ID: 969533185

View in Genome Browser
Species Human (GRCh38)
Location 4:7740686-7740708
Sequence GTGAAGAAGCAAAGTCAGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 363}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969533185_969533188 -9 Left 969533185 4:7740686-7740708 CCTCCCTGACTTTGCTTCTTCAC 0: 1
1: 0
2: 3
3: 28
4: 363
Right 969533188 4:7740700-7740722 CTTCTTCACTCCCACCTGTGCGG 0: 1
1: 1
2: 3
3: 37
4: 266
969533185_969533193 11 Left 969533185 4:7740686-7740708 CCTCCCTGACTTTGCTTCTTCAC 0: 1
1: 0
2: 3
3: 28
4: 363
Right 969533193 4:7740720-7740742 CGGCCACCCAGTCCCTCTGTGGG 0: 1
1: 0
2: 1
3: 16
4: 122
969533185_969533201 26 Left 969533185 4:7740686-7740708 CCTCCCTGACTTTGCTTCTTCAC 0: 1
1: 0
2: 3
3: 28
4: 363
Right 969533201 4:7740735-7740757 TCTGTGGGAGCCCGGGTGCCAGG 0: 1
1: 0
2: 0
3: 21
4: 276
969533185_969533192 10 Left 969533185 4:7740686-7740708 CCTCCCTGACTTTGCTTCTTCAC 0: 1
1: 0
2: 3
3: 28
4: 363
Right 969533192 4:7740719-7740741 GCGGCCACCCAGTCCCTCTGTGG 0: 1
1: 0
2: 3
3: 9
4: 183
969533185_969533197 18 Left 969533185 4:7740686-7740708 CCTCCCTGACTTTGCTTCTTCAC 0: 1
1: 0
2: 3
3: 28
4: 363
Right 969533197 4:7740727-7740749 CCAGTCCCTCTGTGGGAGCCCGG 0: 1
1: 0
2: 2
3: 27
4: 271
969533185_969533198 19 Left 969533185 4:7740686-7740708 CCTCCCTGACTTTGCTTCTTCAC 0: 1
1: 0
2: 3
3: 28
4: 363
Right 969533198 4:7740728-7740750 CAGTCCCTCTGTGGGAGCCCGGG 0: 1
1: 0
2: 2
3: 30
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969533185 Original CRISPR GTGAAGAAGCAAAGTCAGGG AGG (reversed) Exonic
901078772 1:6571893-6571915 GGGAAGAAGGAAAGGCAGGCAGG - Intronic
901315188 1:8302346-8302368 GTGAAGCCGAAAAGTGAGGGAGG + Intergenic
903025854 1:20429491-20429513 GGGCAGATGCAAAGCCAGGGTGG - Intergenic
903756122 1:25662244-25662266 TTGAATAAGCAAATGCAGGGAGG + Intronic
903935987 1:26895220-26895242 GTGCTGAAGAAAAGTCAGGATGG + Intronic
904008698 1:27377812-27377834 GTGAAGAAGAAAACTCATGCTGG + Intergenic
904386480 1:30145897-30145919 GAGAAGAAACCAAGGCAGGGAGG + Intergenic
904891909 1:33785641-33785663 GAGAAGAAACAGAGGCAGGGTGG + Intronic
906138984 1:43522088-43522110 GGGAAGAAGCCAAGCAAGGGGGG - Intergenic
906706901 1:47901556-47901578 GTGAATGAGTTAAGTCAGGGAGG - Intronic
906750564 1:48255345-48255367 ATGAAGAAACAAACTCAGAGAGG + Intergenic
910235873 1:85036117-85036139 GTGAACAAATAAAGTCAAGGAGG - Intronic
910370668 1:86512420-86512442 CTGAAGAAGAGAAGGCAGGGTGG - Intergenic
910466514 1:87506017-87506039 GTGCAGAAGCCAAGCCAGAGGGG + Intergenic
910672100 1:89783816-89783838 CTGAAGAAGTAAGGACAGGGTGG + Intronic
912158635 1:106953347-106953369 GAGAAGAAGCAAAGTGAGAGAGG - Intergenic
912269837 1:108198025-108198047 GTGAAGAAGCAAAATCCGAGGGG - Intronic
914506362 1:148292931-148292953 GTGCAGAAGCCAAGCCAGAGGGG + Intergenic
914748720 1:150517748-150517770 GTGAAGTACCATAGACAGGGTGG - Intergenic
917455595 1:175183162-175183184 GTGAGCAAGCATTGTCAGGGAGG - Intronic
917562843 1:176177894-176177916 GTGAAGAATCAAAGTAACAGTGG + Intronic
919250639 1:195052086-195052108 GTGTAGAAACTATGTCAGGGAGG - Intergenic
920087174 1:203426112-203426134 GTGAAGAAACAGATTCAGAGAGG - Intergenic
920514615 1:206575508-206575530 GTGAAAAAGTAAAGTCGTGGCGG + Intronic
922663306 1:227448406-227448428 GTGAAGAAGCAAAGTCCCGAAGG - Intergenic
923200406 1:231705398-231705420 GTGAAGAATCAAAGTAGTGGAGG + Intronic
924373481 1:243381936-243381958 GTGAAAAGGGATAGTCAGGGAGG + Intronic
924683571 1:246263400-246263422 TTGAAGTAGAAAAGTTAGGGAGG + Intronic
1063424541 10:5941164-5941186 GAGAGGAAGCAAATTCAGAGAGG + Intronic
1064008444 10:11715932-11715954 GTTAGGAAGCAAAGGCAGAGAGG + Intergenic
1064012303 10:11744189-11744211 GTGAGGAAGCAAGTTCAGAGAGG + Intronic
1064456507 10:15492226-15492248 ATGTAGAAGCAAGGCCAGGGCGG + Intergenic
1064509250 10:16071694-16071716 TTGAAGATGCAAAACCAGGGCGG - Intergenic
1064625381 10:17256001-17256023 GTGTAGAAGAAAAGTAAGGTAGG - Intergenic
1065199893 10:23302421-23302443 ATGAAGAGGCAGAGACAGGGTGG - Intronic
1065921903 10:30400060-30400082 GTGAAAAGGCAAAGGCAGAGTGG + Intergenic
1066202550 10:33155946-33155968 GTGAGAAAGCAAAGTCCTGGAGG - Intergenic
1067342941 10:45419212-45419234 GTGAAGGCGCAGAGGCAGGGAGG + Intronic
1068810296 10:61248073-61248095 GTGAATAAACAAGGTCAGAGTGG - Intergenic
1070371236 10:75784239-75784261 GTGAGGAAACAAGCTCAGGGAGG - Intronic
1070828818 10:79406441-79406463 GTGAAGAAGCAGGGTCAGCAGGG - Intronic
1071200029 10:83211574-83211596 CTGCAGAATCAGAGTCAGGGTGG + Intergenic
1072199380 10:93144825-93144847 GTGACCAAGCAAAGCCCGGGTGG + Intergenic
1073604185 10:104877286-104877308 GTGAAAAGGCAAAGAAAGGGTGG - Intronic
1073763482 10:106656213-106656235 GCAAAGAAGCAAAGTCAAAGAGG - Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074970082 10:118528882-118528904 GTGAAGAAGCTAGGTGATGGGGG + Intergenic
1076238479 10:128884051-128884073 GTGAAGAGGCAGAGAAAGGGGGG - Intergenic
1077853269 11:6096231-6096253 GTGGAGAGGCAAAGCCAGGTGGG - Intergenic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1080827758 11:35862101-35862123 TTGAAGAATCAAATTCTGGGTGG - Intergenic
1082679648 11:56152474-56152496 GCGAAAATGCCAAGTCAGGGTGG - Intergenic
1082859623 11:57842326-57842348 GTCAAGGAGCAGAGTGAGGGAGG + Intergenic
1083250161 11:61461223-61461245 GTGAACAGGCTAAGTCTGGGAGG - Intronic
1084442099 11:69180428-69180450 GGGAAGGAGCACAGCCAGGGAGG - Intergenic
1084775474 11:71372031-71372053 GTGAAGCAGCAAACTCAGGGGGG - Intergenic
1085099095 11:73785465-73785487 TTGTAGGAGCAAAGGCAGGGAGG + Intergenic
1085455489 11:76663040-76663062 GAGAGGAAGCACAGTCAGGGAGG - Intronic
1085560389 11:77467164-77467186 TTAACGAAGCACAGTCAGGGAGG - Intronic
1086776793 11:90845796-90845818 GGAAAGAAGGAAAGTAAGGGAGG + Intergenic
1086841331 11:91688375-91688397 GAATAGAAGCAAAGACAGGGAGG + Intergenic
1087008231 11:93489531-93489553 TTGAAGCAGGAAAGTCAGGATGG + Intronic
1087958700 11:104321684-104321706 GTGAAGAAGAGAATTCTGGGTGG - Intergenic
1088058444 11:105612652-105612674 AGGAAGAAGCAAAGAGAGGGAGG - Intronic
1090710628 11:129381809-129381831 GGGAAGAAGGAAAGTAAGAGTGG + Intronic
1090920857 11:131204753-131204775 GTGGAGAAGGAAGGGCAGGGAGG + Intergenic
1091155780 11:133371169-133371191 GTGAAGATGCAGAGTAAAGGAGG + Intronic
1091465738 12:682660-682682 GAAATGAAGCATAGTCAGGGCGG - Intergenic
1091536931 12:1419633-1419655 GTGAAAAACCAAAGTAATGGAGG + Intronic
1091854534 12:3728745-3728767 GTGGAGCAGCAAAGGGAGGGAGG + Intronic
1092105487 12:5919135-5919157 GTGATGAAGAAAAGTAAGGCAGG + Intronic
1092623511 12:10300515-10300537 GTGAATAAACAAAGTCTGGATGG - Intergenic
1092970258 12:13686988-13687010 GAGAAGAAGCAAGGTCGGGGAGG - Intronic
1093483635 12:19629778-19629800 ATGAAGAAACAATCTCAGGGAGG + Intronic
1093870074 12:24280318-24280340 GTTAAGAAACACAGTCAGGGAGG + Intergenic
1096479932 12:51933316-51933338 ATGAAGAATCAAAGTCAGCGTGG - Intergenic
1098211156 12:68167178-68167200 CTGAAGAAGGAAGTTCAGGGTGG + Intergenic
1100130126 12:91482195-91482217 GTGGAGAAACAAAGTCTGAGAGG + Intergenic
1100357219 12:93842793-93842815 GAGAATAAGTTAAGTCAGGGCGG + Intronic
1101177735 12:102173114-102173136 GTGAAGGAGGAAAGCCAGCGAGG + Intronic
1101645526 12:106627809-106627831 GAGAAGAAGGAAGTTCAGGGTGG + Intronic
1102031943 12:109744647-109744669 GTGAAAAAGCAAGGCCAGAGAGG - Intronic
1104048827 12:125183273-125183295 CTGCAGAAGGAAGGTCAGGGTGG - Intergenic
1104509988 12:129368525-129368547 ATGAAGAAGGGAAGGCAGGGAGG - Intronic
1104743430 12:131195140-131195162 GTGAGGGACCAAAGTCAGGCAGG - Intergenic
1104790903 12:131481544-131481566 GTGAGGGACCAAAGTCAGGCAGG + Intergenic
1106529763 13:30578816-30578838 CTGCATATGCAAAGTCAGGGAGG - Intronic
1106689233 13:32096030-32096052 GTGAAGAAATAAAGACAGGAAGG - Intronic
1106869146 13:34000152-34000174 GTGAGCATGCAAAGTCAGAGAGG - Intergenic
1107666924 13:42700159-42700181 CTGAAGAAGTAAAGACAGGAAGG + Intergenic
1107828137 13:44349686-44349708 CTGAAGAGGCAAGGTCAAGGTGG + Intergenic
1109308279 13:60663662-60663684 GTGATCAAGCAGAGGCAGGGCGG - Intergenic
1112696873 13:101959468-101959490 GTTGTGAAACAAAGTCAGGGAGG - Intronic
1113232298 13:108226251-108226273 ATGAAGCAGCTAAGCCAGGGTGG - Intronic
1114523960 14:23356642-23356664 CCCAAGAAGCAGAGTCAGGGAGG + Exonic
1117479447 14:56128687-56128709 GTGAAGTTGGAAAGTCAGGTTGG + Intronic
1117995403 14:61473249-61473271 ATGAAGAAGCAAAGTCATAATGG + Intronic
1118164440 14:63322252-63322274 GAGAAGAAGCAAAGTCTTTGGGG + Intergenic
1118825865 14:69380654-69380676 GGGAATAAGCAAAGTCACAGTGG + Intronic
1120052311 14:79881475-79881497 GTGAAATAGCCAAGTCAGGAAGG + Intergenic
1120482967 14:85075598-85075620 GTGAAGTAGGAAAGTGAGGTAGG + Intergenic
1120764775 14:88318716-88318738 TTGAAGAGACAAAGTCAGAGAGG + Intronic
1121049535 14:90811475-90811497 GTGAAGAAGAGGAGTCGGGGTGG - Intronic
1122036308 14:98951557-98951579 GTGCAGAAGCAAGGCCAGGATGG + Intergenic
1122131647 14:99607293-99607315 CTTAAGAAGCAAAGTCACTGAGG - Intergenic
1124461924 15:29900046-29900068 GAGAAGGAGGAAACTCAGGGTGG + Intronic
1125730656 15:41891040-41891062 GTGAAGAGTTAAAGGCAGGGAGG - Intronic
1128609981 15:69065595-69065617 GAGAGGAAGCAAGGTCAGGGTGG + Intergenic
1129744538 15:78008623-78008645 CTCAAGAAGCAATGTCAGGCTGG - Intronic
1130353376 15:83109768-83109790 GTCAAGGAGCAAAGGCAGGCTGG - Intronic
1130380082 15:83364103-83364125 ATGAAGAAGCACAGTTAGCGAGG + Intergenic
1131551228 15:93358734-93358756 GGAAAGAAGCAAAGTCAGGCGGG + Intergenic
1132078158 15:98840406-98840428 GAAAAGAAGAAAAGACAGGGAGG + Intronic
1132264877 15:100461036-100461058 GTGAAGAAGCCATCTCAGGTAGG + Intronic
1133497343 16:6331432-6331454 ATGAAGAAAAAAAGTCTGGGAGG + Intronic
1133510719 16:6454781-6454803 GGGAAGAAGCAAGGGGAGGGAGG - Intronic
1133937041 16:10277775-10277797 GCGAAAATGCCAAGTCAGGGTGG - Intergenic
1136509938 16:30731161-30731183 GTTATGAAGCAAAGTCAGCTTGG - Intronic
1137555733 16:49469207-49469229 GTGAGGGAGTATAGTCAGGGAGG - Intergenic
1138367374 16:56491386-56491408 GTGAAGAGGCAAAGCCTGAGGGG - Intronic
1138850241 16:60620107-60620129 AGGAAGAGACAAAGTCAGGGAGG - Intergenic
1140944456 16:79754906-79754928 GAGAAAAAGAAAATTCAGGGAGG + Intergenic
1141769924 16:86083599-86083621 GTGGAGAGGCAAGGTCGGGGAGG - Intergenic
1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG + Intergenic
1143537836 17:7551750-7551772 GTGAAGAATAAAAGAAAGGGAGG + Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144388501 17:14771803-14771825 GGTAAGAAGCAATGTCAGGTGGG + Intergenic
1144686438 17:17229064-17229086 GTGAAGACGCACAGTGCGGGTGG + Intronic
1145283133 17:21482861-21482883 GTGGAGGAGCAAATGCAGGGAGG - Intergenic
1145394349 17:22482939-22482961 GTGGAGGAGCAAATGCAGGGAGG + Intergenic
1145940702 17:28742010-28742032 GAGGAGAAGCAATATCAGGGTGG - Exonic
1147464905 17:40603444-40603466 GTGAAGAAGCCAAGCCAGAAGGG + Intergenic
1148485494 17:47988166-47988188 AAGAAAAAGCAAAGTCAGGTTGG + Intergenic
1151898035 17:76993539-76993561 AGGATGAAGGAAAGTCAGGGGGG - Intergenic
1152531737 17:80922924-80922946 GAGACGAAGCCAAGACAGGGCGG - Intronic
1153623343 18:7000442-7000464 GCGAGGAAGGAAAGCCAGGGAGG + Intronic
1154216140 18:12417820-12417842 ATGAAGAAGCCAAGACTGGGTGG - Intronic
1155043577 18:22085095-22085117 GGGCAGAAGCAAAGGCAGGAGGG + Intergenic
1156377102 18:36524573-36524595 GTGAATCAGCAAAGCAAGGGTGG - Intronic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1158431082 18:57388145-57388167 GAGAAGTATCAAAGTAAGGGAGG + Intergenic
1160130770 18:76223058-76223080 GAAAAGAAACAAAGTCATGGTGG - Intergenic
1161756673 19:6138804-6138826 GGGAAGAAGCAAAGGGAGGAAGG + Intronic
1162416524 19:10541482-10541504 GGAAAAAAGGAAAGTCAGGGAGG + Intergenic
1162514922 19:11142205-11142227 GAGAAGAGGCCAAGCCAGGGTGG - Intronic
1162774434 19:12970381-12970403 GTGTAGAAGCAAAGTAACTGAGG - Intronic
1164686656 19:30170691-30170713 GTGAAGAACCACAGACTGGGGGG - Intergenic
1164747252 19:30625573-30625595 GTGAAGAAGCAGTGTCAGATAGG + Intronic
1165225169 19:34349671-34349693 ATGAGAAAGCAAGGTCAGGGTGG + Intronic
1165671849 19:37686654-37686676 GTCAAAAAGAAAAGTCAGGATGG + Intronic
1166104128 19:40589302-40589324 TTGAAGGAGCAAAGGCTGGGAGG + Intronic
1166140570 19:40803093-40803115 GTGAAGATGCTGAGCCAGGGAGG - Intronic
1166536766 19:43579564-43579586 GAGGAGAAGCAGAGACAGGGAGG + Intronic
1166782773 19:45351069-45351091 GAGATGAGGCAAAGGCAGGGCGG + Exonic
1166878909 19:45914878-45914900 GTGAAGAACTAAAGTCAGATGGG - Intergenic
1167456903 19:49601165-49601187 GTGAGGAAGTAGAGTTAGGGAGG + Intronic
1168501630 19:56898044-56898066 GTGAAGAATCAAGGGCGGGGTGG + Intergenic
925072851 2:984635-984657 GTGAAGGAGCAATTTCAGGACGG - Intronic
925095357 2:1194225-1194247 GGGAAGAAGCATGGTCAGGATGG + Intronic
925678225 2:6388780-6388802 GAGCAGGAGCAAGGTCAGGGTGG + Intergenic
926210673 2:10867405-10867427 TATAAGAAGCAAAGTCAGGCCGG - Intergenic
927002208 2:18809404-18809426 GTGGAGTATCAAAGACAGGGAGG - Intergenic
928186148 2:29113135-29113157 ATGAAGAAGCAGACTCTGGGAGG - Intronic
928849939 2:35733992-35734014 GAGAGCAAGGAAAGTCAGGGTGG + Intergenic
929429392 2:41874307-41874329 ATGAAGAAACAAACTCAGAGAGG + Intergenic
929971433 2:46580529-46580551 GGGAAAAAGCAGAGTGAGGGAGG - Intronic
930122928 2:47774581-47774603 GTTAAGCAGCTAAGTGAGGGAGG - Intronic
931183894 2:59930970-59930992 GTGAAGGAGCAAAGAGAAGGTGG - Intergenic
931378121 2:61726393-61726415 GTGAACAAGCAAACCCAGAGAGG + Intergenic
931555799 2:63502866-63502888 GTGAAGAACCACAGTCTGGCTGG - Intronic
931763905 2:65437876-65437898 GGGTAGAAGCCAGGTCAGGGAGG + Intergenic
932363655 2:71131134-71131156 CTGAAGAAGCTTAGTCATGGGGG - Intronic
932485115 2:72079993-72080015 GTGAAGGAGGAAAGCAAGGGGGG + Intergenic
932812172 2:74834635-74834657 GTGCAGAAGGTAAGTCAGCGCGG + Exonic
932892967 2:75611910-75611932 ATGAAGGAGCTAAGTCAGAGAGG - Intergenic
933559596 2:83874277-83874299 GCGAAAATGCCAAGTCAGGGTGG + Intergenic
933942669 2:87257831-87257853 GAGCAGAAGCATTGTCAGGGTGG - Intergenic
933983421 2:87572072-87572094 GTGAAGATGCAGAGACAGGTTGG - Intergenic
934123652 2:88865284-88865306 GACAGGAAGGAAAGTCAGGGAGG + Intergenic
935206000 2:100896833-100896855 ATGAAGAAGAAAAGGAAGGGAGG - Intronic
936114440 2:109690817-109690839 GGGAAAAAACAAAGTCAGGAAGG - Intergenic
936310427 2:111378722-111378744 GTGAAGATGCAGAGACAGGTTGG + Intergenic
936337553 2:111603731-111603753 GAGCAGAAGCATTGTCAGGGTGG + Intergenic
937236927 2:120436782-120436804 GTGAAGAAGAGAAGTAAAGGGGG - Intergenic
937333374 2:121045703-121045725 GTGAAAATGAAAAGCCAGGGAGG - Intergenic
938026098 2:127949933-127949955 GTGACGAAGCAAAGTAATGGGGG + Exonic
938119755 2:128625209-128625231 GTGTAGAAGGAAGGGCAGGGAGG + Intergenic
938246871 2:129783962-129783984 GTGGAAAAGCAAATTAAGGGAGG + Intergenic
938669502 2:133573525-133573547 GTGAAAAAGCAAAGGGATGGTGG - Intergenic
939122292 2:138132070-138132092 GTGAAGATCCAAAGACAGGTTGG + Intergenic
939515122 2:143156847-143156869 GTTTAAAAGCAAAGTCAGGCTGG - Intronic
942058577 2:172207247-172207269 AGGATGAAGCAGAGTCAGGGAGG - Intergenic
942998029 2:182288765-182288787 ATGAAGTGGCAAAGTCAGAGAGG - Intronic
943784951 2:191867262-191867284 GTGAAGAAGCACAGCTTGGGAGG - Intergenic
944832327 2:203545409-203545431 GAGAAGAAGAAAAGTCCGGCCGG + Intergenic
945644324 2:212470274-212470296 GTGAAGAAGCACAGAGAGGCTGG - Intronic
946307111 2:218862278-218862300 GTGAAGGGGCCAAGGCAGGGAGG - Intronic
947017838 2:225641157-225641179 GTCTAGGAGCAATGTCAGGGTGG - Intronic
947732000 2:232436457-232436479 GTGAGATAGCAAAGTCACGGAGG - Intergenic
947760414 2:232599956-232599978 GTGAAGAAGCAGAGCCCGGAAGG + Intergenic
947981724 2:234416034-234416056 ATGAAGATGCCAAGACAGGGAGG + Intergenic
948057433 2:235019076-235019098 AGGAAGGAGCAAAGTCAGGCAGG + Intronic
948496292 2:238352004-238352026 GGGAAGAAACAAAGGCAGGAGGG + Intronic
1169871629 20:10254370-10254392 GGGAAGAAGCCAAGCAAGGGGGG - Intronic
1169955886 20:11102232-11102254 GTGAAAAAGGAAAGTTTGGGCGG + Intergenic
1171101400 20:22386798-22386820 GTGGAGAAGCAAATGCAGTGAGG - Intergenic
1172578726 20:36030222-36030244 GTGCAGAAGGAGAGTCTGGGAGG + Intronic
1172756004 20:37284907-37284929 GTGAAGAAGCTACCTCAGAGCGG - Intergenic
1172757572 20:37297615-37297637 GTGAAGCAGCAGAGCCAAGGTGG + Intronic
1173317629 20:41959338-41959360 GAGGAGAAGCTAAGTCAGGGAGG + Intergenic
1173927853 20:46794018-46794040 ATGAAGAAGCAAAGTAGGGTGGG - Intergenic
1174291602 20:49512927-49512949 GTGAGGAAGCAAACACAGAGAGG + Intronic
1177723750 21:24940830-24940852 GTAAAGAAGCAAACACAGGCTGG - Intergenic
1177884574 21:26732855-26732877 GTGGAGAAGCAAAGCCCGGCGGG + Intergenic
1178418758 21:32426452-32426474 GGGAAGGAGGAAAGTCGGGGAGG - Intronic
1178741536 21:35206514-35206536 GGGAAGAAGGAAGGTCGGGGTGG + Intronic
1179292422 21:40030370-40030392 GTGGAGAAGCAAATCCAGGAAGG + Intronic
1179801374 21:43812968-43812990 CTGAAGAAGCAAAGTGTGTGGGG - Intergenic
1181313002 22:21955650-21955672 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1181346109 22:22221722-22221744 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1181982734 22:26777348-26777370 CTGAAGAAACAGAGTCAGAGAGG - Intergenic
1182807282 22:33084044-33084066 GTGAAGTAGCAAACTCATGTGGG - Intergenic
1183108928 22:35634290-35634312 GTTCAGAAGCAAAGTCACTGTGG - Intronic
1183324081 22:37182089-37182111 GTGAAGCAGGAAGGCCAGGGAGG - Exonic
1183708017 22:39487042-39487064 GTGCAGCCGCACAGTCAGGGTGG + Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184401381 22:44276615-44276637 GTGAAGCAGGAAAGAAAGGGAGG + Intronic
949904668 3:8849035-8849057 GTGCAGAAGCAGAGACAGGGAGG - Intronic
950401578 3:12773169-12773191 GGGAAGAAGTAAAGGGAGGGAGG + Intergenic
950663961 3:14483530-14483552 GTGGAGAGGCAAAGTGATGGAGG + Intronic
951142038 3:19174012-19174034 CTGGAGAGGCAAAGTCAGAGTGG - Intronic
951312776 3:21149395-21149417 ATGAAGAAGCAAAATCCGAGAGG - Intergenic
951580100 3:24153610-24153632 CTGAAGGAGCAAAGACAGGAGGG - Intronic
953124972 3:40083365-40083387 GGGAAGAAGCACAGTCCTGGAGG + Intronic
953481403 3:43255437-43255459 GTGAGGAATTAAAGTCAGAGGGG - Intergenic
953744891 3:45566815-45566837 GTGAAGGAGAGAAGTAAGGGAGG + Intronic
955019829 3:55109184-55109206 GTGATGAAGCAAAGTCAGTGAGG + Intergenic
955317884 3:57953835-57953857 GGGAAGACTCAAAGTCAGGGAGG - Intergenic
955789489 3:62573544-62573566 GGGCAGAAGCCAAGTCAAGGGGG - Intronic
955872636 3:63455719-63455741 GTACAGAAGCAAAATCAGAGAGG - Intronic
959024955 3:101230597-101230619 GAGCATGAGCAAAGTCAGGGAGG - Intronic
960748527 3:120918153-120918175 GGGAGGCAGGAAAGTCAGGGTGG - Intronic
961080259 3:124020924-124020946 GTGAAGAAGGAAAGAAAGGAAGG + Intergenic
961410259 3:126715289-126715311 ATGAAGAAACTGAGTCAGGGAGG - Intronic
961426218 3:126850586-126850608 GTGAAGCAGCAGAGACAAGGAGG - Intronic
961537168 3:127577190-127577212 AGGAAGGCGCAAAGTCAGGGTGG + Intronic
962915691 3:139901465-139901487 ATGAAGAGGCAAGGTCAGGGAGG + Intergenic
964301926 3:155297735-155297757 GTCAAGAACCAAAGACAGGTTGG + Intergenic
966292535 3:178376808-178376830 CTGAGAAAGCAAACTCAGGGTGG + Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
967135592 3:186510232-186510254 GAGAAGAAGCACAGCCAAGGTGG + Intergenic
967329349 3:188275153-188275175 GTGATGACCCAAAGTCAGGATGG - Intronic
967443786 3:189540732-189540754 GTGCAGGAGCAAGGTGAGGGGGG - Intergenic
968090153 3:195894368-195894390 GGGAAGAAGCAAAGTATGTGTGG + Intronic
969533185 4:7740686-7740708 GTGAAGAAGCAAAGTCAGGGAGG - Exonic
970003989 4:11393516-11393538 GTCTAGAAGCAAAGTCTGAGGGG + Exonic
971061659 4:22978511-22978533 GTGAAGGGGCAAAGCCAGGTTGG - Intergenic
971735660 4:30447116-30447138 GTGAAGAAGCATACACAGGAGGG + Intergenic
972028558 4:34420111-34420133 TTGAAGGAACAAAGTCAGGGAGG + Intergenic
973855986 4:55010216-55010238 GGTAGGAAGCAAAGTCAGGAAGG - Intergenic
975851782 4:78580210-78580232 GTGATGAAGGAATGTCAGTGAGG + Intronic
976357572 4:84137131-84137153 GTGCAGAAGCAGAGGCAGGGTGG - Intergenic
977487816 4:97671001-97671023 ATGGAGAACAAAAGTCAGGGAGG - Intronic
978160657 4:105543686-105543708 GTGAAGAAACTGAGTCAGGGAGG + Intergenic
978279169 4:106988929-106988951 ATTAAGGATCAAAGTCAGGGTGG + Intronic
978844780 4:113260175-113260197 GTGAAGAAGCAAAGTAAGAGTGG - Intronic
978886758 4:113773997-113774019 GTAAGGAAGCAAATTCAGGTAGG + Intergenic
979149380 4:117290196-117290218 GTGATGAAGCAAAGGTAGAGTGG - Intergenic
979662282 4:123270998-123271020 ATGAAGAAGCAAAGCCATGAAGG + Intronic
980066247 4:128191876-128191898 ATGAAGAAGCTGAGTCTGGGAGG + Intronic
981139787 4:141254685-141254707 GTGGAGGTGCAAAGTCAGTGGGG + Intergenic
982204824 4:152989799-152989821 GTGAAGAAGGCAAGACAGGAGGG + Intergenic
982222161 4:153134249-153134271 GTGCAGAAGAAAGGTGAGGGAGG - Intergenic
985394841 4:189531238-189531260 GTGGAGAAGCAAAGGCAGGTGGG + Intergenic
986003448 5:3648430-3648452 GGGAAGAAGGGCAGTCAGGGTGG + Intergenic
988621789 5:32830349-32830371 GTAAAGAAAGAAAGTCAGGTTGG - Intergenic
988644664 5:33081150-33081172 GTGAAGAAAGAAAGGAAGGGAGG - Intergenic
988915682 5:35891615-35891637 CTGAAAAAGAAAGGTCAGGGAGG + Intergenic
989444808 5:41514925-41514947 GTGCATGAGCAAAGTCATGGTGG - Intergenic
989713802 5:44434808-44434830 GTGAAGGAGTAAAGAGAGGGTGG + Intergenic
990539800 5:56760880-56760902 GTGACGGAGCAGAGTCAGCGAGG - Intergenic
992112595 5:73510072-73510094 GAGAAGGAGGAAAGTGAGGGAGG + Intergenic
992810496 5:80382971-80382993 GTAAACAAGTAAAGTCAGGTAGG - Intergenic
995017410 5:107326527-107326549 GTGAAGAAGGAAAGCCAGTAAGG + Intergenic
995737871 5:115322150-115322172 GTTAAGAAGCTAAGTCAAAGAGG + Intergenic
996185918 5:120475160-120475182 ATGAAGAAGCACAGACAGAGAGG + Intronic
996472239 5:123874471-123874493 CTGAAGAAACAAAGTCCAGGGGG - Intergenic
997732270 5:136190487-136190509 GTGAAGAATCAAGCCCAGGGAGG + Intergenic
998368053 5:141643938-141643960 GTGAAGAAACAAGCTCAGAGAGG + Intronic
999257012 5:150215349-150215371 GTGAAGCAGCAGATTCAGAGGGG - Intronic
1000302479 5:159968722-159968744 GGGAAGAAGTAGAGTGAGGGAGG - Intronic
1001214421 5:169842198-169842220 GTAAAGCAGGAATGTCAGGGTGG - Intronic
1001402738 5:171455595-171455617 CAGATGAAGCAAAGTCAAGGAGG - Intronic
1001519357 5:172379781-172379803 GCCCAGAAGCAAAGTGAGGGAGG + Intronic
1001683666 5:173576862-173576884 GTGGAGTGGCAAAGGCAGGGAGG + Intergenic
1001955285 5:175844546-175844568 TTGTATAAGCAAAGTCAGAGAGG + Intronic
1003114747 6:3276421-3276443 GTGAGGAAACAAAGTCTAGGGGG - Intronic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1005468270 6:26136724-26136746 GTGAAGAAAGAAAGGAAGGGAGG - Intronic
1006125874 6:31837731-31837753 GAGCAGCAGCAAAGGCAGGGAGG + Intronic
1007183993 6:39951862-39951884 GTGAACAAGAAAACTCAGAGTGG - Intergenic
1007819156 6:44547804-44547826 CTGAAGGAGAAAAGTCAAGGAGG - Intergenic
1007983965 6:46188848-46188870 GGGAAGAAGCCAAGCCAGGAAGG - Intergenic
1008862686 6:56169003-56169025 GTCAAGAAGAAAACTCTGGGGGG - Intronic
1009273914 6:61650510-61650532 GTGAATAAGCACAGTCAGATGGG + Intergenic
1009451671 6:63808302-63808324 ATGAAGAAGAAAAGTGAGAGTGG + Intronic
1011247241 6:85332260-85332282 ATGAAGCAGGAAAGACAGGGTGG - Intergenic
1011336389 6:86266093-86266115 GTCAGGAAGCAAAGCCAGTGAGG + Intergenic
1012684075 6:102221472-102221494 GTTAAGAAGCAAAGGCAGGCCGG - Intergenic
1012900794 6:105003805-105003827 TTGAAAAAACAAAGTCAGGCTGG - Intronic
1013088217 6:106874952-106874974 GAGAAGAAGTAAGGGCAGGGTGG + Intergenic
1016469706 6:144362235-144362257 GTGAAGGAGCCAACTGAGGGAGG + Intronic
1016844959 6:148560818-148560840 ATGAAGAAGAAATGTCATGGTGG - Intergenic
1016999752 6:149988555-149988577 GTGAGGAAGAAGAGTCAGGAGGG + Intergenic
1017006864 6:150033719-150033741 GTGAGGAAGAAGAGTCAGGAGGG - Intergenic
1017060432 6:150479345-150479367 CTGAATAAGCAAAGCCAGCGTGG - Intergenic
1017456135 6:154603285-154603307 GAGAAGAAGCTAAGTCAGGAAGG - Intergenic
1018013842 6:159694540-159694562 GTGAAAAAGGAAATTCAGGCTGG + Intronic
1018257656 6:161938466-161938488 TGGAAGAAGTAAAGTCAAGGAGG + Intronic
1019212877 6:170420863-170420885 GTCAAAAAGAAAAGTCAGGGAGG + Intergenic
1019406389 7:886282-886304 GTGGAGCAGCCAAGCCAGGGGGG - Intronic
1019754953 7:2762249-2762271 GTGACGACCCTAAGTCAGGGTGG - Intronic
1022770782 7:33470633-33470655 TAGAAGATGCAAAGCCAGGGAGG + Intronic
1023615168 7:42012378-42012400 GAGAAGAAGAAAAGGGAGGGGGG - Intronic
1023665155 7:42515173-42515195 GTGAATAAACAAAGCCAAGGAGG - Intergenic
1023890092 7:44385847-44385869 CTGGAGATGCAAGGTCAGGGTGG + Exonic
1024471105 7:49769560-49769582 GGGAAGAAGGAAAGGAAGGGAGG - Intergenic
1024846864 7:53654716-53654738 TTGAAGAAACAAAGTCACAGAGG - Intergenic
1025034866 7:55587745-55587767 TGGAGGAAGCACAGTCAGGGAGG - Intergenic
1027448733 7:78304706-78304728 GTGAAAAATCAAAGCCAGGAAGG + Intronic
1029568005 7:101351818-101351840 GTAAAGAAGAAAATTCAGGCTGG + Intergenic
1030069864 7:105689271-105689293 GGGAAGAATCAAAGTGAGGAAGG + Intronic
1030158689 7:106484642-106484664 CTGATGAGGCAAAGCCAGGGTGG + Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030328908 7:108252023-108252045 GTAAAGAATGAAATTCAGGGAGG + Intronic
1030440002 7:109577324-109577346 GTTAAGAAGACAAGTCAGTGAGG + Intergenic
1033227057 7:139570721-139570743 GTGAGGAAGTAAAGGGAGGGAGG + Exonic
1033387503 7:140892761-140892783 GTGGGGAAGTAAAGACAGGGAGG - Intronic
1033897580 7:146093716-146093738 GTGAAGAAACAAAGTGAGAAGGG + Intergenic
1034487525 7:151375122-151375144 GATAAGAGGCAAAGGCAGGGTGG - Intronic
1034960034 7:155359335-155359357 GTGAAAAAGGAAGGGCAGGGAGG - Intronic
1035403852 7:158586462-158586484 GTGCAGAAGCAAACGCAGGCGGG - Intronic
1035553728 8:548011-548033 GGGGAGAAGTAAAGTCAGGTTGG - Intergenic
1036993192 8:13623650-13623672 TTGAATAAGAAAAGTCAGGTGGG + Intergenic
1037067485 8:14600192-14600214 ATGAAGAAGACAAGGCAGGGAGG - Intronic
1038431745 8:27505758-27505780 GAGAAGAAGCAAAGTCCAGGAGG - Intronic
1040453582 8:47573595-47573617 GAGGAGAAGCAAAGTCTGGGAGG + Intronic
1040982134 8:53254810-53254832 ATCAAGAAGGAAAGGCAGGGAGG + Intergenic
1041391585 8:57351714-57351736 GGGAGGCAGCACAGTCAGGGAGG - Intergenic
1041600450 8:59711438-59711460 GTGAAGAAGCAGAGAGAAGGTGG + Intergenic
1043534328 8:81185376-81185398 GTGAATTAGCAAAATCATGGAGG + Intergenic
1044411693 8:91891346-91891368 GTGAAAAAGCAAAAGAAGGGTGG + Intergenic
1044486025 8:92755720-92755742 GGCAAGAAGGGAAGTCAGGGAGG + Intergenic
1044644232 8:94421072-94421094 TTGAAGAAGCAGAGGCAGTGTGG - Intronic
1044952090 8:97444824-97444846 GTGAAGAAACAAAGGCTGGCTGG + Intergenic
1045441551 8:102218244-102218266 GTGAAGGAGCAAGGCCAGTGCGG + Intronic
1045977553 8:108146805-108146827 GAGAAGAAGGAAAGACAGGAAGG - Intergenic
1048474354 8:134729989-134730011 GTCAAAATGCAAAGACAGGGAGG - Intergenic
1051477332 9:17522448-17522470 GTGAAGAATCAAGGTCAGGATGG - Intergenic
1051782605 9:20706648-20706670 ATGAAGAAACAATGTCAGAGAGG - Intronic
1051856199 9:21568566-21568588 CTGAAGAAACAATGTCGGGGAGG - Intergenic
1053065630 9:35066911-35066933 GTGAAAAAGAAAAGGCAGGATGG + Intronic
1057344052 9:94231987-94232009 CTGAAGAAACAAAGTGAGGTGGG + Intergenic
1057804809 9:98212447-98212469 GGGAGGAAGGAAAGTCAGGGAGG - Intronic
1059358272 9:113718297-113718319 CTGCAGAAGCGAAGGCAGGGAGG + Intergenic
1059454369 9:114390236-114390258 GTGCATGAGCAAAGGCAGGGAGG - Intronic
1059510948 9:114846172-114846194 GATAAGAAGAAAAGTAAGGGGGG + Intergenic
1059647315 9:116280219-116280241 GTGAAAAAGGAAGGCCAGGGAGG + Intronic
1059722869 9:116978287-116978309 GGCAGTAAGCAAAGTCAGGGCGG - Intronic
1060240019 9:121894973-121894995 GTTGAGAAGAAAAGTCAGCGGGG + Intronic
1060543518 9:124447423-124447445 GGGAAGAGGCACAGTGAGGGAGG + Intergenic
1062013511 9:134279905-134279927 GTGAAGGAGCAGGGCCAGGGAGG - Intergenic
1062606522 9:137351066-137351088 GTGGAGAAGCAGATTCTGGGCGG - Exonic
1203566767 Un_KI270744v1:98473-98495 GGGAAGAGGCAAGGTGAGGGAGG + Intergenic
1185595430 X:1303766-1303788 GTTAAGAACCAAAAACAGGGAGG + Intronic
1187585641 X:20658854-20658876 GAAAAGATGAAAAGTCAGGGTGG - Intergenic
1188291531 X:28394975-28394997 AAGGAGAAGCAAAGTCAGTGAGG + Intergenic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1188912502 X:35866770-35866792 GTGAAGAACCAAAGATAGAGGGG - Intergenic
1190517065 X:51234803-51234825 GGGAAGAAGCAGGGTCAGAGAGG + Intergenic
1192087468 X:68114902-68114924 GTAGAGATGCTAAGTCAGGGAGG + Intronic
1192309594 X:69998986-69999008 GATAAGAAACAAAGTCTGGGAGG - Intronic
1193559555 X:83001009-83001031 GTGTAAAGGCAAAGTTAGGGAGG + Intergenic
1195526248 X:105893385-105893407 GTGAAGAAGCAAAATATGGAGGG - Intronic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1196025179 X:111034400-111034422 GTGAAGAAGCAATGACAATGTGG - Intronic
1196071198 X:111524468-111524490 TTGAAGAAGCACAGTGAGTGAGG + Intergenic
1196086343 X:111686565-111686587 GAGAAGAGGGAATGTCAGGGTGG + Intronic
1196100822 X:111845376-111845398 GTGAAGAAGCATTGTCATGGTGG - Intronic
1197942520 X:131804147-131804169 GTCAAGGAGCAGAGTGAGGGGGG + Intergenic
1199170166 X:144726198-144726220 ATGAAGAGGCAAAGTCAGGAGGG - Intergenic
1199229805 X:145423612-145423634 GTGAAGGGGCAAAGCCAGGTAGG - Intergenic
1200001515 X:153063921-153063943 GTGAACTAGAAAAGTCAGCGAGG + Intergenic
1200976653 Y:9218740-9218762 TTGAAGGAGAAAAGGCAGGGTGG - Intergenic