTGTGGGGAGACGG + Intronic
1019927526 7:4203112-4203134 GCCTCCTGCCTCTGCGGGAAGGG - Intronic
1020083723 7:5299486-5299508 GGCCCTGGCCTATCCGGGAAGGG + Intronic
1020283643 7:6664115-6664137 AGCCCAAGCCTCCGCGGGGAAGG - Intergenic
1021656620 7:22880150-22880172 GGCCCCCAGCTCTGTGGGGAAGG - Intergenic
1023050779 7:36249293-36249315 GCCCCCGGCCACTGCTGGGGAGG + Intronic
1023703048 7:42911737-42911759 GGCCCCGGCCCCTCCTGGCAGGG - Intronic
1023805452 7:43869600-43869622 GGGCAGGGCCTCTGCGGGGCGGG + Intronic
1023941057 7:44768609-44768631 GGCCCCAGCCTGTGCGAGCAGGG + Exonic
1024034737 7:45497675-45497697 GGCCCCGTTCTCTGCGGGAAGGG - Intergenic
1024491080 7:49986400-49986422 GGCCCCAGCCCCAGCTGGGAGGG - Intronic
1024578276 7:50782304-50782326 GGCCCCGGCCGCGGCGGACAGGG - Intronic
1026455571 7:70569625-70569647 GGCCTTGGCCTCTGCAGAGAGGG + Intronic
1026888291 7:73967331-73967353 GGCCCTGGCCACAGCCGGGAAGG - Intergenic
1027190220 7:75992227-75992249 CCCCTCGGCCTCTGCTGGGAGGG + Exonic
1027233597 7:76285545-76285567 AGCCCTGGCCGCTGCTGGGATGG + Intronic
1029549976 7:101232505-101232527 GCCGCCGGGCGCTGCGGGGAGGG + Exonic
1030597990 7:111562317-111562339 GGCCCCGGCCCCGGCGGGGCGGG - Intronic
1032200822 7:129821591-129821613 GGGCCCCACCACTGCGGGGAGGG + Intergenic
1034253136 7:149708187-149708209 AGCCCAGGCCTCTGTCGGGAAGG - Intergenic
1035171045 7:157017733-157017755 GGCCCCGGAGACTGCGGGGAGGG - Intergenic
1035202470 7:157276317-157276339 GGCCCTGGCCACTGCGGGGCAGG + Intergenic
1036632976 8:10528513-10528535 GGACCCGGCCTCTGTCCGGAAGG + Intronic
1037902385 8:22695326-22695348 GGCCCGGGCGGCTGCGGGGAGGG + Intergenic
1039800241 8:40948243-40948265 GGCCTCGTCCTCTCTGGGGAAGG - Intergenic
1041653172 8:60321630-60321652 GGCCTCAGCCTCTGCCTGGAAGG + Intergenic
1044698914 8:94949193-94949215 GGCCGCCGGCTCGGCGGGGAAGG + Exonic
1044967066 8:97584108-97584130 CTCCCTGGCCTCTGTGGGGATGG + Intergenic
1044973778 8:97644341-97644363 GGCCGCTGCCACCGCGGGGAGGG - Exonic
1045320933 8:101080822-101080844 GGCGCCGGGCTTCGCGGGGAGGG + Intergenic
1045673921 8:104588418-104588440 CGCCCCCGCCGCTGCCGGGACGG - Intronic
1048318918 8:133383465-133383487 GGCCCAGGGCTCTGCAGGGCTGG + Intergenic
1049339913 8:142106547-142106569 GGTCCCGGCCTCTGCCAGCAAGG - Intergenic
1049433058 8:142574184-142574206 GGCCCAGGGCTGTGCGGAGAGGG + Intergenic
1049554688 8:143275991-143276013 TGCACCGGGCCCTGCGGGGAAGG - Exonic
1053129611 9:35607565-35607587 TGCCCCTGCCCCTGCAGGGAGGG + Exonic
1053164078 9:35832490-35832512 GCCCCTGGCCACTGTGGGGATGG + Intronic
1055446962 9:76393876-76393898 GGCTCCGAGCTCCGCGGGGACGG - Intronic
1056621778 9:88220926-88220948 GCACCCGGACTCTGCGTGGAGGG + Intergenic
1057311839 9:93947951-93947973 GGCCCCGGGCTGAGCTGGGAGGG + Intergenic
1059536502 9:115086004-115086026 GGCCAGGGCCGCTGCGTGGACGG - Exonic
1060389790 9:123268194-123268216 TGCCCCGGCCGCTTCGGGCAAGG - Intronic
1060599516 9:124868893-124868915 GCCCCTGGCCTCAGCGGGGCCGG - Exonic
1060794421 9:126504511-126504533 AGCCTCTGCCTCAGCGGGGACGG + Exonic
1060978398 9:127778790-127778812 GCCCCCGCCCCCTGCGGAGAGGG - Intergenic
1061231759 9:129319669-129319691 GGCCCCGGCCTCCACGGGCCCGG - Intergenic
1061365786 9:130172095-130172117 GGCCCCCGCCGCGGCGGGGAGGG - Intergenic
1061404462 9:130385713-130385735 GGACCCAGGCTCTGCGGGGTGGG + Intronic
1061426119 9:130499448-130499470 GGCCCTGGCCTCTGCTTGAAGGG - Intronic
1062027424 9:134346975-134346997 GGACCTGGCCCTTGCGGGGAGGG + Intronic
1062030494 9:134359898-134359920 GGGCCTGGCCTGTGAGGGGATGG + Intronic
1062362267 9:136193627-136193649 CGCCCTGGCCGCCGCGGGGAGGG - Intergenic
1062363670 9:136199049-136199071 GGCCTCGGCCTCTGCGCGGCGGG + Exonic
1062637931 9:137501238-137501260 GGGCCTGGCCTCTGAGGGGTGGG + Intronic
1062713034 9:137987045-137987067 GGCCCCAGCCCCTACGGTGAAGG + Intronic
1062738175 9:138150194-138150216 AGCCCCGGCCCCTCCGGGGTGGG - Intergenic
1203772816 EBV:58114-58136 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772823 EBV:58129-58151 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772830 EBV:58144-58166 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772837 EBV:58159-58181 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772844 EBV:58174-58196 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772850 EBV:58189-58211 GGCCCCGGCCTCTGCGGCCCCGG - Intergenic
1203772856 EBV:58204-58226 GGCCCCGGCCTCTGCGGCCCCGG - Intergenic
1187077236 X:15947312-15947334 GACCACAGCCTCTGGGGGGATGG - Intergenic
1195060699 X:101191449-101191471 GGCCCGGGCCTGGCCGGGGAGGG + Intergenic
1200064681 X:153498683-153498705 GGCCCCAGGCTCTGGGGGGCAGG + Intronic
1200249935 X:154547351-154547373 CGCCCCGCCCTCTCCGGGGGAGG - Intronic
1201077739 Y:10199807-10199829 GGCCCCGGCAGCTGGGGAGACGG - Intergenic