ID: 969533525

View in Genome Browser
Species Human (GRCh38)
Location 4:7742036-7742058
Sequence CTTTGGGTCTGGGGGACAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 431}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969533525_969533534 6 Left 969533525 4:7742036-7742058 CCACCTGTCCCCCAGACCCAAAG 0: 1
1: 0
2: 1
3: 37
4: 431
Right 969533534 4:7742065-7742087 CCCCACCCTACCTGCCCACCTGG 0: 1
1: 1
2: 9
3: 69
4: 507
969533525_969533538 8 Left 969533525 4:7742036-7742058 CCACCTGTCCCCCAGACCCAAAG 0: 1
1: 0
2: 1
3: 37
4: 431
Right 969533538 4:7742067-7742089 CCACCCTACCTGCCCACCTGGGG 0: 1
1: 0
2: 4
3: 25
4: 363
969533525_969533536 7 Left 969533525 4:7742036-7742058 CCACCTGTCCCCCAGACCCAAAG 0: 1
1: 0
2: 1
3: 37
4: 431
Right 969533536 4:7742066-7742088 CCCACCCTACCTGCCCACCTGGG 0: 1
1: 1
2: 4
3: 54
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969533525 Original CRISPR CTTTGGGTCTGGGGGACAGG TGG (reversed) Exonic
900183765 1:1323904-1323926 CTTGGGGGCTGGGGGACTGGGGG + Intronic
900396847 1:2456590-2456612 CCTTGGGGTTGGGGGACATGGGG + Intronic
901004443 1:6165184-6165206 CCTGGGGGCTGGGGGCCAGGGGG - Intronic
901154607 1:7127101-7127123 CATGGGGCCTGGGAGACAGGGGG + Intronic
901601162 1:10424387-10424409 CCTTGAGTCTGGGGGACTTGCGG - Intergenic
901929474 1:12587846-12587868 CTCGGGGGCTGGGGGACAAGGGG - Intronic
902177456 1:14661646-14661668 CTTTGGGATTGGGGGACGGGGGG + Intronic
902229057 1:15015865-15015887 ATTGGGGACTTGGGGACAGGTGG - Intronic
902341455 1:15786006-15786028 GTTTGTGTTTGGGGGAGAGGGGG - Intronic
903032622 1:20474874-20474896 TGTTGGGACTGGGGGAAAGGAGG - Intergenic
903580308 1:24365811-24365833 CTGTGGGCCTGGGGGAAGGGAGG - Intronic
903677629 1:25074399-25074421 CATTGGGCCTGGGGCACAGTTGG + Intergenic
903795710 1:25927548-25927570 CTGTGAGTCTGGGAGTCAGGGGG + Intergenic
904111291 1:28128568-28128590 CTTCTGGTCTGGTGGACAGGAGG - Intergenic
904311562 1:29632733-29632755 CTTGGGGGCTGGGGGACTGAGGG - Intergenic
904456440 1:30651065-30651087 CTGTGGGTCTGGGTGCCAAGTGG - Intergenic
904833722 1:33321425-33321447 CTTTGGTTCTTGGGAACAGCTGG + Intergenic
904839391 1:33362307-33362329 CTGTGAGTCTGGGGTGCAGGAGG + Intronic
905282964 1:36860670-36860692 CTCTGGGTCTGGGGGCAGGGTGG + Intronic
905771137 1:40638724-40638746 CTTTGGGTCCAGGACACAGGTGG - Intronic
906423378 1:45688729-45688751 ATTTTGGTCTGGGGCTCAGGTGG + Intronic
909129440 1:71715884-71715906 CTTTGGAACTGGGTAACAGGCGG - Intronic
910040673 1:82848215-82848237 CTTAGAGTCTGGGGGCCAAGAGG - Intergenic
910717176 1:90244760-90244782 CTATGGGTCTTGGAGAAAGGAGG + Intergenic
912579243 1:110705357-110705379 CTTTGGAACTGGGTAACAGGCGG - Intergenic
912963024 1:114212966-114212988 CTTTAGGTGGGTGGGACAGGTGG - Intergenic
913101623 1:115572960-115572982 CTTTGGAACTGGGTAACAGGTGG + Intergenic
915466658 1:156102328-156102350 CTCTGGGCCTGGGGTACAGAGGG + Intronic
915682751 1:157597263-157597285 GTTGGGGTCTGGGGATCAGGTGG + Intronic
915908867 1:159899987-159900009 AGTTGGGTCTAGGGGTCAGGAGG - Intronic
916839176 1:168582531-168582553 CTTAGGGTCTGGGAGACATTTGG - Intergenic
917443138 1:175084275-175084297 ATTTGGGTGTTGGGGACAGGAGG + Intronic
917629680 1:176879561-176879583 CTTGGGGGCGGGGGGAGAGGTGG - Intronic
919091037 1:192979278-192979300 GGTTGGGACTGAGGGACAGGTGG + Intergenic
920123476 1:203675843-203675865 CCTTGGGTCTCTGGGAAAGGGGG + Intronic
920312797 1:205058382-205058404 CTTTGGGGGAGGGGGAGAGGGGG + Intronic
920385525 1:205568524-205568546 CTTCTGTTCTGGGGGAAAGGGGG + Intergenic
920597829 1:207291051-207291073 CTTTGGAACTGGGTAACAGGCGG + Intergenic
921122208 1:212147057-212147079 CTGTGGGTGTGGGGTACAGTAGG - Intergenic
923465675 1:234246187-234246209 CTTGGGGTTTGGGAGGCAGGAGG + Intronic
923521579 1:234739028-234739050 TTTTGGGTCAGGGGGACCAGAGG + Intergenic
1064292359 10:14047590-14047612 CTTTGGGTTCTGGGAACAGGAGG - Intronic
1065123825 10:22553890-22553912 CTTTGGGACTCTGAGACAGGAGG + Intronic
1065536030 10:26715638-26715660 CTTTGGGAGGGGGAGACAGGCGG - Intronic
1065769955 10:29068943-29068965 CTTGAGACCTGGGGGACAGGGGG - Intergenic
1066415044 10:35213957-35213979 GCTTGGGTCTGGAGGACAGAGGG + Intergenic
1069615724 10:69805033-69805055 CTTTGAGGCTGGGGGCCAGAGGG + Intronic
1069762344 10:70820391-70820413 CTTTGGCAATGGGGGACTGGGGG + Intronic
1069846450 10:71375165-71375187 CTTAGGGTCGGTGGGGCAGGTGG - Intergenic
1070483727 10:76910235-76910257 CTTTGGGTAAGGGGGGCAGTGGG + Intronic
1070638587 10:78149081-78149103 CTTTGGCTCTGGGGTGCATGTGG + Intergenic
1070790870 10:79188611-79188633 CTAGGGGGGTGGGGGACAGGAGG - Intronic
1071124446 10:82318058-82318080 CTTTGTGTCTGGTGGGCAGGGGG + Intronic
1072366187 10:94712339-94712361 CTTGGGGGCGGGGGGAAAGGGGG - Intronic
1072963303 10:99950419-99950441 CTTTGGAACTGGGTAACAGGCGG + Intronic
1073056719 10:100707863-100707885 CTTTGGGGCTGGAAGACAGACGG - Intergenic
1074479034 10:113801636-113801658 CTTTGGGGCAGGCGGACATGGGG - Intergenic
1074769628 10:116724898-116724920 TTCAGGGTCTGGGGGCCAGGTGG - Intronic
1075179068 10:120194098-120194120 GTTGGGGGATGGGGGACAGGGGG - Intergenic
1075813324 10:125244830-125244852 CTGTGGGTGTGGGTGACAGTTGG + Intergenic
1075879373 10:125837186-125837208 CTTTGGGTAGGGGAGAGAGGGGG + Intronic
1076317595 10:129553485-129553507 CTGTGGGCCCGGGGGACACGTGG + Intronic
1076514430 10:131035834-131035856 CTTTGGGGATGGGGAACGGGAGG + Intergenic
1076525928 10:131112389-131112411 GTGGGGGCCTGGGGGACAGGGGG - Intronic
1076744046 10:132503945-132503967 CTGGGGGTGTGGTGGACAGGTGG - Intergenic
1076772667 10:132675055-132675077 CTTTGGGTATGGAGGACTGAGGG - Intronic
1077908732 11:6556668-6556690 CTCTGGGTCTATGGGACATGAGG - Exonic
1078918399 11:15802867-15802889 GTTGGGGGGTGGGGGACAGGGGG - Intergenic
1079355109 11:19724172-19724194 CTTTGGAGCTGGGTGACTGGAGG - Intronic
1080163900 11:29213652-29213674 CTTTGGATTTGGAGAACAGGAGG - Intergenic
1081364891 11:42222494-42222516 GTTGGGGGCTGGGGGACAAGTGG + Intergenic
1081577515 11:44328371-44328393 CTCTGGGCCTGGGGGAGAGGAGG - Intergenic
1081660098 11:44882820-44882842 CCTTGGGTCTGGGGGTCTGGGGG - Intronic
1081962957 11:47151775-47151797 CTTTCTTTCTGGGGGACATGTGG - Intronic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG + Exonic
1083697186 11:64450600-64450622 CTTTGAGCCTGGTGGTCAGGAGG - Exonic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1084288625 11:68147477-68147499 ACTTGGGGCTGGGGGCCAGGAGG + Intergenic
1085339915 11:75724347-75724369 ATTTGGGTCCAGGGGACAGATGG + Intronic
1086152314 11:83625520-83625542 CTTTTGTTCTGGGGGAAGGGTGG - Intronic
1088764545 11:112962789-112962811 CTTTGGCTCTGATGGACGGGAGG + Intronic
1089461319 11:118655978-118656000 CCTTGGGCCTGGGGGAAGGGAGG - Intronic
1090635706 11:128689492-128689514 CCTTTCGTCCGGGGGACAGGCGG - Intronic
1096886981 12:54727909-54727931 CTTTGGAACTGGGTAACAGGAGG - Intergenic
1098465644 12:70783642-70783664 CTCTGGGTCTGCAGGACTGGCGG + Intronic
1099742297 12:86655180-86655202 ATTGGGGGCTGGGGGACAGGGGG - Intronic
1101580056 12:106034705-106034727 CATTGGTTTTGGGGAACAGGTGG + Intergenic
1102173604 12:110860283-110860305 CAGTGGGTCTGGGGGGCAAGTGG + Intronic
1103047288 12:117747429-117747451 GTTGGGGGGTGGGGGACAGGGGG + Intronic
1103785009 12:123426050-123426072 CTTTGGGAGTTTGGGACAGGAGG - Intronic
1103917579 12:124383999-124384021 CGTGGGGTGAGGGGGACAGGCGG + Intronic
1104477610 12:129083550-129083572 CTGTGGGTCTCAGGGACAGTTGG - Intronic
1104543118 12:129685661-129685683 TCTAGGGTCTGGGGGACAGTTGG - Intronic
1104600613 12:130150883-130150905 ATTTGGGTCTGGGGAGCTGGGGG - Intergenic
1104808156 12:131602743-131602765 CTTTGGAACTGGATGACAGGTGG - Intergenic
1106508443 13:30392193-30392215 CTGTTTGTCTGGGGGAAAGGAGG - Intergenic
1107298919 13:38945613-38945635 TTTTGGCTCTGGAGGACAGATGG - Intergenic
1107298935 13:38945706-38945728 TTTTGGCTCTGGAGGACAGATGG - Intergenic
1109297609 13:60553406-60553428 CTTTGGAACTGGGTAACAGGCGG - Intronic
1109923714 13:69106139-69106161 CCTTGGGTTTGGTGGACAGGTGG - Intergenic
1110342070 13:74403330-74403352 CTTTGGAACTGGGTAACAGGTGG - Intergenic
1112265548 13:97920224-97920246 CGGTGGGAGTGGGGGACAGGGGG - Intergenic
1112759033 13:102672355-102672377 GGTTGGGTTTTGGGGACAGGAGG + Intronic
1113950901 13:114070186-114070208 CTTGGGGGCTGGGAGACTGGGGG + Intronic
1114527058 14:23373062-23373084 GTTTGGGGCTGGGGGCCAAGTGG + Exonic
1114646977 14:24261270-24261292 CCTTGGGTCATGGGGACAGAGGG + Intronic
1115099301 14:29678547-29678569 CTTTGGGTGGGAGGGGCAGGTGG + Intronic
1118319904 14:64747004-64747026 CTTGGAGCCTGGGTGACAGGAGG + Exonic
1118375249 14:65171151-65171173 CAGTGGGGCTGGGGGACATGAGG + Intergenic
1118378861 14:65201446-65201468 CTTTGGGTCAAAGGGCCAGGTGG + Intergenic
1118480831 14:66163658-66163680 CTTTGGGGATGGGGGGCTGGAGG - Intergenic
1119067302 14:71541983-71542005 CTTTGGGGTTAAGGGACAGGAGG + Intronic
1119182722 14:72615250-72615272 CTTTGGGTCTGTGTGTGAGGAGG - Intergenic
1119924924 14:78484515-78484537 CTTTTTTTCTGGGGGAGAGGGGG + Intronic
1121338654 14:93092319-93092341 CCTCAGGTCTGGGGGTCAGGAGG - Intronic
1121586860 14:95068547-95068569 CTTGGGGACTGGGGGACAGCTGG + Intergenic
1121625680 14:95384076-95384098 CTCTGGGACAAGGGGACAGGAGG + Intergenic
1122564809 14:102645590-102645612 CTTTGGGGCTGGGTGGCAGGTGG - Intronic
1122877950 14:104677457-104677479 CTAGGGCTATGGGGGACAGGAGG + Intergenic
1123631196 15:22260833-22260855 CCTTGGGGCTGGGGGGGAGGGGG - Intergenic
1123827826 15:24101309-24101331 GTGTGGGTCTGGGAGAAAGGAGG + Intergenic
1124530434 15:30500750-30500772 ATTTGTGTCTGGAGGGCAGGGGG - Intergenic
1124768225 15:32506938-32506960 ATTTGTGTCTGGAGGGCAGGGGG + Intergenic
1125244453 15:37618974-37618996 CTTGGGGGGTGGGGGACTGGGGG - Intergenic
1125323700 15:38514963-38514985 ATTTGGGTCTGGGGTACTGAGGG + Intronic
1125584962 15:40813531-40813553 GTCTGGGTCTGGGTCACAGGAGG - Intronic
1126398376 15:48243412-48243434 CTTTGGGAGGGGGAGACAGGTGG + Intronic
1126469113 15:48988117-48988139 CTTTGGGAATGTGGAACAGGAGG - Intergenic
1127932359 15:63605360-63605382 TCTTGGGACTGGGGGATAGGGGG + Intergenic
1127960555 15:63887377-63887399 CTTTGGGACTAGGGGACCTGGGG - Intergenic
1128996986 15:72304627-72304649 CCCTGGGTCAAGGGGACAGGTGG - Intronic
1130284522 15:82543876-82543898 ATTTGTGTCTGGGGGACTGCTGG - Exonic
1130292776 15:82618925-82618947 CTTTGTGTATGTGGGGCAGGGGG + Intronic
1131502114 15:92978412-92978434 CTTTAGGGTTGGGGGCCAGGGGG + Intronic
1132246426 15:100299821-100299843 TTTGGGGACTGGGGGAGAGGTGG - Intronic
1132333385 15:101027623-101027645 CTGGGGATCTGGGGGACAGTTGG - Exonic
1132554515 16:566663-566685 CCTTGGGTCTGGACCACAGGCGG - Intergenic
1132559827 16:588579-588601 CTTCAGCTCTGGGGGACGGGAGG + Intergenic
1132647819 16:1007180-1007202 CTTTGGTGCTGGGGGACAGAGGG + Intergenic
1132751927 16:1461572-1461594 CTCAGGGTCAGGGGGACAGAAGG + Intronic
1133320884 16:4913200-4913222 CTGTGGTTCTGGGGGACGGGGGG - Intronic
1134196269 16:12161632-12161654 TATTGGGTCACGGGGACAGGTGG + Intronic
1135756206 16:25100428-25100450 CTTATGGACTAGGGGACAGGGGG + Intergenic
1136605519 16:31331044-31331066 CTGGGGTTCTGGGGGACATGAGG + Intronic
1137875594 16:51993755-51993777 CTTTGGGAGTCTGGGACAGGTGG - Intergenic
1139133761 16:64177570-64177592 CTTTGGAACTGGGTAACAGGCGG + Intergenic
1139138490 16:64233460-64233482 CTTTGGGTTTGGGGGGCTGAAGG + Intergenic
1139339544 16:66259168-66259190 GTGTGGGTCCCGGGGACAGGTGG - Intergenic
1139472788 16:67187194-67187216 CTTTGGGGCAGCGGGACATGGGG - Intronic
1139527252 16:67524663-67524685 CTTTGGGCCTGGGTGATGGGTGG - Intronic
1139957501 16:70700158-70700180 CTTTGGGGCTGGGGGTGGGGAGG - Intronic
1140063946 16:71594121-71594143 CTTTAGGTCTAGAGGGCAGGAGG - Intergenic
1141062807 16:80889938-80889960 GTATGGATTTGGGGGACAGGGGG + Intergenic
1141132674 16:81445993-81446015 CTTTGGGTTTGGGGGTTTGGAGG - Intronic
1141702101 16:85647216-85647238 CTTTGGGCCTGGGTGACTGGTGG - Intronic
1142198762 16:88751143-88751165 CTTGGGGACTGAGGGGCAGGTGG - Intronic
1142361459 16:89629583-89629605 CTGGGGTTCTGGGGGACAGTGGG - Intronic
1142420729 16:89967905-89967927 CTGTGGGTCTGTGGCACAGCAGG + Exonic
1142682929 17:1561263-1561285 CCAGGGGACTGGGGGACAGGTGG - Intronic
1143023833 17:3929769-3929791 ATTAGGGTCTGGGGGTCAGTGGG - Intronic
1143256660 17:5562551-5562573 CTGTGTGTGTTGGGGACAGGGGG - Intronic
1143352418 17:6298437-6298459 CATTGTGTGTGGGGGACAAGTGG - Intergenic
1143880389 17:10025415-10025437 CTTGGGGACTGGGAGACAGGAGG - Intronic
1144463311 17:15476099-15476121 TTTTGGGACTGGGTGACATGTGG - Intronic
1144466702 17:15502934-15502956 CTTTGGGCCTGGAGGGGAGGTGG - Exonic
1144511810 17:15883480-15883502 CTGTGGTTCTGGAGGAGAGGAGG + Intergenic
1144787832 17:17841665-17841687 CTTTGGGTCCTGGGGGCAGCGGG - Intergenic
1145016647 17:19403132-19403154 CACTGGGCCTGGGGGACAGGAGG + Intergenic
1145045710 17:19614046-19614068 CTTTTGTTTTGGGGGATAGGTGG - Intergenic
1146624397 17:34424693-34424715 CTTTGGGTTTGGGGGCTTGGTGG - Intergenic
1147638073 17:41975988-41976010 AAATGGGTCTGGGGGTCAGGAGG + Exonic
1147728589 17:42582314-42582336 ATGTGGGGCTGGGGCACAGGAGG - Intronic
1147907409 17:43832436-43832458 CTTGGGGGGTCGGGGACAGGGGG - Intronic
1148214925 17:45829345-45829367 CTCTAGGTCCTGGGGACAGGAGG - Intronic
1148688817 17:49515110-49515132 CTTTTGGTGTGGGGGAAAAGAGG - Intergenic
1148804399 17:50257111-50257133 CTCTGAGCCTGGGGGACAGCAGG + Intergenic
1148823505 17:50375369-50375391 CTCTGGTGCTGGAGGACAGGAGG - Exonic
1148831913 17:50438808-50438830 CTTTGGGAGTCGGAGACAGGTGG - Intronic
1149138542 17:53400776-53400798 CTTTGGGTTTGGGGGAAGGAAGG - Intergenic
1149524101 17:57340644-57340666 CTGTGGTTCTGGGGGATGGGAGG + Intronic
1150239790 17:63622465-63622487 CTGCGGGTCTGAGGGACTGGCGG + Exonic
1150284873 17:63949007-63949029 CACTGGGGCTGGGGGCCAGGAGG - Intronic
1152420210 17:80188704-80188726 TTTGGGGTCTGGGGAACAGCAGG - Intronic
1152691559 17:81720414-81720436 CTTTGGGCATCGGGGGCAGGAGG - Exonic
1152827656 17:82477755-82477777 CTTTGGGACTGTGAGGCAGGCGG - Intronic
1153012092 18:548443-548465 CTTTGGAACTGGGTAACAGGCGG - Intergenic
1153465996 18:5388461-5388483 CTTGGGGTGTGGGGAGCAGGGGG + Intergenic
1153660061 18:7318098-7318120 CTGTGGGCCTGGGAGACAGAAGG - Intergenic
1155073833 18:22338365-22338387 GTTTGGGGATGGGGGACTGGAGG + Intergenic
1155160643 18:23192742-23192764 CTTTGCGTGTGTGTGACAGGTGG + Intronic
1155828974 18:30487635-30487657 CAATGGGCCTGGGGCACAGGAGG + Intergenic
1156088674 18:33440291-33440313 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156088678 18:33440299-33440321 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156088682 18:33440307-33440329 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156088686 18:33440315-33440337 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156454717 18:37286549-37286571 CTGTGGGTCAGAGGGGCAGGGGG - Intronic
1156622718 18:38872283-38872305 CAGGGGGTCTGGGGGTCAGGGGG - Intergenic
1156678533 18:39561207-39561229 CCCTGGATCTGGGAGACAGGAGG - Intergenic
1157112201 18:44832079-44832101 CTTTGGCTCTGGAGAACAGGTGG + Intronic
1157501939 18:48196950-48196972 CATTGGTTGTGGGGGCCAGGTGG - Intronic
1158767653 18:60474242-60474264 TGTTGGGTGTGGGGGACAAGGGG + Intergenic
1158877384 18:61746105-61746127 CTTTGGGTCTTGGGATCTGGTGG + Intergenic
1159606005 18:70476055-70476077 TTTTGGTTCTTGGGGACATGTGG + Intergenic
1160337671 18:78057150-78057172 CTTTGGAACTGGGTAACAGGGGG + Intergenic
1160825373 19:1077834-1077856 CTGTGGGTGTGGGAGCCAGGAGG - Intronic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1161398787 19:4058680-4058702 CTGCTGGGCTGGGGGACAGGAGG - Intronic
1161614929 19:5264860-5264882 CGTTGGCTCTGGGGGAGTGGGGG - Intronic
1162110555 19:8397556-8397578 TTCTAGGACTGGGGGACAGGAGG + Intronic
1162794452 19:13079271-13079293 GGCTGGGTCTAGGGGACAGGTGG + Intronic
1162808400 19:13150699-13150721 GCTAGGGTCTGGGGGAGAGGTGG + Intronic
1162904578 19:13816114-13816136 ATATGGGGGTGGGGGACAGGAGG + Intronic
1163220677 19:15917368-15917390 ATTTGGGGGTGGGGTACAGGTGG - Intronic
1163268753 19:16236477-16236499 GTTTAGGTTTGGGGGCCAGGTGG + Intronic
1163628109 19:18402342-18402364 CTTGGGGTCTGGGGGTCCAGGGG + Intergenic
1163655402 19:18542805-18542827 CTTGGGGCCTGGGGGACGGAGGG - Intronic
1164695046 19:30237116-30237138 GTGTGGATCTGGGGGACAGCAGG + Intronic
1164854708 19:31511986-31512008 CTTTGGGCCTGGGTGCCTGGTGG - Intergenic
1165250033 19:34523676-34523698 ATGTGGGTCTGGTGCACAGGTGG + Intergenic
1166993086 19:46704877-46704899 TTCAGGGTCTGGGGGACAGATGG - Intronic
1166993116 19:46704996-46705018 TTCAGGGTCTGGGGGACAGATGG - Intronic
1167599109 19:50443688-50443710 CTGTGGGGCAGGGGGACAGGAGG - Intronic
1167671562 19:50856491-50856513 CCTTGGGACTGGGGGAGAGAGGG + Intronic
1168237335 19:55071575-55071597 CTTTGGGTCTGAGGGAGGAGGGG - Intergenic
1168238055 19:55075963-55075985 CAATGGGTCTGAGGGACGGGGGG + Intronic
925945168 2:8855308-8855330 CTTGGGGTCTACAGGACAGGTGG + Exonic
926012200 2:9417236-9417258 CTGTGTGTTTGGGGGACAGCAGG - Intronic
926336817 2:11869700-11869722 CTCAGGGTCTGGATGACAGGAGG - Intergenic
926766078 2:16323853-16323875 CTTTGGTTCTGGTAGACAGACGG + Intergenic
926871228 2:17419932-17419954 CTTTGTATCTTGGGGACTGGAGG + Intergenic
928827756 2:35441218-35441240 GGTTGGGACTGAGGGACAGGCGG + Intergenic
931366138 2:61620781-61620803 CTTTGGGACTAGGTGGCAGGTGG - Intergenic
931366854 2:61626733-61626755 TTCTGGGTGTGGGGGACAGCAGG - Intergenic
931528396 2:63185394-63185416 ATTTGGGGGTGGGGGAGAGGGGG - Intronic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
933064947 2:77781026-77781048 CTTTGGAACTGGGTAACAGGCGG + Intergenic
933808175 2:86015137-86015159 CTTTGCGCCTGGGAGCCAGGTGG + Intergenic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
935989241 2:108704714-108704736 CTGGGGATATGGGGGACAGGTGG - Intergenic
938195531 2:129324307-129324329 TTTTGGCTCTGAGGGACAGAGGG - Intergenic
938850056 2:135250922-135250944 TCTGGGGTCTGGAGGACAGGTGG - Intronic
942364959 2:175215757-175215779 TTGTGGGTTTGGGGGAGAGGCGG - Intergenic
944675673 2:202033245-202033267 CTTTGGGTCCGGGGGGAAAGAGG + Intergenic
945043685 2:205763742-205763764 CTTCGGGGCAGGTGGACAGGGGG - Exonic
945120898 2:206455975-206455997 CTTTGGAACTGGGTAACAGGCGG - Intronic
946108352 2:217391762-217391784 CTTTGGAACTGGGTAACAGGCGG - Intronic
946179155 2:217939691-217939713 CCCTGGGTGTGGGAGACAGGAGG - Intronic
946440413 2:219690472-219690494 CTTTGAGCCTGGGGCCCAGGCGG + Intergenic
946618045 2:221530684-221530706 ATTTGGGTTTGGGGGACACATGG + Intronic
946902286 2:224384145-224384167 CTGTGGGACTGGGTGACAGAGGG - Intronic
948515026 2:238498328-238498350 CATGGGGACTGGGGGAAAGGTGG + Intergenic
948527155 2:238578231-238578253 ATTTGGGTTAGGGTGACAGGTGG - Intergenic
948630131 2:239297094-239297116 CCTTGGGTCAGGGGCACGGGTGG + Intronic
1169254186 20:4084829-4084851 CTCTGGGTCTGATGGTCAGGAGG + Intergenic
1170696660 20:18665216-18665238 AGTTGGGGCTGGGGGCCAGGGGG + Intronic
1170770483 20:19328270-19328292 CTTAGGGTCTTGGGGGCTGGTGG + Intronic
1173127833 20:40356351-40356373 ATGTGGGACTTGGGGACAGGAGG + Intergenic
1173904916 20:46619555-46619577 CTGTGAGTCTGGGGGCCATGGGG - Intronic
1174054486 20:47788509-47788531 CTGTGGGCCTGGCGGACACGTGG + Intergenic
1174292634 20:49519775-49519797 GTTTGGGCCTGAGTGACAGGAGG - Intronic
1174411757 20:50341053-50341075 ATGTGGGACTGTGGGACAGGAGG - Intergenic
1174484977 20:50855469-50855491 ATTGTGGCCTGGGGGACAGGGGG - Intronic
1175518961 20:59587558-59587580 CTGTGGGTCAGGGGTGCAGGTGG + Intronic
1176139366 20:63538293-63538315 CTCAGGGGCTGGGGGGCAGGCGG - Intergenic
1177515581 21:22147414-22147436 CTTTGGAACTGGGTAACAGGAGG + Intergenic
1179461669 21:41539546-41539568 GTTTGGGTCTAGGGGTCATGGGG + Intergenic
1180589128 22:16921329-16921351 CTCTGGGTCTGCAGAACAGGAGG - Intergenic
1181116431 22:20635014-20635036 CTTGGGGACTTGAGGACAGGGGG - Intergenic
1181419891 22:22790421-22790443 CTCTGGGTCTGAGGGAGAGTTGG + Intronic
1182141739 22:27965476-27965498 GGGTGGGTCTGGGGGACAGAAGG - Intergenic
1182774851 22:32823472-32823494 CTTTGGGGCTGGGACACAGACGG - Intronic
1183315939 22:37136811-37136833 CTATGTGTCTGGGGAGCAGGAGG - Intronic
1183321369 22:37167068-37167090 CTCTGAGTCTGGGGGTTAGGTGG - Intronic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
1183629553 22:39025020-39025042 CTCTGGGACGGGGGAACAGGAGG - Intronic
1183717670 22:39543361-39543383 CTTTGGGTCGGGGAGGCAGGGGG - Intergenic
1183745237 22:39688088-39688110 CTTTTGGGCTGAGGGAGAGGGGG + Exonic
1183815266 22:40294717-40294739 ATTTGAGTCTGGGGGAAAGGAGG - Intronic
1184341839 22:43890597-43890619 CAGTGGTTCTGGGGGGCAGGCGG - Intronic
1184609077 22:45590925-45590947 GTTTGGGTCGGGGGCCCAGGAGG + Intronic
1184977139 22:48070290-48070312 GTCTGGGTCTGGGGGAGAGTAGG - Intergenic
950240580 3:11366371-11366393 CCTTGTGTGTGGGGGACAGAGGG - Intronic
950312413 3:11970118-11970140 CTTTGTGTGTGGGGGAGAGGAGG - Intergenic
950376887 3:12579684-12579706 TTTTGTGTCTGGGGGACACTGGG + Intronic
951750632 3:26031259-26031281 CCTTGGGTCTTGGGGAAAGATGG + Intergenic
952648250 3:35689031-35689053 GTCTGGGTGTGGGGGAGAGGTGG - Intronic
954154029 3:48674818-48674840 CCTGGGGTCTGTGGGACAGTGGG - Intronic
954239861 3:49285078-49285100 TTTTGGGGCTGGGGGTCAGAAGG - Intronic
955340906 3:58124281-58124303 TTTTGGGTCTGGGGTACTGGTGG + Intronic
955623155 3:60887778-60887800 AATTTGGTGTGGGGGACAGGAGG + Intronic
956006410 3:64783123-64783145 ATTGGGGTGTGGGGGACAAGGGG + Intergenic
956170818 3:66432155-66432177 CTTTGTGCCTGGTGGACTGGTGG - Intronic
957160418 3:76602301-76602323 CTTTGGAACTGGGTAACAGGCGG - Intronic
957436713 3:80187124-80187146 CTTGGGGGGTGGGGGACAAGGGG - Intergenic
957675357 3:83357252-83357274 GGTTGGGTCTGAGGGGCAGGTGG + Intergenic
957914613 3:86672219-86672241 CTGGGGGACTGGGGGAAAGGAGG - Intergenic
958581587 3:96032466-96032488 CTTTGTGTGTGGGGGAGAGTAGG + Intergenic
958609883 3:96411195-96411217 CTTTGGAACTGGGTGACAGGGGG - Intergenic
960997656 3:123350529-123350551 CTCTGGGGCTGAGGGCCAGGAGG + Intronic
961178885 3:124860480-124860502 CTTTGGGTTTGGGAGAAAGCTGG + Intronic
961313055 3:126016110-126016132 CTTTGAGTCTTGGGGAGAAGAGG - Intronic
961479983 3:127173415-127173437 GTCTGGGTCTGGGTGGCAGGGGG - Intergenic
961673661 3:128551876-128551898 CTTAGGGTCTGGGACACAGAAGG - Intergenic
962093936 3:132274471-132274493 GAATGGGTCTGGGAGACAGGAGG - Intronic
962703489 3:138021445-138021467 CCTTGGGTCTAGGTAACAGGAGG + Intronic
962839640 3:139221992-139222014 CGTTGGGGCTGGGGTACAGTGGG + Intronic
963323467 3:143835299-143835321 CTTGGGGTTTGGGGAAAAGGAGG - Intronic
963335477 3:143970753-143970775 TTTTTAGTCTGAGGGACAGGTGG - Intergenic
964375934 3:156049102-156049124 CTTCGGGTCTGGAGCACAGCAGG + Intronic
964427289 3:156567491-156567513 CTTTGGAACTGGGTAACAGGCGG + Intergenic
967097203 3:186186838-186186860 TTTTGGGGCTGGGGTAGAGGTGG + Intronic
967289445 3:187904841-187904863 CTTTGGGTGGTGGGGTCAGGGGG - Intergenic
967390778 3:188951829-188951851 GTTTGGGTCAGGGGAAGAGGTGG + Intronic
967408009 3:189138765-189138787 CTTTGTGTCTGGAGAACAGGAGG + Intronic
967912831 3:194556278-194556300 CTTAGGGTTTGGGGGACACCAGG - Intergenic
968603775 4:1522023-1522045 CTGGGGGTCTTGGGGACAGCTGG - Intergenic
969014847 4:4097142-4097164 CCTTGGGGGTGGGGGACAAGGGG + Intergenic
969533525 4:7742036-7742058 CTTTGGGTCTGGGGGACAGGTGG - Exonic
970303709 4:14708190-14708212 CTTTTGATCTGGGAAACAGGAGG - Intergenic
971753636 4:30681191-30681213 CTGTGGGGCTGGGGGTTAGGGGG - Intergenic
973067891 4:45820202-45820224 GTTTGGGGGTGGGGGACTGGGGG + Intergenic
973893588 4:55391369-55391391 TTTTAGGTCTGGTGGCCAGGTGG + Intergenic
974023344 4:56711185-56711207 TTCTGAGTCTGGGGGGCAGGGGG - Intergenic
975503761 4:75116275-75116297 GTTGGGGTGTGGGGGACTGGGGG + Intergenic
976286546 4:83376284-83376306 CTTTGGAACTGGGTAACAGGCGG - Intergenic
977565748 4:98578790-98578812 CTTTGGATCTGGAGGAAAAGTGG - Intronic
977823679 4:101504914-101504936 CTTTGGGTTTAGGGGAGAGATGG + Intronic
978308994 4:107364704-107364726 CTTTGGAACTGGGTAACAGGAGG + Intergenic
978507977 4:109481109-109481131 CTCTGGGAGTGGGGGACGGGGGG - Intronic
980156760 4:129117384-129117406 CTATGGGGCTGGGGGACAGTGGG - Intergenic
980482542 4:133405551-133405573 ATTTGGGGCTGGGGGAGGGGTGG - Intergenic
980617891 4:135256522-135256544 CTTTTGGTGTGGGGGATTGGGGG - Intergenic
980861221 4:138501645-138501667 GTGTGTGTCTGGGGGTCAGGTGG - Intergenic
980959438 4:139460143-139460165 TTGTGAGTCTGGGTGACAGGAGG + Intronic
981104448 4:140864622-140864644 CTGTGGGACTGGGGGACACTGGG + Exonic
981373184 4:143983941-143983963 GTGTGTGTCTGGGAGACAGGAGG + Intergenic
982899582 4:160981250-160981272 GCCTGGGTTTGGGGGACAGGAGG + Intergenic
983346983 4:166539196-166539218 CTTCGGGTTTGGGGCCCAGGGGG + Intergenic
985640802 5:1062697-1062719 CTGAGGGACTGGGGGACTGGGGG + Intronic
986056470 5:4142193-4142215 CTTTGTGTGTGGGTGACTGGAGG + Intergenic
986126558 5:4887724-4887746 CTTGGGGGTTGGGGGACTGGGGG - Intergenic
987295828 5:16550493-16550515 AGTTATGTCTGGGGGACAGGTGG - Intronic
987642455 5:20629601-20629623 CTTTGGAACTGGGTAACAGGTGG - Intergenic
987662355 5:20893814-20893836 CTTTGGAACTGGGTAACAGGCGG + Intergenic
987984798 5:25133263-25133285 CTTTGGAACTGGGTAACAGGTGG + Intergenic
990475950 5:56162062-56162084 CATTTGGTCTGAGGGACTGGGGG + Intronic
992990470 5:82278257-82278279 CTTGGGGTCTTGGGGACGGGCGG - Intronic
993387481 5:87277308-87277330 CTATGACTATGGGGGACAGGGGG - Intronic
993994778 5:94709768-94709790 CTTTCAGTCTGGGTGAGAGGTGG - Intronic
996800636 5:127398813-127398835 CTTTGGGGCAGGGGCAGAGGAGG - Intronic
997819950 5:137056259-137056281 ATGTGGGGGTGGGGGACAGGGGG + Intronic
999217785 5:149950086-149950108 CTTTGGGTGGGTGGGGCAGGTGG + Intergenic
1001514807 5:172347942-172347964 CTCTGGGTCTCAGGGCCAGGAGG + Intronic
1001763175 5:174224020-174224042 GGTTTGGGCTGGGGGACAGGGGG + Intronic
1001797681 5:174515640-174515662 CTTTGGGGCTGGGAGACACTGGG - Intergenic
1001893725 5:175361060-175361082 CTTGGTCTCTGGGGGACATGTGG + Intergenic
1001952179 5:175824025-175824047 CTGTGGGTGTTGGGGACAGGAGG - Intronic
1001997926 5:176176883-176176905 CTTTGGGTGCTGTGGACAGGGGG + Intergenic
1002616837 5:180461384-180461406 CTATGAGTCTGGGGAACAGATGG - Intergenic
1002706181 5:181161998-181162020 CCTTGGGCCTGGGGCACAGCAGG - Intergenic
1003425937 6:5998385-5998407 CTTTGTGTTTGGAGGATAGGAGG - Exonic
1003453218 6:6256671-6256693 CTCTGGGTCGGGAGGACAGTGGG - Intronic
1004583095 6:16973387-16973409 CTTTGGGACTGGAAGACAGTGGG - Intergenic
1006315424 6:33288687-33288709 TCTTGGGTCTAGGGGAAAGGAGG + Exonic
1006765208 6:36499002-36499024 CTTTGGGTCTGGGAGTTTGGGGG - Intronic
1007412217 6:41671521-41671543 CTTTGGGGTTGGGGGATGGGAGG + Intergenic
1007412888 6:41674973-41674995 TTGTGGGGTTGGGGGACAGGAGG + Intergenic
1007902754 6:45425037-45425059 CTTTTGGTTTGGGGGATTGGAGG - Intronic
1011865818 6:91825542-91825564 GTTTGGGGTTGGGGGAAAGGCGG + Intergenic
1013056296 6:106586452-106586474 GTTTGAGTCTGGGAGACAGAGGG - Intronic
1013369881 6:109459456-109459478 AATTGGGTGTGGGGGTCAGGTGG + Intergenic
1014935682 6:127382267-127382289 CTTTGGCTCTGGGTGTCAGTTGG - Intergenic
1016311188 6:142735270-142735292 TTTTGGGTCGGGGGGGCGGGGGG + Intergenic
1016985995 6:149896326-149896348 CTCTGGGGCTGGGGGATAAGGGG + Intronic
1017310134 6:152966504-152966526 TGTTGGGGCTGGGGGACTGGGGG - Intergenic
1017547649 6:155469077-155469099 CTTTGGAACTGGGTAACAGGTGG - Intergenic
1017737381 6:157377803-157377825 TTTGGGGACTGGGGGAGAGGTGG - Intergenic
1017764103 6:157593019-157593041 CTTTGGTTCTGGGAGGCGGGCGG - Exonic
1018732785 6:166665386-166665408 CTTTGGGTTTGGGTGACATTGGG - Intronic
1019103266 6:169649407-169649429 CTTAAGGGCTGGAGGACAGGTGG - Intronic
1019340477 7:506679-506701 GCTTGGGTCTGGGGGAGAGTCGG + Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1020052396 7:5090477-5090499 ATTTGTGTCTGGTGGGCAGGGGG + Intergenic
1021753926 7:23832971-23832993 CTTTGGAACTGGGTAACAGGCGG + Intergenic
1022899939 7:34797412-34797434 CTCTGTGTATGGGGGACAGGGGG + Intronic
1023544612 7:41305179-41305201 CTTGGGGTCTAGGGCATAGGAGG + Intergenic
1023844147 7:44111750-44111772 CCGAGGGTCTGGGGGACAGCTGG - Intronic
1027430850 7:78111059-78111081 CTTTAGGTCTGGGGGAGAGATGG + Intronic
1027727889 7:81830041-81830063 CATTGGGACTGTGGGACAGTGGG - Intergenic
1027928367 7:84497419-84497441 TTTTGGGGGTGGGGGACAGAGGG + Intergenic
1028002987 7:85524699-85524721 CTGTGGGGCTGGGGGAGTGGAGG + Intergenic
1028472675 7:91221954-91221976 CTTTGGTTCTGGGGCAGAGGTGG + Intergenic
1029462997 7:100706914-100706936 CATTGGGTCTCCGGGGCAGGCGG - Exonic
1029492669 7:100880798-100880820 ATGTGGGTCTGGAGCACAGGCGG + Intronic
1032155808 7:129466795-129466817 CTTGGAGTATGGGGGAAAGGGGG - Intronic
1032198000 7:129800317-129800339 CTTTGGCTTTGGGGGACAGGTGG - Intergenic
1032218715 7:129977820-129977842 CTTGGGGCCTGGGGGAGGGGTGG + Intergenic
1032453939 7:132057631-132057653 CTTTGGAACTGGGTAACAGGTGG + Intergenic
1032529106 7:132605435-132605457 CTTTGGTCCTGGAGAACAGGTGG + Intronic
1032847408 7:135763299-135763321 CTTTCTATCTGGGGGACAGGAGG + Intergenic
1033199985 7:139360190-139360212 CTTTTGGGCTGGGGGATAAGGGG - Exonic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034338473 7:150338184-150338206 CTCTGGCTCTGGAGCACAGGAGG + Intergenic
1034437400 7:151069738-151069760 CTGGGGGTCTGGGGGAGGGGAGG + Intronic
1035137008 7:156713474-156713496 CTCTGCATGTGGGGGACAGGAGG + Intronic
1035381899 7:158445798-158445820 CTGTGGCTCACGGGGACAGGAGG - Intronic
1035399506 7:158555593-158555615 GGCTGGGTCTGGGGGACAGCTGG - Intronic
1037891537 8:22626467-22626489 ATTTGGGGCTGAGGGAGAGGTGG - Intronic
1037916874 8:22778244-22778266 CTTTGGGTCTGGGAGGAAGGAGG - Intronic
1040057714 8:43074892-43074914 TTGTGGGTATGTGGGACAGGTGG - Intronic
1040475473 8:47773234-47773256 GTTTGGGTGTGGAGGACTGGCGG + Exonic
1041204709 8:55487175-55487197 CTCTGGACCTGGGGGACAGGTGG + Intronic
1042521042 8:69711263-69711285 CTTTGGGACCTGGGGACAGAGGG - Intronic
1043455920 8:80411993-80412015 CTTTGGGTCTGGGAGAAGGCAGG - Intergenic
1044248360 8:89977215-89977237 GTTTGGGGGTGGGGGACAAGGGG - Intronic
1044249846 8:89993085-89993107 CTTTGGGGCTGGGTGCCAAGGGG + Intronic
1045959138 8:107946504-107946526 CTGTGGGACTGGGGCACAGAAGG + Intronic
1046834782 8:118788279-118788301 ATTTGTGTCTGGTGGGCAGGGGG - Intergenic
1047898846 8:129397700-129397722 CTTTGGGTCTGAGTCACAGGTGG - Intergenic
1048036539 8:130682714-130682736 CTTTGTGGCTGTGGGAAAGGAGG + Intergenic
1048268113 8:133005269-133005291 CCCTGGGACAGGGGGACAGGGGG + Intronic
1048352470 8:133627229-133627251 CTCTGGGTCTGGGGCAGGGGTGG + Intergenic
1049001592 8:139828788-139828810 GTTGGGCTCTGGGGGACAGAGGG - Intronic
1049188124 8:141270083-141270105 CTCAGGGTCTGTGGGGCAGGAGG - Intronic
1049392457 8:142379296-142379318 ATTTGAGTCTGGGGGTTAGGAGG - Intronic
1049640126 8:143711669-143711691 CTTTGGGGCGGTGGGGCAGGCGG - Intronic
1050436654 9:5617955-5617977 ATTAGGGTCTGGGGAAAAGGAGG + Intergenic
1051343268 9:16130341-16130363 CTTAGGGGCTTGGGGAAAGGAGG - Intergenic
1053176861 9:35931996-35932018 CTTAGGGACAGGGGGACATGTGG + Intergenic
1053296075 9:36913767-36913789 CCTGGGGTCTGGGGAACAGATGG - Intronic
1056036655 9:82613456-82613478 GTTTGGGTGAGGGGGAAAGGCGG + Intergenic
1056631352 9:88295649-88295671 CTGTGGATCTGGGGAAGAGGGGG - Intergenic
1058040369 9:100295573-100295595 CTGTGGTTATAGGGGACAGGTGG + Intronic
1058316962 9:103580667-103580689 CTTTGGTTTTGGGGGACAGTTGG - Intergenic
1059392183 9:114006198-114006220 TTTGGGTTCTGAGGGACAGGAGG + Intronic
1059423231 9:114205688-114205710 CTCTGGGTCTGGGGGACCCTGGG - Intronic
1059459638 9:114421505-114421527 GTTTTGGTCTGGGAGGCAGGAGG - Intronic
1060186764 9:121568345-121568367 CTTTGGGCCCAGGGGACGGGGGG + Intronic
1060385955 9:123228457-123228479 GTGTGGGGTTGGGGGACAGGGGG + Intronic
1061004218 9:127919261-127919283 CTTAGAGTCTGTGGGGCAGGTGG - Intergenic
1061236106 9:129343521-129343543 CTTCGCGTTTGAGGGACAGGAGG + Intergenic
1062062185 9:134502537-134502559 CTTAGGTCGTGGGGGACAGGGGG + Intergenic
1062149827 9:135012227-135012249 CTTTGGGTCTGGGAGTCAAAGGG - Intergenic
1062220912 9:135414797-135414819 CTTTGTGTCTGGGGGGCGAGAGG - Intergenic
1062250982 9:135593139-135593161 CTTGGGGGCTGGGGGACTCGGGG + Intergenic
1062393064 9:136341646-136341668 CTTTGGGAGTGGGGGACACATGG - Intronic
1062599770 9:137314602-137314624 CCTGGGGGCGGGGGGACAGGGGG - Intronic
1185659530 X:1715719-1715741 GTTGGGGGCTGGGGGACAAGGGG + Intergenic
1185967447 X:4623826-4623848 CATAGGTTTTGGGGGACAGGTGG + Intergenic
1186950700 X:14621508-14621530 GTCGGGGGCTGGGGGACAGGGGG - Intronic
1186977447 X:14923281-14923303 CTTTGGGCCAGGGAGAGAGGGGG - Intergenic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1187884710 X:23878758-23878780 GTGGGGGTCTGGGGGAAAGGTGG - Intronic
1188695804 X:33189290-33189312 CTCTAGGTATGGGGGAGAGGTGG + Intronic
1189289810 X:39877090-39877112 CCTTGGGTCTGTGGGACATGTGG - Intergenic
1189643909 X:43105558-43105580 CTTGGAGCCTGGGGGACAGAGGG - Intergenic
1191859320 X:65653083-65653105 CTTTGGGACTGGGGGCCAAGAGG - Intronic
1193056288 X:77154713-77154735 TTTTGGGGGTGGGGGACAAGGGG + Intergenic
1193445638 X:81598291-81598313 AGTGGGTTCTGGGGGACAGGCGG - Intergenic
1195716684 X:107825578-107825600 TTGTGGGGTTGGGGGACAGGGGG + Intergenic
1196921034 X:120585367-120585389 GTTTTGGTTTGGGGGAAAGGAGG + Intergenic
1197769701 X:130082275-130082297 CCTGGAGACTGGGGGACAGGTGG + Intronic
1198140750 X:133800267-133800289 CTTTGGCTCTGGGGAATAAGTGG - Intronic
1200045857 X:153400832-153400854 CTGTGGGGCTGGGGGTCGGGAGG - Intergenic
1200122045 X:153795670-153795692 CTCTGGGTCTGGACCACAGGAGG - Intronic
1200164552 X:154027152-154027174 CTTGGGGTCAGGTTGACAGGAGG - Intronic
1200425458 Y:3015611-3015633 ATGTGTGTGTGGGGGACAGGGGG + Intergenic
1202076665 Y:21043582-21043604 GGTTTGGACTGGGGGACAGGTGG + Intergenic