ID: 969533320

View in Genome Browser
Species Human (GRCh38)
Location 4:7741191-7741213
Sequence CCTTATAGGCGAAGGGAACC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969533314_969533320 -7 Left 969533314 4:7741175-7741197 CCAGTTTTCTGCAGTTCCTTATA 0: 1
1: 0
2: 4
3: 74
4: 867
Right 969533320 4:7741191-7741213 CCTTATAGGCGAAGGGAACCGGG 0: 1
1: 0
2: 0
3: 7
4: 63
969533313_969533320 2 Left 969533313 4:7741166-7741188 CCAGATGTACCAGTTTTCTGCAG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 969533320 4:7741191-7741213 CCTTATAGGCGAAGGGAACCGGG 0: 1
1: 0
2: 0
3: 7
4: 63
969533311_969533320 29 Left 969533311 4:7741139-7741161 CCAGAAAGGTGGGTGGTGGAGAC 0: 1
1: 0
2: 1
3: 9
4: 174
Right 969533320 4:7741191-7741213 CCTTATAGGCGAAGGGAACCGGG 0: 1
1: 0
2: 0
3: 7
4: 63
969533310_969533320 30 Left 969533310 4:7741138-7741160 CCCAGAAAGGTGGGTGGTGGAGA 0: 1
1: 0
2: 1
3: 24
4: 271
Right 969533320 4:7741191-7741213 CCTTATAGGCGAAGGGAACCGGG 0: 1
1: 0
2: 0
3: 7
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969533320 Original CRISPR CCTTATAGGCGAAGGGAACC GGG Exonic
911080027 1:93919448-93919470 CCTTAAAGGTGAAGGGAACGTGG + Intergenic
915725180 1:158012083-158012105 TCTTATTGGGGAAGGGAAGCAGG - Intronic
915921779 1:159981193-159981215 CCTTATAAGAAAAGGAAACCAGG + Intergenic
920413962 1:205785195-205785217 CCTGATTGGCGAAGGCAGCCTGG + Intergenic
1067079092 10:43203552-43203574 CCTGCAAGGCGAAGGGAACCGGG - Intronic
1068485681 10:57655455-57655477 CCTTATAAGGGAAGGCAAGCAGG + Intergenic
1074561608 10:114540256-114540278 CCTTAGAGCCGAAGGGACTCCGG + Intronic
1076403031 10:130195620-130195642 CCTGATGGGCGATGGGAACCTGG - Intergenic
1083770485 11:64864289-64864311 CCTTCTGGGCACAGGGAACCTGG - Intronic
1084965844 11:72744028-72744050 TGTTCTAGGCAAAGGGAACCGGG - Intronic
1095310370 12:40691594-40691616 CCTTTTATGTGAAGGGAACAGGG - Intergenic
1101276190 12:103203962-103203984 GCTTATAGGGGAAAGTAACCTGG - Intergenic
1107699034 13:43028811-43028833 CCTACTAGGCAAAGGGAACTGGG - Intronic
1108848842 13:54704209-54704231 CCTCAAAGGCAAAGGGAAACTGG - Intergenic
1110742627 13:79015815-79015837 CCTTATAAGCCAAGAGAAACTGG - Intergenic
1111918738 13:94388756-94388778 CCTTATAAGAGAAAGGAACCAGG - Intronic
1123394036 15:19909123-19909145 TCTCATAGAAGAAGGGAACCGGG - Intergenic
1124201982 15:27686601-27686623 TCTTATAGGGGAAGGGAAGCTGG - Intergenic
1125685484 15:41560908-41560930 CCTTAGAGCCGGAGGGAACTTGG + Intronic
1129387911 15:75206159-75206181 CCTTGTAGGTGCAGGGATCCTGG - Exonic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1135887092 16:26320085-26320107 CCACAAAGGCTAAGGGAACCTGG - Intergenic
1138213772 16:55185095-55185117 CATTATAGATGAAGGGACCCAGG + Intergenic
1144453913 17:15403624-15403646 CCTTATGGGCCAAGATAACCAGG - Intergenic
1152069535 17:78128035-78128057 CCTTCTAAGCTCAGGGAACCCGG + Intronic
1166782174 19:45348548-45348570 CCTGACAGGCCCAGGGAACCTGG - Intronic
1167423025 19:49414887-49414909 CATAGTAGGCAAAGGGAACCAGG + Intronic
925955395 2:8959073-8959095 CCTTATAGTCTCAGGGAACTTGG - Intronic
926227792 2:10980790-10980812 CTTCATAGGCCAAGGGAAACAGG + Intergenic
936230031 2:110692511-110692533 CCTTACAGGAAAAGGAAACCTGG + Intergenic
946059658 2:216930785-216930807 CCTAATAGGGGAAGAGAAACTGG + Intergenic
948075229 2:235160688-235160710 CCTTATAGGAGGAGGGAGGCAGG - Intergenic
1169473000 20:5904430-5904452 CCTGAAAGCAGAAGGGAACCTGG - Intergenic
1172656311 20:36540927-36540949 CCTCAAAGGAGAAGGGGACCTGG - Intergenic
1184841980 22:47057384-47057406 CCTTCCAGGTGCAGGGAACCAGG + Intronic
1185385786 22:50530828-50530850 CCTGATAGGCGCAGGGGCCCGGG + Exonic
949559311 3:5187703-5187725 CCTTAAAGGGGAAGCGAGCCGGG + Exonic
950787767 3:15450228-15450250 CAGTAGAGGCGAAGGGAACAGGG + Exonic
952923789 3:38307156-38307178 ACCTATAGGCCAAGGGGACCTGG - Intronic
953800775 3:46020963-46020985 CCTCATAGGCGAAGGCACCAGGG + Exonic
960353872 3:116627433-116627455 CCTTATAGGCCAGGGGAGACTGG - Intronic
964143783 3:153434100-153434122 CCTTACAGGGTAAGGGGACCTGG - Intergenic
968108384 3:196020532-196020554 TCTTATAGACCATGGGAACCTGG + Intergenic
969533320 4:7741191-7741213 CCTTATAGGCGAAGGGAACCGGG + Exonic
976914697 4:90357619-90357641 ACTTATAGGAAAAGGTAACCAGG + Intronic
977978231 4:103292487-103292509 CCTTATAGCCGAAGCCAGCCAGG - Intergenic
979773250 4:124556049-124556071 CCCGCAAGGCGAAGGGAACCAGG + Intergenic
981900768 4:149859301-149859323 CCTCAAAGGTCAAGGGAACCGGG + Intergenic
984069532 4:175094000-175094022 CCCTATAGGGGAAGGTAAGCGGG + Intergenic
985470316 5:38155-38177 TCTTATAGACCATGGGAACCAGG + Intergenic
985894398 5:2740045-2740067 CCTTATAGGGGAATGCAGCCAGG - Intergenic
988787285 5:34576866-34576888 TCTTATGGGAGAAGGGAATCAGG - Intergenic
1003342402 6:5234380-5234402 CCTTATAGCCTAAGGGCACCTGG - Intronic
1004049196 6:12058453-12058475 TCTTATAGCTGAAAGGAACCTGG + Intronic
1006101557 6:31689033-31689055 CCTTCAAGGCCAAGGGCACCAGG + Exonic
1006117772 6:31784406-31784428 CCTTATAGGCAAAGGACACGAGG + Exonic
1006788760 6:36685149-36685171 CCTTTTAGGGCAAGGAAACCAGG + Intronic
1024022413 7:45384259-45384281 CCTTAAAGGAGAAGGAAATCTGG - Intergenic
1024086995 7:45902038-45902060 GCTTAGAGGGGAAGGGAACAAGG - Intergenic
1025306507 7:57865132-57865154 TCTTATAGAAGAAGGGAACTGGG + Intergenic
1027244556 7:76358557-76358579 CCCGAGAGGCGACGGGAACCCGG - Intronic
1037734537 8:21555770-21555792 CCTTAGAGGAGAAGGGAAAGTGG - Intergenic
1042458994 8:69040203-69040225 TCTTATAGGCAGAGAGAACCTGG - Intergenic
1044055902 8:87569544-87569566 CCTTATAGGCCTAGAGAACTAGG + Intronic
1050152176 9:2627909-2627931 CCTCATAGGCCTAGGGAACAGGG + Intronic
1050997910 9:12243037-12243059 TCTTATAGGAAAAGGTAACCAGG + Intergenic
1054907402 9:70422882-70422904 GCCTAGAGGGGAAGGGAACCTGG - Intergenic
1060775582 9:126371419-126371441 CCTGATGGCCGAAGGGAGCCAGG - Intronic
1187285445 X:17899371-17899393 CCTTATAGGTGTAGGGAACGGGG + Intergenic
1192901448 X:75502254-75502276 CCTTATAGGGAAAGGAAATCTGG - Intronic
1193972431 X:88071662-88071684 CCTTATAAACAAAGGGAATCGGG + Intergenic