ID: 969537323

View in Genome Browser
Species Human (GRCh38)
Location 4:7764643-7764665
Sequence CAGCACTCAGGGCCTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 332}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969537323_969537330 24 Left 969537323 4:7764643-7764665 CCATCCACAGGCCCTGAGTGCTG 0: 1
1: 0
2: 3
3: 24
4: 332
Right 969537330 4:7764690-7764712 AGTGCCAGCACTGTGAAAGCAGG 0: 1
1: 0
2: 3
3: 28
4: 287
969537323_969537329 -6 Left 969537323 4:7764643-7764665 CCATCCACAGGCCCTGAGTGCTG 0: 1
1: 0
2: 3
3: 24
4: 332
Right 969537329 4:7764660-7764682 GTGCTGGCTGCAGATGGCTGTGG No data
969537323_969537331 25 Left 969537323 4:7764643-7764665 CCATCCACAGGCCCTGAGTGCTG 0: 1
1: 0
2: 3
3: 24
4: 332
Right 969537331 4:7764691-7764713 GTGCCAGCACTGTGAAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969537323 Original CRISPR CAGCACTCAGGGCCTGTGGA TGG (reversed) Intronic
902281427 1:15377439-15377461 TGGCACTGAGGCCCTGTGGAGGG - Intronic
902417643 1:16250930-16250952 CAACATTTAGGGACTGTGGAGGG + Exonic
902817698 1:18925639-18925661 CAGCTCTCTGGGCCTGCAGAAGG - Intronic
902861956 1:19252886-19252908 CAGCACTCAGGGAGGGTGGTTGG - Intronic
903253757 1:22076890-22076912 CAGCACTCTGGGACTTTGGGAGG + Intronic
904703490 1:32373268-32373290 CTGCCCTCAGGGCCTGTGAAAGG - Intronic
905241400 1:36583794-36583816 AAGAACGCAGGGCCTGGGGAGGG - Intergenic
907526410 1:55056527-55056549 GAGGACGCAGGGCCTGGGGATGG - Intronic
907580594 1:55568778-55568800 CACCCCTCAGAGCCTTTGGAGGG + Intergenic
908606224 1:65799655-65799677 CAGCCTTAAAGGCCTGTGGATGG + Intronic
909574514 1:77159034-77159056 CAGGCCTCAGGGCCTGTGATGGG - Intronic
909721667 1:78778233-78778255 CACCCCTTAGGGCCTGGGGATGG - Intergenic
910096510 1:83528535-83528557 CAAGACTGAAGGCCTGTGGAAGG - Intergenic
912074119 1:105850725-105850747 CAGCATTCAGACCCTGTGGTTGG - Intergenic
912453269 1:109780413-109780435 TTGCACTCTGGGCCTGTGGTGGG + Intergenic
912834813 1:112986645-112986667 TAGCACTCTGGGCCTGTGATGGG + Intergenic
913396889 1:118381434-118381456 CAGCACACAGGACTTGTGGTTGG + Intergenic
919794813 1:201315172-201315194 CTCCACTCAGGGCCTCTGGTTGG - Intronic
919876775 1:201875088-201875110 CACCACTCAGGGCCTGATCATGG + Intronic
920069055 1:203289533-203289555 CAGCACCCAGAGCTTGGGGATGG + Intergenic
920135321 1:203764617-203764639 CAGCAGCCAGGAGCTGTGGAAGG + Intergenic
921161130 1:212472768-212472790 CAGCAGGCAGGTCCTGTGGAAGG + Intergenic
922608682 1:226908198-226908220 CAGAACTCTTGGCATGTGGAAGG + Intronic
924119015 1:240777869-240777891 TAGGAGTCAGGGCCTTTGGAAGG - Intronic
924119023 1:240777918-240777940 TAGGAGTCAGGGCCTTTGGAAGG - Intronic
924119031 1:240777967-240777989 TAGGAGTCAGGGCCTTTGGAAGG - Intronic
924119048 1:240778065-240778087 TAGGAGTCAGGGCCTTTGGAAGG - Intronic
924119075 1:240778212-240778234 CAGGAGCCAGGGCCTTTGGAAGG - Intronic
1065983624 10:30928713-30928735 CAGGACTCGGGGACAGTGGAGGG - Intronic
1066421577 10:35268921-35268943 TAGCACTGTGGGCCTGTGAAGGG + Intronic
1067664970 10:48269940-48269962 CCTGACTCAGGGCCTGAGGAGGG - Intronic
1067742324 10:48904980-48905002 CAGCACTCATGGGCTGCAGATGG + Intronic
1068103241 10:52581853-52581875 TAGGACTCTGGGCCTGTGAAGGG + Intergenic
1069662360 10:70132190-70132212 CAGCACCCAGGGCTTCGGGAAGG + Intronic
1069774711 10:70919617-70919639 CAGCCCTCTGGGCCTGGGGGAGG + Intergenic
1069856677 10:71444827-71444849 CCACACTCAGGGCCCCTGGAGGG + Intronic
1069883878 10:71611176-71611198 AAGCCCACAGCGCCTGTGGAGGG + Intronic
1069992250 10:72322916-72322938 CTGCACTGTGGGCCTGTGGCCGG + Intergenic
1070771136 10:79082900-79082922 CAGCACTCTGGCCCTGGGGAGGG + Intronic
1073186088 10:101615783-101615805 TAGCACTCAGGGCCTGTCCCTGG - Intronic
1074010329 10:109472301-109472323 CAGCACTCTGAGGCTATGGATGG - Intergenic
1076306030 10:129466584-129466606 CAGCCTCCAGGGCCTGTGGTGGG - Intergenic
1076520444 10:131077828-131077850 TGGTACCCAGGGCCTGTGGAGGG - Intergenic
1076539754 10:131206536-131206558 TTGCACCCAGGGCCTGTGCAAGG - Intronic
1076753960 10:132558393-132558415 CAGCTGTCAGGGCCTGAGGAGGG - Intronic
1077072183 11:680297-680319 CACCACCCAGGGCCTCAGGAAGG + Intronic
1078895295 11:15592056-15592078 GAGCAGACAGGGCCAGTGGAGGG + Intergenic
1081108334 11:39100437-39100459 CAGACCTCAGGGCCTGTGATGGG + Intergenic
1082071888 11:47946040-47946062 CAGCACTTTGGGGCTGAGGAGGG - Intergenic
1082195510 11:49299590-49299612 CAGCACTTAGGGGCTGAGGTGGG - Intergenic
1082778758 11:57269784-57269806 CAGAGCTCAGGGCCTGGGAATGG + Intergenic
1083758951 11:64805560-64805582 CAGCCCCCATGGCCTGTGGAAGG + Intronic
1084102242 11:66957502-66957524 CAGCACTGGGGGACTGTGGCAGG + Intronic
1084352581 11:68613159-68613181 CACCACTCAGGGGCTCTGGAGGG + Exonic
1084573257 11:69972752-69972774 CTGCACTCAGGGCCTCTGCGTGG + Intergenic
1084677653 11:70645658-70645680 CAGCCCTGAGGGCCTGTGGCAGG - Intronic
1086190757 11:84075970-84075992 CAAAACTCAGAGCCTGAGGATGG + Intronic
1087579471 11:100033747-100033769 CAGCACTGAGGGCCTAAGTAAGG - Intronic
1088132313 11:106508176-106508198 AAACACTGAGTGCCTGTGGAAGG + Intergenic
1090202288 11:124865474-124865496 CAGCGCGCAGAGGCTGTGGAGGG + Exonic
1090432472 11:126657581-126657603 GGGAACTCAGGGCCTGTAGATGG + Intronic
1091209125 11:133841888-133841910 CTGCACTCAGGGCCAGTAGTGGG - Intronic
1091695259 12:2624024-2624046 CAGAACTCAGGGCCAGTGAGAGG + Intronic
1091702658 12:2674236-2674258 GAGCACTGAGTGCCGGTGGAGGG + Intronic
1091928463 12:4375001-4375023 CAGCACTAAGGGCTCGGGGAAGG + Intronic
1093464502 12:19436381-19436403 CAGCACTGAGGGCTTCTGGCTGG - Intronic
1095832670 12:46604260-46604282 CAGCAGTCAGGCTCTGGGGAGGG - Intergenic
1095959853 12:47827498-47827520 CAGGACTCAGGGCCTGCCCAAGG - Intronic
1096189164 12:49603857-49603879 CAGCACACAGGTCCTGTGATGGG + Intronic
1096628011 12:52907093-52907115 CAGGAGGCAGGGCCTGGGGAGGG - Intronic
1097167369 12:57093096-57093118 TAGGACTCAGGGCCTGGGGGAGG - Exonic
1101825713 12:108218601-108218623 CATCACTCAGGGCCTGTGGGTGG - Intronic
1102911113 12:116714831-116714853 CAGATCCCAGGCCCTGTGGAAGG + Exonic
1103614286 12:122142321-122142343 CAGCACCCAGCCCTTGTGGATGG + Exonic
1104196100 12:126539861-126539883 AAGCACTCAGGGGCTGGGGAAGG + Intergenic
1104328525 12:127823066-127823088 CAGCAGCCAGGGCCTCTGCATGG + Intergenic
1104713786 12:131003891-131003913 CAGCTCTCAAGGCCGGTGCAAGG - Intronic
1105983090 13:25538892-25538914 TAGGACTCCAGGCCTGTGGAGGG + Intronic
1106337012 13:28792674-28792696 CAACACTCAGAGGCTGAGGAGGG - Intergenic
1106581127 13:31019202-31019224 TAACACTCAGGGCCAGTGTAGGG - Intergenic
1109021028 13:57093684-57093706 TAGCACTCTGGGTCTGTGGTGGG - Intergenic
1117493506 14:56276470-56276492 CAGTACTCCGGGCCTTTGTAGGG + Intronic
1118215945 14:63808608-63808630 CAGCTCTCAGGGACAGTGTATGG + Intergenic
1118316862 14:64730969-64730991 AAGCACCTAGGGCCTGGGGAGGG + Intronic
1118884002 14:69851638-69851660 CAGCACTGTGGGCCAGTGGTGGG - Intergenic
1119138040 14:72238635-72238657 CAGCAGGGAGGGCCTGTAGAGGG + Intronic
1119266314 14:73264933-73264955 CAGGACTCAGGAACTGAGGAAGG + Intronic
1119911845 14:78356644-78356666 CAGAACCCAGGGCCTGTGTAAGG + Intronic
1119968916 14:78947731-78947753 CAGCACTCAGGGCAGGCTGAGGG - Intronic
1120760226 14:88278154-88278176 CAGCACTCAGGGGCTAGAGAAGG + Intronic
1120991658 14:90382972-90382994 CAGAGCTCAGGGTCTGAGGAAGG - Intergenic
1123112711 14:105880674-105880696 CCTCACTCAGGGCCTGCTGAGGG - Intergenic
1123144113 14:106111343-106111365 CACCACTGAGAGCCTGTGGATGG + Intergenic
1123220886 14:106854432-106854454 CACCACTGAGAGCCTGTGGATGG + Intergenic
1123465438 15:20511571-20511593 CAGTTCTCAGGGCCTGTGATGGG - Intergenic
1123652678 15:22489466-22489488 CAGTTCTCAGGGCCTGTGATGGG + Intergenic
1123683674 15:22782318-22782340 CAGTTCTCAGGGCCTGTGATGGG + Intronic
1123743101 15:23298325-23298347 CAGTTCTCAGGGCCTGTGATGGG + Intergenic
1124276162 15:28327550-28327572 CAGTTCTCAGGGCCTGTGATGGG - Intergenic
1124306538 15:28584057-28584079 CAGTTCTCAGGGCCTGTGATGGG + Intergenic
1124511547 15:30331605-30331627 CAGCCCTCTGGGCGTGTGGAGGG + Intergenic
1124645180 15:31433509-31433531 GAGCACACAGGGACTGGGGAAGG - Intronic
1124731367 15:32199152-32199174 CAGCCCTCTGGGCGTGTGGAGGG - Intergenic
1126536352 15:49769694-49769716 CAACATTTAGGGCCAGTGGAGGG - Intergenic
1128217665 15:65945460-65945482 GAGCAGTGAGGGCCTGAGGAGGG + Intronic
1128510933 15:68313652-68313674 CAGCACTAAGGGACTATGGATGG - Intronic
1128577969 15:68789282-68789304 GAGAAATCAGGGCCTGTGCATGG - Intronic
1128579209 15:68797166-68797188 CAGCACCCGGGGCCTCTGGGGGG - Intronic
1129159480 15:73739456-73739478 CAGGACTCAGGGCCTGGGGGTGG - Exonic
1129272875 15:74428686-74428708 CACCATGCAGGGCCTGGGGAAGG + Intronic
1129748517 15:78042624-78042646 CAGCACCCAGGGGATGGGGAGGG - Intronic
1132018443 15:98339365-98339387 CAGGATCCAGGGCCTGCGGAGGG + Intergenic
1132525958 16:414864-414886 CCTCCCTCAGAGCCTGTGGAGGG - Intergenic
1133235016 16:4383753-4383775 CAGAAGACAGGGCCTGGGGAAGG - Intronic
1133770906 16:8866924-8866946 CAGCACTCAGGGGCTCCTGAGGG - Intronic
1133778984 16:8922146-8922168 ATGCAGCCAGGGCCTGTGGATGG - Intronic
1133819635 16:9225195-9225217 AGGCACTGAGGGCCTGGGGAAGG + Intergenic
1134255036 16:12603496-12603518 CAGCACTGGGGGTCTGTGGGAGG + Intergenic
1135530071 16:23245580-23245602 CAGTCCTCAGGGCATGAGGAGGG - Intergenic
1136411321 16:30079058-30079080 TTTCACTCAGGGTCTGTGGAAGG + Intronic
1137603810 16:49774155-49774177 CAGAAGTCAGGGACTGTGGCTGG + Intronic
1138475854 16:57270335-57270357 AAGGACTCGGGGGCTGTGGAAGG - Intronic
1138475869 16:57270373-57270395 AAGCACTCAGGGGCCATGGATGG - Intronic
1139268389 16:65660378-65660400 CAGCACTGAAAGCCTGGGGAAGG - Intergenic
1141788605 16:86217893-86217915 CAGCAGCCCGGGCCTGTGGGAGG - Intergenic
1142244834 16:88965492-88965514 CAGGATTCGGGGCCTGTGGCTGG - Intronic
1142310061 16:89307074-89307096 CAGCACTCGGGACGTGGGGAGGG + Intronic
1142673038 17:1496251-1496273 CAGCACTCCTGTCTTGTGGAAGG - Intronic
1142852068 17:2709146-2709168 CAGCACACAGGTCCTCTGGGAGG - Intronic
1143261819 17:5605190-5605212 CAGCACTCAGGTGTTTTGGATGG - Intronic
1143405100 17:6671984-6672006 CACCTCTCAGGCCCTGTGGGTGG + Intergenic
1144063722 17:11605749-11605771 CAGCACTGAGAGGCTGAGGAGGG - Intronic
1144834727 17:18150868-18150890 CAGCACTCAGGGGCTGCTGCTGG - Exonic
1144834995 17:18152058-18152080 CAACAGGCAGGCCCTGTGGAGGG - Intronic
1146927341 17:36754178-36754200 CAGCACAAAGGCCCTGAGGAAGG + Intergenic
1147326021 17:39670020-39670042 CAGCACCCAGGGGCTGGGGCTGG - Exonic
1147919311 17:43906624-43906646 CAGAACTGAGGGCCAGAGGATGG + Intronic
1150609074 17:66718688-66718710 CAGGAGGCAGGGCCTTTGGAAGG - Intronic
1150640862 17:66948521-66948543 CGGCACTGAGGGCCTGGTGAGGG + Intergenic
1151667246 17:75552230-75552252 CAGCACTCTGGCACTCTGGAAGG + Intronic
1152372866 17:79901351-79901373 AAGCACCCAGGTCCTGAGGAGGG + Intergenic
1152634360 17:81424436-81424458 CAACTTTCAGGGTCTGTGGATGG - Intronic
1153710715 18:7796237-7796259 CAGAGATCAGTGCCTGTGGATGG + Intronic
1154018629 18:10643320-10643342 CAGCACTCAGTCCCGGCGGAAGG - Intergenic
1154185599 18:12180102-12180124 CAGCACTCAGTCCCGGCGGAAGG + Intergenic
1154300252 18:13185848-13185870 CAGCCCTCAGTGCCAGAGGAAGG - Intergenic
1154355078 18:13618944-13618966 CAGCCCTGAGGGTCTGTGCAGGG - Intronic
1157121741 18:44917779-44917801 CAGCACTCAAAGCCCGTGCATGG + Intronic
1158595267 18:58810392-58810414 CGGCACTAGGGGCCTGTTGAAGG + Intergenic
1159002552 18:62987131-62987153 CTGCACTCAGCGCATGTGGAGGG - Intergenic
1160236349 18:77089168-77089190 GAACACCCAGGGGCTGTGGAAGG - Intronic
1160616638 18:80135535-80135557 AAGTCCTCAGGGACTGTGGAAGG + Intronic
1161473959 19:4474204-4474226 CAGCAGGGAGGGGCTGTGGAGGG + Intronic
1161551697 19:4916593-4916615 CAGCACACAGGACGGGTGGAGGG - Intronic
1162989595 19:14293678-14293700 TAGCACCCAGGGTCTGTGGGGGG - Intergenic
1163301532 19:16450411-16450433 CAGAACTCAGGGCCTGCAGTGGG - Intronic
1165067303 19:33236722-33236744 CACCACTCAGGCCCTGCAGACGG + Intergenic
1165127721 19:33612494-33612516 AATCAATCAGGGCCTCTGGAGGG - Intergenic
1165807224 19:38587805-38587827 CACCACTACAGGCCTGTGGAAGG + Exonic
1166078352 19:40427012-40427034 CAACACTCAGGGGCCGAGGAGGG - Intergenic
1166215382 19:41331231-41331253 CAGGGCTCAGGGCTCGTGGAGGG + Intronic
1168173099 19:54602803-54602825 CAGGACCCTGAGCCTGTGGAAGG - Intronic
1168300292 19:55401194-55401216 AAGGACCCAGGGCCTGTGCAGGG + Exonic
1168562896 19:57398138-57398160 CAGCAACCATGGCCTGTTGATGG + Intronic
1168641693 19:58035065-58035087 GAGGGCTCAGTGCCTGTGGAAGG - Intronic
925260902 2:2527684-2527706 CAGCAGGCAGGGCTGGTGGAGGG - Intergenic
925641839 2:5992916-5992938 CAGCCTTCACTGCCTGTGGACGG + Intergenic
926484640 2:13439347-13439369 AAGCAGTCATGGCCTATGGAAGG + Intergenic
928087904 2:28357057-28357079 CAGAGCCCAGGGCCTGGGGAGGG - Intergenic
934044451 2:88160956-88160978 AATTACTCAGGGCCTGGGGAAGG - Intergenic
934058876 2:88275622-88275644 CAGACCCCAGGGCCTGTGGTGGG - Intergenic
934687734 2:96333957-96333979 CACTACTCAGGGCCTGAGGGGGG + Intergenic
934949421 2:98566238-98566260 CAGCACTTAGAGCCTGAAGAGGG - Intronic
936149776 2:110009318-110009340 CTGCACTCAGGGCAGGTGTAAGG - Intergenic
936617514 2:114063122-114063144 CAGCACTGAGGGCTGGTGGTTGG + Intergenic
937425450 2:121795118-121795140 GTGCACTCAGGGGCTGAGGATGG + Intergenic
937683395 2:124668547-124668569 TAGCAGGGAGGGCCTGTGGAGGG - Intronic
937830951 2:126422566-126422588 CAGCACTCAAGGGCTGAGGCAGG + Intergenic
940027054 2:149219413-149219435 CTGCACTTAGGCCCTGTGGATGG - Intergenic
940323900 2:152404924-152404946 CAGTACTCAGGGCCTGTTGTAGG - Intronic
942261785 2:174172371-174172393 CAACACGCAGGGCCTACGGAAGG + Intronic
945839377 2:214869432-214869454 CAGCACTTGGGGCCTGGGAAAGG + Intergenic
946201880 2:218075371-218075393 CAGCACCCAGGGACAGGGGAAGG + Exonic
947792807 2:232877426-232877448 CAGTCCCCAGGGCCTTTGGAGGG + Intronic
947965830 2:234280816-234280838 CATCACTCGTGGACTGTGGATGG - Intergenic
948129359 2:235589104-235589126 CAGCGCTCAGGGCCTCTGGAAGG + Intronic
948423542 2:237874833-237874855 CCTCACTCAGGGCTGGTGGAGGG - Intronic
948463499 2:238141431-238141453 CTGCACGCAGGGCCTGGGCACGG - Exonic
948600778 2:239106427-239106449 CAGCTGTCTGGTCCTGTGGAGGG + Intronic
948652462 2:239457018-239457040 CCACTCTCAGAGCCTGTGGATGG - Intergenic
948927718 2:241110280-241110302 CAGCTGCCAGGGCCTGAGGAAGG + Intronic
1168837919 20:890170-890192 GGGCACTGAGGGCCTGTGGCTGG - Intronic
1169325022 20:4668523-4668545 CGGCAGTCAGGGGCAGTGGAGGG + Intergenic
1170153771 20:13251260-13251282 CAGAATTCAATGCCTGTGGAAGG - Intronic
1170405857 20:16035780-16035802 CAGGACTCAGCTCATGTGGATGG - Intronic
1170986769 20:21266172-21266194 CTGCACTCAGGGCACATGGATGG - Intergenic
1173555768 20:43964531-43964553 CAGCTCTCAGTGCCTGTGACTGG + Intronic
1173570235 20:44071233-44071255 TGGCACTCAGGACCTGGGGATGG - Intergenic
1175279032 20:57790432-57790454 CAGCTCTGAGGGCCCGTGGGAGG - Intergenic
1175323863 20:58109219-58109241 ATGCACTCTGGGCCTGTGGTGGG - Intergenic
1175569612 20:60008957-60008979 CAGCAGTCAGGACCTGGGGAAGG - Intronic
1175965594 20:62658620-62658642 CACCACCCAGGGGCTGCGGAGGG - Intronic
1178154250 21:29832718-29832740 CAGCCCTCTGGGCCTGTGACAGG + Intronic
1179270659 21:39848065-39848087 GTGAACTCAGGGGCTGTGGATGG + Intergenic
1179886631 21:44316935-44316957 CAGCAGTCAGGGCCAGGGGCAGG + Intronic
1179950953 21:44708629-44708651 CAGGTCTCTGGGCCTGGGGACGG - Intronic
1180041241 21:45281402-45281424 CAGAACTCAGAGGTTGTGGAGGG - Intronic
1180050908 21:45330629-45330651 CAGGACTCAGGGCCTCAGGGTGG + Intergenic
1180050941 21:45330719-45330741 CAGGACTCAGGGCCTCAGGGTGG + Intergenic
1180050950 21:45330750-45330772 CAGGACTCAGGGCCTCAGGGTGG + Intergenic
1180050957 21:45330780-45330802 CAGGACTCAGGGCCTGAGGATGG + Intergenic
1180180591 21:46117167-46117189 CTGCCCTCAGGGCCTCTGGGAGG + Intronic
1180248941 21:46566727-46566749 CAGCACTCATGCCCAGAGGAAGG - Intronic
1180582977 22:16859055-16859077 CTGCACTCAGGGCAGGTGTAGGG + Intergenic
1180588342 22:16914005-16914027 CAGCAGTCACAGCCTGGGGAAGG - Intergenic
1180840652 22:18957435-18957457 GAGGGCCCAGGGCCTGTGGAGGG + Intergenic
1181060836 22:20281339-20281361 GAGGGCCCAGGGCCTGTGGAGGG - Intronic
1181296390 22:21843188-21843210 AAGCACTGTGGACCTGTGGAAGG + Intronic
1181440413 22:22932744-22932766 CAGGCCTCGGGGCTTGTGGAAGG - Intergenic
1181957921 22:26601747-26601769 CAGCACTGGGAGACTGTGGAAGG + Intronic
1182147486 22:28005618-28005640 CAGCGCTCTGGGCCCGTGGCTGG - Intronic
1183305765 22:37082295-37082317 CAGCATTCAGGGGTTGTGGGGGG - Intronic
1183317938 22:37147198-37147220 CAGCAATCAGGGCCTCTGGCGGG + Intronic
1183583982 22:38741458-38741480 CGGCACTCAGGGCCTGTGACTGG - Intronic
1183695929 22:39422175-39422197 CAGTCCTCAGGGCCTGAGCAAGG + Intronic
1184234369 22:43175117-43175139 AAGCCCTCAGGCCCGGTGGAGGG + Intronic
1184380664 22:44143230-44143252 CAGCACTCAGCTCATGGGGATGG + Intronic
1184787683 22:46679853-46679875 CGGCACTGAGGGCCTGGGGTTGG - Intergenic
1185108980 22:48890313-48890335 GAGCTCACAGGGCCTGTGAAAGG - Intergenic
1185109737 22:48894274-48894296 CTGCAGTCAGGGCCTGAGGCCGG - Intergenic
950455798 3:13092006-13092028 CAGTTCTAAGGGCCTGTGCATGG + Intergenic
950534030 3:13569226-13569248 CAGGCCTAAGGGCCTGTGGGAGG + Intronic
950964587 3:17137490-17137512 CAGCCCTAGGGGCGTGTGGAGGG - Intergenic
951574189 3:24097004-24097026 CAGCACTTAGCAGCTGTGGAGGG - Intergenic
952220007 3:31315640-31315662 CAGACCTCTGGGCCTGTGGTGGG - Intergenic
954119702 3:48490007-48490029 GTGCACTCTGGGCCTGTGGTGGG - Intronic
954659501 3:52219422-52219444 GTCCACTCAGGGCCTCTGGAGGG - Intergenic
956627717 3:71283091-71283113 CTGCACTCAGCACCAGTGGAAGG - Intronic
959453524 3:106532107-106532129 CAGGCCTCAGGGCCTGTGATGGG - Intergenic
959484727 3:106913588-106913610 TAGCACTCTGGGCCTGTGATGGG + Intergenic
959507879 3:107176012-107176034 TAGGACTCAGGGCCTGTGATGGG - Intergenic
960504013 3:118471073-118471095 TAGCACTCTGGGCCTGTGATGGG + Intergenic
961451391 3:127003877-127003899 CTGCCCACAGGGCCTGTGGCTGG + Intronic
961471308 3:127114866-127114888 CAGCAATGAGAGCCTGGGGAGGG + Intergenic
962875581 3:139533810-139533832 CAGAAGGCAGGCCCTGTGGAGGG + Intronic
963004208 3:140710858-140710880 CAGCTCTCAGGAACAGTGGATGG + Intergenic
964663819 3:159150947-159150969 CAGCACGCAGGACCAGGGGATGG - Intronic
964722215 3:159778849-159778871 GTGCACACACGGCCTGTGGAGGG + Intronic
966921120 3:184612054-184612076 AAGTCATCAGGGCCTGTGGATGG + Intronic
966933726 3:184691981-184692003 TGGCAGTCAGGGCCTGTGGTGGG + Intergenic
967778294 3:193407366-193407388 CTGCACTCCCGTCCTGTGGAGGG - Exonic
968045813 3:195623509-195623531 CAGCACACAGGGCCCGGTGAGGG - Intergenic
968123592 3:196142948-196142970 GAGCACTCAGGTACTGTGGGTGG - Intergenic
968308843 3:197666578-197666600 CAGCACACAGGGCCCGGTGAGGG + Intergenic
969147298 4:5135326-5135348 CAACACTCAGTGGCTGTGGCTGG - Intronic
969321993 4:6417982-6418004 CAGCAGGCAGGGGCTCTGGAAGG + Intronic
969468365 4:7371028-7371050 CGGCTCTCAGGGCCCCTGGATGG + Intronic
969537323 4:7764643-7764665 CAGCACTCAGGGCCTGTGGATGG - Intronic
970147971 4:13056913-13056935 CAGTTCTCAGGGCCTGCGAACGG - Intergenic
971914663 4:32851932-32851954 CTGAACTCAGCTCCTGTGGAAGG - Intergenic
974977543 4:68908710-68908732 CATCACTCAGTTCCTTTGGAAGG + Intergenic
974988373 4:69057408-69057430 CATCACTCAGTTCCTTTGGAAGG - Intronic
981052454 4:140322920-140322942 TAGCACTCTGGGCCTGTGGTGGG - Intronic
981692426 4:147524198-147524220 CTGCACCCTGGGCCTGTGGGAGG - Intronic
982179173 4:152734117-152734139 CAACCTTCAGGTCCTGTGGAAGG + Intronic
982305199 4:153923346-153923368 CATCACTCAGGTACTGTGCATGG - Intergenic
982965467 4:161901337-161901359 CAGCACACAGGGCCTCAGGTAGG + Intronic
984407877 4:179357008-179357030 CAGCACTCAGGGACTGCGCCAGG + Intergenic
985571396 5:647485-647507 CAGCAGACAGGCCCAGTGGAGGG + Intronic
985747481 5:1655333-1655355 CAGCACACAGGGCCGGGTGAGGG + Intergenic
985784730 5:1887655-1887677 CACCCCCCAAGGCCTGTGGAGGG + Intergenic
986225429 5:5807492-5807514 GAGCTCACAAGGCCTGTGGAAGG - Intergenic
986321201 5:6633707-6633729 CGGCACTCGGAGCCTGTGGCTGG - Exonic
988739925 5:34060001-34060023 CTGCAATCAGGTCCTGAGGAAGG - Intronic
992481755 5:77158583-77158605 GAGCTCTGAGTGCCTGTGGATGG + Intergenic
994217968 5:97159842-97159864 CAGAACTCAGTGCCCATGGAGGG - Intronic
994959967 5:106587116-106587138 CAGCCCCCAGGGCCTGTCTATGG + Intergenic
996151089 5:120035836-120035858 CAGCACTCCCGGTGTGTGGAAGG - Intergenic
998089375 5:139355072-139355094 CAGCACTTTGGGACTTTGGAAGG - Intronic
998745815 5:145258878-145258900 TAGCACTCTGGGCCTGTGATAGG - Intergenic
999175718 5:149630463-149630485 CAGCACTCACAGCCTGCGGCAGG - Intronic
1001397289 5:171426467-171426489 CAGCACTGTGGGCCTGAGCATGG + Intronic
1001451557 5:171829012-171829034 CAGAACTCATGGCCTGAGAAAGG - Intergenic
1001775914 5:174329021-174329043 CAGCCCTGTGGGCCTGTGGATGG + Intergenic
1001968966 5:175938415-175938437 CAGAAATCAGGGCTTTTGGAAGG + Intronic
1002128582 5:177065223-177065245 CACCATTCAGGAACTGTGGAGGG - Exonic
1002248478 5:177905330-177905352 CAGAAATCAGGGCTTTTGGAAGG - Intergenic
1003016656 6:2473466-2473488 GATCCCTCAGGGCCTCTGGAAGG + Intergenic
1006314267 6:33280748-33280770 CGGCTCTCAGGCCCTGTGCATGG - Exonic
1006578387 6:35062197-35062219 CAGCACTGAGAGCCCCTGGAAGG - Intronic
1007121338 6:39384680-39384702 CAGCACCCAGGGCCAATGGTGGG - Intronic
1007260767 6:40561534-40561556 CAGCAGCCAGCCCCTGTGGAGGG - Intronic
1007422572 6:41728535-41728557 CACCCCTCAGGGACTGTGGGGGG + Intronic
1007749662 6:44064211-44064233 GAGAACCCAGTGCCTGTGGAAGG - Intergenic
1008516333 6:52322986-52323008 CAGCAGCCAGAGCCTGAGGAGGG - Intergenic
1010519673 6:76817861-76817883 CAGCACCCAGTGCATGTTGAGGG - Intergenic
1011018114 6:82781560-82781582 CTGCTCTCTGGGCCTGTGGTGGG - Intergenic
1011032886 6:82942503-82942525 TAGCACTCTGGGCCTGTGATGGG - Intronic
1013130069 6:107224094-107224116 CAGCACTCAATGCATGGGGATGG - Intronic
1017077220 6:150630432-150630454 CAGCCCACAGGGTTTGTGGATGG + Intronic
1017913916 6:158818302-158818324 CAGCACTGCGGGCATGGGGAGGG + Intronic
1018028848 6:159826341-159826363 CACCACTGAGGGCCTGGGGCTGG + Intergenic
1018365795 6:163118372-163118394 CCTCACCCAGGGCATGTGGAAGG + Intronic
1018441303 6:163815962-163815984 CAGCACAGAGAGCCTGGGGAAGG - Intergenic
1018859870 6:167703864-167703886 GAACACTCAGGGCCTGAGGCTGG - Intergenic
1020257996 7:6513020-6513042 CAGCATGCAGGTCATGTGGATGG - Intronic
1023159310 7:37282230-37282252 CTGCGTTCAGGCCCTGTGGAGGG + Intronic
1024119662 7:46223999-46224021 CAACCATCAGGGCCTGTTGAGGG + Intergenic
1024228762 7:47348014-47348036 CAGCACTTGCGTCCTGTGGAGGG - Intronic
1026444481 7:70472061-70472083 CAGTACTCAGAGCATGTGGGAGG - Intronic
1026576638 7:71577537-71577559 CAGCCCTCAGGGCCTTTCCATGG + Intronic
1028642871 7:93062842-93062864 CAGCAGTCACGGCCTGAGAAGGG - Intergenic
1028648784 7:93127324-93127346 CACCACTTGGGGCCTGTTGATGG + Intergenic
1029728456 7:102424204-102424226 CAGCGCTCAGGGTCTGTAGTGGG + Intronic
1030908267 7:115213271-115213293 CTTCACTCAGTGCCTCTGGAGGG + Intergenic
1032551553 7:132789037-132789059 CAGAACTCAGGGCTTTTGGCTGG + Intronic
1032853023 7:135811279-135811301 CAGGGCTCAGGGGCTGTGGGTGG + Intergenic
1033435249 7:141327967-141327989 CAGTACTCAGGGTCTGTGCCTGG - Intronic
1034873599 7:154705586-154705608 CATCACTCAGGGCCCATGGCTGG + Intronic
1034953032 7:155313767-155313789 CAGCAAGCCGGGCTTGTGGAGGG - Intergenic
1034974417 7:155439527-155439549 CAGCAGTCAGGGTGTGAGGAGGG + Intergenic
1035462342 7:159049750-159049772 CAGGATTCAGGGCCTGAGGGTGG + Intronic
1036211010 8:6841451-6841473 CAACACACAGGCCCTGGGGAGGG - Intergenic
1037725937 8:21482706-21482728 TATCACTCCAGGCCTGTGGACGG - Intergenic
1039430466 8:37521481-37521503 CAGCGCTGTGGGCCTGCGGACGG - Intergenic
1039947275 8:42140621-42140643 CAGCACTCAGCGCGGGTGGCGGG - Intergenic
1042768637 8:72354711-72354733 CAGGACTCAGGGCCTCTTGTGGG + Intergenic
1046900555 8:119519304-119519326 GATCAATCAGAGCCTGTGGAAGG + Intergenic
1047199021 8:122748303-122748325 CAGCGTGCAGGGCCAGTGGATGG - Intergenic
1047256641 8:123218256-123218278 CAGCAATGAGGTGCTGTGGAAGG + Intergenic
1048045489 8:130768711-130768733 GACCACGCAGGGCCTGTGGCTGG - Intergenic
1049218724 8:141419185-141419207 CAGCCCTGAGGACCTGTGCAGGG + Intronic
1049242419 8:141544777-141544799 CATCCCTCAGGGCCTGGGTAGGG - Intergenic
1049347735 8:142147735-142147757 CAGCACTCAAGGCCCCTCGAGGG + Intergenic
1052341504 9:27368662-27368684 CAGCACAAAGGGGCTGGGGAGGG - Intronic
1057444238 9:95102882-95102904 CAGCACACAGGGCCTGCAGCCGG + Intronic
1057867846 9:98695393-98695415 CAGCCCCAAGGGCCAGTGGATGG + Intronic
1060206339 9:121684849-121684871 CAGCAGCCTGGGCCAGTGGAGGG - Intronic
1060437523 9:123607048-123607070 CAGAACCCAGGGACTGTGTAGGG + Intronic
1060520258 9:124290339-124290361 CGGCCCCCAGGGCCTGTGGATGG + Intronic
1061121223 9:128643752-128643774 CTGCACTGAGAACCTGTGGACGG + Intronic
1061293752 9:129666290-129666312 CAGCACTCTGGGCTGGGGGAGGG + Intronic
1061806529 9:133140352-133140374 CTGGACTCAGGGCCTCTGGTTGG + Intronic
1062043684 9:134415575-134415597 CACCTCTCTGGGCCTGTGGCGGG - Intronic
1062046745 9:134427886-134427908 GAGCGCTCAGGGAGTGTGGAAGG + Intronic
1062066379 9:134528890-134528912 CAGTACTCTGGGCCTTTTGATGG + Intergenic
1062444100 9:136586145-136586167 CTCCACACAGGGCCTGAGGATGG + Intergenic
1062459730 9:136657873-136657895 CAGCACCCAGGGAGTCTGGAGGG - Intergenic
1062515603 9:136933676-136933698 TGGCACTCTGGGCCTGTGGTGGG - Intronic
1203360545 Un_KI270442v1:217075-217097 GACCACACAGGGCCTGTGGGGGG + Intergenic
1186330503 X:8527167-8527189 CAGGCCTCAGGGACTGGGGAGGG + Intergenic
1186486267 X:9936660-9936682 TAGTTCTCAGGGCCTGGGGAGGG - Intronic
1192263597 X:69523842-69523864 CAGGACACAGGGCATGGGGAGGG - Intronic
1192453105 X:71255480-71255502 CAGCCCTTAGGGGCTGTGGTGGG - Intergenic
1195941551 X:110171896-110171918 CAGCCTTCAGGGCCTATGAATGG - Intronic
1196015789 X:110938811-110938833 TAGGCCTCTGGGCCTGTGGAAGG - Intergenic
1197460619 X:126736209-126736231 TAGGACTCTGGGCCTGTGAAGGG + Intergenic
1199763915 X:150926860-150926882 TAGCTCTCAGAGCCTGTAGATGG - Intergenic
1200109822 X:153734688-153734710 CAGGACAGAGGGCCGGTGGAAGG + Intronic
1201067889 Y:10116776-10116798 CAGGCCTCAGGGCCTGTGATGGG - Intergenic