ID: 969537325

View in Genome Browser
Species Human (GRCh38)
Location 4:7764647-7764669
Sequence CAGCCAGCACTCAGGGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 5, 3: 60, 4: 500}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969537325_969537330 20 Left 969537325 4:7764647-7764669 CCACAGGCCCTGAGTGCTGGCTG 0: 1
1: 0
2: 5
3: 60
4: 500
Right 969537330 4:7764690-7764712 AGTGCCAGCACTGTGAAAGCAGG 0: 1
1: 0
2: 3
3: 28
4: 287
969537325_969537329 -10 Left 969537325 4:7764647-7764669 CCACAGGCCCTGAGTGCTGGCTG 0: 1
1: 0
2: 5
3: 60
4: 500
Right 969537329 4:7764660-7764682 GTGCTGGCTGCAGATGGCTGTGG No data
969537325_969537334 29 Left 969537325 4:7764647-7764669 CCACAGGCCCTGAGTGCTGGCTG 0: 1
1: 0
2: 5
3: 60
4: 500
Right 969537334 4:7764699-7764721 ACTGTGAAAGCAGGGACAGTGGG 0: 1
1: 0
2: 0
3: 27
4: 253
969537325_969537331 21 Left 969537325 4:7764647-7764669 CCACAGGCCCTGAGTGCTGGCTG 0: 1
1: 0
2: 5
3: 60
4: 500
Right 969537331 4:7764691-7764713 GTGCCAGCACTGTGAAAGCAGGG No data
969537325_969537333 28 Left 969537325 4:7764647-7764669 CCACAGGCCCTGAGTGCTGGCTG 0: 1
1: 0
2: 5
3: 60
4: 500
Right 969537333 4:7764698-7764720 CACTGTGAAAGCAGGGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969537325 Original CRISPR CAGCCAGCACTCAGGGCCTG TGG (reversed) Intronic
900184983 1:1328713-1328735 CAGCCACCATCCAGTGCCTGGGG + Exonic
900743222 1:4343192-4343214 AAGCCAGAGTTCAGGGCCTGGGG - Intergenic
901034607 1:6328860-6328882 CGGCCAGCACACAGGCCCCGAGG - Intronic
901284627 1:8067321-8067343 CAGTCAGCATTCAGAGCCAGAGG - Intergenic
901451908 1:9341026-9341048 AGGCCAGCAATCAGGGCCCGAGG - Intronic
901810904 1:11766369-11766391 CAGCCAGGCCTCAGATCCTGGGG + Exonic
901857781 1:12055336-12055358 CAGCGAGCACAAAGGCCCTGGGG + Intergenic
902408611 1:16199945-16199967 GAGCCAGCACAAAGGCCCTGGGG - Intronic
902840318 1:19070179-19070201 CAGCCTTTACTCAGGGCCCGCGG - Intergenic
903822218 1:26111515-26111537 CAGCGGGCGCTCAGGGCCCGCGG - Intronic
904374456 1:30071339-30071361 TAGCCAGCAGGGAGGGCCTGGGG - Intergenic
904524251 1:31120759-31120781 CAGTCAGCGCTCAGGAGCTGAGG + Intergenic
904962821 1:34348091-34348113 CAGCCTGGACTCCGGGACTGTGG - Intergenic
905680179 1:39864821-39864843 CAGCCAGCACTCAGAGCTCTGGG - Intronic
905761088 1:40558887-40558909 CATCCACCACCCAGGGGCTGAGG - Intergenic
906584175 1:46961790-46961812 CATCCAGCACCAAGGGTCTGGGG - Intergenic
907320976 1:53602128-53602150 CAGGCAGCAGCCAGGGCCAGTGG - Intronic
907493536 1:54826247-54826269 CAGCTAGCTCTCAGGCTCTGGGG + Intronic
907501841 1:54886849-54886871 CGGCCGGGACTCAGGGCCGGAGG - Intronic
908398364 1:63746833-63746855 CACCCAGCACTCCGGCTCTGTGG + Intergenic
908447845 1:64218498-64218520 CAGGCAGCACTCAGGGATAGAGG - Intronic
908779800 1:67679931-67679953 CAGTCAGCACAAAGGCCCTGAGG + Intergenic
912499878 1:110114700-110114722 CAGCCAGCACTCCCAGGCTGGGG + Intergenic
914860000 1:151377981-151378003 CAGGCAGCATTCAGGTGCTGAGG - Intergenic
915670220 1:157482752-157482774 CAGCCAGTGATCAGTGCCTGTGG - Intergenic
915702009 1:157805141-157805163 GAGCCACCACTCCCGGCCTGGGG + Intronic
916362310 1:163984445-163984467 CAGCCAGTACAAAGGCCCTGAGG + Intergenic
917098187 1:171420705-171420727 GAGCCACCACTCCGGTCCTGTGG + Intergenic
918237192 1:182592133-182592155 CAGCAAGCACACAGGTCCTGAGG + Intergenic
918321123 1:183365767-183365789 CAGACATCTCTCAGGGGCTGTGG - Intronic
920087614 1:203429166-203429188 CATCCACCAGTCAGGGTCTGTGG - Intergenic
920440894 1:205979710-205979732 CAGCCAGTACTGTGGGCCTCGGG + Intronic
920753216 1:208702562-208702584 GAGCCAGCTCTCTGGGGCTGTGG - Intergenic
921821399 1:219621185-219621207 GACCCAGCACACAGGTCCTGGGG + Intergenic
922165935 1:223115864-223115886 CAGCCAGCACCAAGGTCCTAGGG + Intronic
922570450 1:226631640-226631662 CAGCCAGGTCTCAGGGCTGGGGG + Intergenic
922719696 1:227893859-227893881 AAGGCACCACTCAGGGGCTGAGG + Intergenic
922773760 1:228205667-228205689 CAGCCATCTCCCAAGGCCTGGGG - Intronic
922792495 1:228317922-228317944 CTGCCGGCTCTCAGGGGCTGAGG - Exonic
922947536 1:229529846-229529868 CAGCCAGGACAGAGTGCCTGGGG - Intronic
923140830 1:231160973-231160995 CAGCCTGCGCCCAGGGCTTGGGG - Intergenic
924146907 1:241085996-241086018 CAGCAAGCACACAGGAACTGTGG + Intronic
1063122699 10:3115732-3115754 CTGCCTGCACTCAGGCCCTCAGG - Intronic
1063370134 10:5515854-5515876 CAGCCACCACCCAGGGACTCTGG - Intergenic
1063427190 10:5959689-5959711 CACCCAGCACCCTGGGACTGCGG + Intronic
1065021818 10:21508155-21508177 CTGCCAGAGCTCAGGGGCTGCGG + Intergenic
1066337970 10:34499787-34499809 CAGCCATCTCTCAGTGTCTGTGG + Intronic
1067051147 10:43021991-43022013 CAGGGAGCACACAGGCCCTGAGG - Intergenic
1067723452 10:48748163-48748185 CTGCCAGCTCTCAGGGGCAGGGG + Intronic
1068120513 10:52779058-52779080 AAGGGAGCACACAGGGCCTGTGG - Intergenic
1069774708 10:70919613-70919635 CCTCCAGCCCTCTGGGCCTGGGG + Intergenic
1070496583 10:77029759-77029781 CAGCAAGCACAGAGGCCCTGAGG + Intronic
1070956262 10:80465441-80465463 CAGCCAGCACACAGCGCTGGTGG + Intronic
1071505208 10:86227859-86227881 CAGGCACCATGCAGGGCCTGGGG - Intronic
1072620079 10:97073921-97073943 CAGCAAGTACACAGGTCCTGTGG - Intronic
1072664572 10:97384303-97384325 CAGCCAGGACGGAGGCCCTGAGG + Intronic
1072741482 10:97912582-97912604 GGGCCAGCCCTCAGGGACTGGGG + Intronic
1073012326 10:100371289-100371311 GAGCCTGCAATTAGGGCCTGTGG - Intergenic
1073480421 10:103783167-103783189 GGGCCATCACCCAGGGCCTGGGG + Intronic
1074126573 10:110533313-110533335 CAGGCAGCAAGCAGGGGCTGAGG + Intergenic
1074888904 10:117718887-117718909 AAGCCAGCACTTTGGGTCTGGGG + Intergenic
1075426278 10:122344035-122344057 CCGCCAGCTCTCAAGGCCTCAGG - Intergenic
1075485993 10:122822404-122822426 CAGCCAGGGCTGAGGTCCTGAGG + Intergenic
1075654756 10:124153427-124153449 GAGGCAGCACCGAGGGCCTGCGG + Intergenic
1076125189 10:127968496-127968518 CAGCCAGAGCTCAGGGCAGGGGG + Intronic
1076149790 10:128152962-128152984 CAGACATCTCTCAGTGCCTGGGG + Intergenic
1076351340 10:129816788-129816810 CAGGCAGCCCTGAGTGCCTGTGG - Intergenic
1076753962 10:132558397-132558419 CATGCAGCTGTCAGGGCCTGAGG - Intronic
1077072180 11:680293-680315 CACCCACCACCCAGGGCCTCAGG + Intronic
1077321165 11:1942722-1942744 CAGCCGGTACACAGGGTCTGAGG + Intergenic
1077329350 11:1977134-1977156 AAGCCAGCACTGAAGCCCTGGGG - Intronic
1077886317 11:6390519-6390541 TAGCCAGCCCTCAGGGCCCCGGG - Exonic
1078023358 11:7673128-7673150 CAGGCAGCACACATGGCCTGGGG + Intronic
1078247207 11:9584790-9584812 GAGCCACCACTCTGGGCCTCTGG - Intronic
1079112590 11:17613075-17613097 CAGCCAGCACCCATGACCTCGGG - Intronic
1079131906 11:17751734-17751756 CGGCAAGCCCTCAGGACCTGTGG + Intronic
1081984015 11:47288649-47288671 CATCCAGCACAGAGGGCCAGGGG - Intronic
1082001602 11:47396115-47396137 CTGCCAGCTGTCATGGCCTGGGG - Intergenic
1082195514 11:49299594-49299616 AACCCAGCACTTAGGGGCTGAGG - Intergenic
1082615825 11:55357628-55357650 CAGCCAGCACTCAGTGGGAGAGG + Intergenic
1082782310 11:57297507-57297529 CAGTGAGCACTGAGGGCCTGTGG - Intergenic
1082806372 11:57454266-57454288 CAGCCAGCAGCCAGGCCCGGTGG + Intergenic
1082879396 11:58023373-58023395 CAGCCTGCTCTCATGGCCTTGGG - Intergenic
1083008266 11:59368831-59368853 CAGGCAGCACTCAGGGGGAGAGG + Intergenic
1083171749 11:60927448-60927470 CTAACAGGACTCAGGGCCTGAGG + Intronic
1083647960 11:64184071-64184093 CAGCCAGTGCAAAGGGCCTGGGG - Intergenic
1083715070 11:64570524-64570546 CAGCAAGCACTCTGGACATGTGG + Intronic
1084229953 11:67744369-67744391 AAGGCAGCAGTCAGGGCCTGAGG + Intergenic
1084309857 11:68310791-68310813 CAGCAAGCACAAAGGCCCTGAGG + Intergenic
1084352578 11:68613155-68613177 CCGCCACCACTCAGGGGCTCTGG + Exonic
1084509409 11:69593842-69593864 CAGCCTCCAATCAGGCCCTGGGG - Intergenic
1086060708 11:82696842-82696864 CACCCAGCACCCAGTGCCTGGGG - Intergenic
1087146713 11:94820489-94820511 AAGCTAGCGCACAGGGCCTGAGG - Intronic
1087540284 11:99508466-99508488 CAGCCAGCACTCAGTATGTGTGG - Intronic
1088132312 11:106508172-106508194 CAGCAAACACTGAGTGCCTGTGG + Intergenic
1088649213 11:111942511-111942533 GAGCCCACCCTCAGGGCCTGTGG - Intronic
1088725352 11:112629646-112629668 GAACCAGCACTCAGGGGATGGGG - Intergenic
1088788358 11:113202520-113202542 CAGCCAGCTCACATGGCCTGAGG - Intronic
1089163432 11:116457159-116457181 GGGCCAGCTCTCAGGGCCTCAGG - Intergenic
1089816589 11:121182236-121182258 CACACACCACTTAGGGCCTGAGG - Intronic
1090029695 11:123196000-123196022 CAGCCAGCACCCAGGGGAAGGGG + Intergenic
1090086448 11:123654577-123654599 CTGACAGCACACACGGCCTGGGG - Exonic
1090247219 11:125224964-125224986 CACCCAGCACCCAGACCCTGGGG - Intronic
1090388115 11:126368391-126368413 CAGTCGGCCCTCAGGCCCTGTGG + Intronic
1091060283 11:132454598-132454620 AAGCCAGCACCCAGGGCCTTCGG + Intronic
1202812329 11_KI270721v1_random:32313-32335 AAGCCAGCACTGAAGCCCTGGGG - Intergenic
1091394082 12:142964-142986 CAGACAACAGTCAGGGCCTGTGG - Intronic
1091810308 12:3391433-3391455 CAGCCAGCACAAATGCCCTGGGG + Intronic
1091825581 12:3510177-3510199 TTGCGGGCACTCAGGGCCTGGGG + Intronic
1091914947 12:4264798-4264820 CAGCCATCCCTCAGTGTCTGTGG - Intergenic
1092053502 12:5490241-5490263 CAGCCAGTAAGCAGTGCCTGGGG + Intronic
1092306552 12:7306696-7306718 CAGCCACCACTCAGGGATTCTGG - Exonic
1095216453 12:39555853-39555875 CAGGCAGGACTCAGTGGCTGGGG + Intronic
1096408727 12:51362190-51362212 AAGACAAGACTCAGGGCCTGTGG - Intronic
1097277715 12:57824475-57824497 CAGCCAGTTCTCCGGGTCTGTGG - Intronic
1097352262 12:58561934-58561956 CAGCAAGCACAAAGGCCCTGGGG + Intronic
1099844609 12:88013894-88013916 GAGCCAGAACTGAGAGCCTGTGG + Intronic
1100357152 12:93842243-93842265 CAGACAGGACCCTGGGCCTGTGG + Intronic
1100465237 12:94838705-94838727 CAGCCCATACTCAGGGCATGGGG - Intergenic
1101232300 12:102753919-102753941 CAGCCAACACTCATTGCCTCTGG + Intergenic
1101825715 12:108218605-108218627 GGGGCATCACTCAGGGCCTGTGG - Intronic
1101967349 12:109290697-109290719 CACAGAGCACTCAGGGCCTGTGG + Intronic
1105214173 13:18274669-18274691 CAGTCTGCACTCAGGGCCCCAGG - Intergenic
1105948861 13:25212067-25212089 CAGCATGCACTCATAGCCTGGGG - Intergenic
1106618415 13:31351892-31351914 CACCAAGCTCTCAGGGCCTGTGG - Intergenic
1108110854 13:47070733-47070755 AAGCAAGCACACAGGTCCTGAGG - Intergenic
1108434057 13:50384533-50384555 CAGCCAGCATCCAGGACCAGAGG - Intronic
1108713895 13:53060117-53060139 CAGCCAGCATCGGGGGCCTGAGG - Intergenic
1113395402 13:109942819-109942841 TGGCCAGCACTCAGGGGCTAGGG + Intergenic
1113451177 13:110411025-110411047 AAGCCCTCACTCACGGCCTGTGG + Intronic
1113863097 13:113502908-113502930 CGCCCAGCACCCTGGGCCTGGGG + Intronic
1114529705 14:23388111-23388133 CAGCCAGCATGCAGGGCAAGGGG - Intronic
1114535057 14:23417459-23417481 CAGCCAGCATGCAGGGCAAGGGG - Intronic
1115643833 14:35352920-35352942 CAGCCAGGCATCAGGGCCTGGGG - Intergenic
1117440245 14:55752882-55752904 CTTCCAGCACTGAGGTCCTGTGG - Intergenic
1117690482 14:58299640-58299662 CAGCCAGGACGCAGGAGCTGAGG - Intronic
1117882781 14:60328171-60328193 CAGCATTCACCCAGGGCCTGCGG + Intergenic
1118442304 14:65822823-65822845 CAGCCAGCACATGGGCCCTGAGG - Intergenic
1119884550 14:78129527-78129549 CAGCCAGCACTAAGGGTCATAGG + Intergenic
1121005732 14:90489535-90489557 CAGCAAGCCCTGAGGGGCTGGGG + Intergenic
1121931117 14:97973061-97973083 CAGGAAGCACTCAGTGCCTATGG - Intronic
1122263161 14:100534657-100534679 CTTCCAGAACACAGGGCCTGTGG - Intergenic
1122418457 14:101561257-101561279 CAGCCAGCTCTCGGGGGCGGGGG - Intergenic
1122428309 14:101624235-101624257 CAGCAAGCGCACAGGCCCTGAGG - Intergenic
1122540883 14:102497125-102497147 GAGCCTGCAGACAGGGCCTGTGG + Intronic
1122686654 14:103511444-103511466 CAGCCCGCCCCCAGGACCTGTGG + Intergenic
1122768239 14:104085712-104085734 CAGCGGGGACGCAGGGCCTGCGG - Exonic
1123044609 14:105505235-105505257 AAGCCAGCACCCTGGGCCCGTGG + Intergenic
1124107416 15:26753121-26753143 CGGGCAGCCCTCAGTGCCTGGGG - Intronic
1124110555 15:26781673-26781695 CATTCAGCACCCAGGGGCTGAGG - Intronic
1124399474 15:29335731-29335753 GAGCCAGCTCTCAGGTTCTGTGG - Intronic
1124511544 15:30331601-30331623 GAGCCAGCCCTCTGGGCGTGTGG + Intergenic
1124595115 15:31085931-31085953 CACCCATCAGTCTGGGCCTGGGG - Intronic
1124731370 15:32199156-32199178 GAGCCAGCCCTCTGGGCGTGTGG - Intergenic
1124808574 15:32910757-32910779 CAGAAAGGACTCAGAGCCTGAGG - Intronic
1125202663 15:37113685-37113707 CAGCCAGCCCTCAGGGACCCTGG - Intergenic
1125260617 15:37820725-37820747 CATGCAGCACTCAGGGCCACAGG + Intergenic
1125477403 15:40056252-40056274 CAGCCAGAGCTCTGCGCCTGTGG - Intergenic
1127303979 15:57684076-57684098 GAGCCACCACGCTGGGCCTGGGG + Intronic
1127613765 15:60662876-60662898 CAGTCAACACTCAGGGCCCCAGG - Intronic
1128127515 15:65203990-65204012 CAGCAAGCACGAAGGCCCTGAGG + Intronic
1128717558 15:69919834-69919856 CAGGCAGCACTGGGGGCCTCAGG - Intergenic
1129231735 15:74200898-74200920 CAGCCAGTGCCCAGGCCCTGAGG + Intronic
1129329918 15:74821823-74821845 CAGGAAGCATCCAGGGCCTGGGG - Exonic
1130044079 15:80430587-80430609 AAGCCAGCACAGAGGGACTGAGG - Intronic
1130540574 15:84818122-84818144 CAGCCCCCACTCAGGTCCTGGGG - Intronic
1130791508 15:87160589-87160611 CAGCTAGCATTGAGTGCCTGTGG - Intergenic
1132321869 15:100931275-100931297 CATCCAGCACCCAGGGGCCGTGG + Intronic
1132671660 16:1104429-1104451 CTGCCACCTCTCAGAGCCTGGGG - Intergenic
1132672303 16:1106812-1106834 CACCCATCAGTCAGGGCCAGGGG - Intergenic
1133286262 16:4692230-4692252 CAGCCAGCGCCCAGGGCCCGTGG - Intergenic
1133819634 16:9225191-9225213 CTGCAGGCACTGAGGGCCTGGGG + Intergenic
1134111162 16:11516255-11516277 CATCCTGCACTCTGGGCGTGTGG - Exonic
1134307463 16:13046057-13046079 CAGGCATCACTGAGGGTCTGTGG + Intronic
1134419231 16:14070977-14070999 CAGCGAGCACTCAGGACGGGTGG + Intergenic
1135203904 16:20465680-20465702 CAGCCACCACTCAGGCACTCGGG - Exonic
1135215101 16:20559262-20559284 CAGCCACCACTCAGGCACTCGGG + Exonic
1136398970 16:30007554-30007576 CTGCCTCCATTCAGGGCCTGGGG + Intronic
1136690607 16:32025644-32025666 CAGCCAGGCCCCAGGGTCTGGGG + Intergenic
1136690686 16:32025950-32025972 CAGCCAGCGCCCCTGGCCTGTGG - Intergenic
1136791195 16:32969208-32969230 CAGCCAGGCCCCAGGGGCTGGGG + Intergenic
1136878619 16:33884724-33884746 CAGCCAGGCCCCAGGGGCTGGGG - Intergenic
1137369187 16:47888854-47888876 CAGCCAGCACAAAGGTCCTGAGG - Intergenic
1137475136 16:48801293-48801315 CATCCAGCACAGAGGCCCTGAGG - Intergenic
1137476938 16:48817374-48817396 CAGCCAGCCTGCAGAGCCTGGGG + Intergenic
1138506135 16:57479227-57479249 CAGCCAGCCCTCTGGGGCGGGGG + Intronic
1138738481 16:59280083-59280105 CAGACAGCTCTCAGGCTCTGGGG - Intergenic
1139833710 16:69821410-69821432 CAGCCAGCACTCAGTGACACAGG - Intronic
1139952964 16:70680851-70680873 CAGCCAGCACGGTGGTCCTGGGG + Exonic
1140229429 16:73105465-73105487 GAGCCAGCACGCCTGGCCTGGGG - Intergenic
1140470802 16:75213278-75213300 CCCGCAGCACTCAGGGCCTCAGG + Intergenic
1140711665 16:77684299-77684321 AAGCCAGCAAACAGGGCCTGGGG - Intergenic
1141424282 16:83935339-83935361 CAGCCAGTACAAAGGCCCTGGGG + Intronic
1141493309 16:84389657-84389679 CAGGGAGCACTGAGGGCCTTAGG - Intronic
1141590170 16:85063156-85063178 CACCCAGCACTCAGGGCTTCTGG + Intronic
1141875761 16:86823170-86823192 CAGGCAGCACCCGGGGCTTGTGG + Intergenic
1142384205 16:89752294-89752316 CAGCCATCACTCAGCTCCGGAGG - Intronic
1203093404 16_KI270728v1_random:1230670-1230692 CAGCCAGGCCCCAGGGGCTGGGG + Intergenic
1142519519 17:495048-495070 CAGCCAGCATGCGGGGCCTGGGG - Intergenic
1142581895 17:948497-948519 CAGCCGTCCCTCAGTGCCTGTGG - Intronic
1142960201 17:3547787-3547809 CAGCCAGGCCACAGGGCCGGGGG - Intronic
1142993718 17:3748746-3748768 CAGCCAGTGCCAAGGGCCTGTGG + Intronic
1143302972 17:5924599-5924621 CTTCAAGAACTCAGGGCCTGAGG - Intronic
1143405098 17:6671980-6672002 CAGTCACCTCTCAGGCCCTGTGG + Intergenic
1143492806 17:7294106-7294128 CAGTTAGCGCTCTGGGCCTGCGG + Intronic
1143711047 17:8735639-8735661 CAGCCAGCCCCTGGGGCCTGAGG + Intronic
1144807802 17:17979169-17979191 CAGCCAGTGCAAAGGGCCTGGGG + Intronic
1145043874 17:19596969-19596991 GAGGCAGCACGCAGGGCCTGTGG + Intergenic
1145270310 17:21401291-21401313 CAGCCAGGTGTGAGGGCCTGGGG - Intronic
1146059631 17:29597713-29597735 CAGGCGGCACTCTGGGCTTGTGG + Intronic
1146927339 17:36754174-36754196 CAGCCAGCACAAAGGCCCTGAGG + Intergenic
1147153469 17:38531787-38531809 CAGCCAGGCCCCAGGGTCTGGGG + Exonic
1147153550 17:38532093-38532115 CAGCCAGCGCCCCTGGCCTGTGG - Exonic
1147326024 17:39670024-39670046 CTCCCAGCACCCAGGGGCTGGGG - Exonic
1147537285 17:41328882-41328904 CAGCCAGCAGTATGGACCTGGGG + Intergenic
1147863751 17:43539659-43539681 AAGTCAGCACTGTGGGCCTGAGG + Intronic
1148342943 17:46884215-46884237 CAGCCAGCCCTCCGAGCCCGGGG + Intronic
1148444321 17:47728286-47728308 CAGCCTCCACTCAGGGCCTGGGG - Intergenic
1148596957 17:48864362-48864384 CAGCAAGAAGTCAGGGCCTCGGG - Intronic
1150476078 17:65476334-65476356 CAGCCAGCACTGAGGGCTGGGGG - Intergenic
1150630192 17:66875051-66875073 CAGGCAGAACCCAGGTCCTGGGG - Intronic
1151009083 17:70472854-70472876 CAGGCAGCTCTCAGGCTCTGGGG - Intergenic
1151719182 17:75845936-75845958 CGGCCAGCACACAGGGTCAGGGG + Exonic
1151829864 17:76543166-76543188 GAGCCCACACCCAGGGCCTGGGG - Exonic
1151968952 17:77447454-77447476 CAGCCAGATCCCATGGCCTGTGG + Intronic
1151989286 17:77564016-77564038 CAGGAAGCACTCAAGGCCTCTGG - Intergenic
1152516243 17:80826501-80826523 CTGCCAGCAGCCAGGGCCTCCGG + Intronic
1152801402 17:82332494-82332516 CAGCCACCCCTCAGGTGCTGTGG - Intronic
1152839974 17:82561208-82561230 CAGGCAGCACTCAGGTGCTCAGG - Intronic
1153104528 18:1511440-1511462 CAGGCAGCTCTCAGGCTCTGAGG + Intergenic
1153925555 18:9832207-9832229 CAGCCAGCACCCCAGGCCGGTGG + Intronic
1154308302 18:13246567-13246589 CAGCCACCCCTTAGGGGCTGTGG - Intronic
1155188290 18:23406723-23406745 CAGGCAGCACTCAGAACCAGAGG - Intronic
1155362288 18:25015628-25015650 CAGCCAGCATGCAGGGTCAGGGG + Intergenic
1156177686 18:34565995-34566017 TAGCAAGCACTCAGTGACTGTGG + Intronic
1156881765 18:42088473-42088495 CAGCAAGCACCCGGGGCCTCAGG - Intergenic
1157151575 18:45223728-45223750 CAGCCAGCCCTGAGGTCCAGAGG + Intronic
1157612236 18:48964350-48964372 GAGGCAGGACTCAGGGCCAGAGG + Intergenic
1158346732 18:56523660-56523682 CAGCTGGCACTCAGGGTTTGTGG - Intergenic
1158691625 18:59666513-59666535 AAGGCATCACTCAGGGCCTGTGG + Intronic
1159934960 18:74357270-74357292 CCACCAGCACTCAGGGGCTCAGG - Exonic
1160692892 19:467902-467924 CAGCCACAACTCAGGGCCCCTGG - Intronic
1161326692 19:3667650-3667672 CACCCACCACGGAGGGCCTGGGG + Intronic
1161396733 19:4048453-4048475 CACACAGCACTCAGGGTCCGAGG - Intronic
1161480503 19:4508017-4508039 CAGGGAGCCCGCAGGGCCTGGGG - Intronic
1162053835 19:8051106-8051128 CAGCCAGGACACAGGGACTGGGG - Intronic
1162121951 19:8476081-8476103 CAGTCAGGATTCAGAGCCTGGGG + Intronic
1162792398 19:13069873-13069895 CAGCCACGAGGCAGGGCCTGGGG + Intronic
1162998172 19:14349660-14349682 CAGCCAGCGCAAAGGCCCTGTGG + Intergenic
1163323071 19:16585939-16585961 CAGTAATTACTCAGGGCCTGAGG - Intronic
1163696742 19:18768133-18768155 CAGCCAGCTCCCAGCCCCTGTGG - Intronic
1164213009 19:23116900-23116922 CATCTGTCACTCAGGGCCTGAGG + Intronic
1164564598 19:29316838-29316860 CAGCCAGCACAAGGGCCCTGGGG - Intergenic
1165095411 19:33407268-33407290 CTTGCAGCACTCCGGGCCTGAGG - Intronic
1166733490 19:45071368-45071390 CGGCCAGCCCCCAGTGCCTGGGG - Intergenic
1167074223 19:47239444-47239466 AAGCCAGGACTCAGGCCCTGCGG - Intergenic
1167094647 19:47368163-47368185 CAGCCAGTACAGAGGCCCTGTGG + Intronic
1167182045 19:47912093-47912115 CAGCCAGTACAGAGGCCCTGTGG - Intergenic
1167184011 19:47927861-47927883 CAGCCAGTACAGAGGCCCTGTGG - Intergenic
1167185334 19:47938574-47938596 CAGCCAGTACAGAGGCCCTGTGG - Intergenic
1167186652 19:47949331-47949353 CAGCCAGTACAGAGGCCCTGTGG - Intergenic
1167187303 19:47954719-47954741 CAGCCAGTACAGAGGCCCTGTGG - Intergenic
1167267091 19:48488635-48488657 CAGCTTGCACACAGGGCCTGAGG - Intronic
1167348222 19:48960064-48960086 AAGCCTGCACACAGGGCTTGTGG + Intronic
1167541886 19:50093545-50093567 CAGCCAGTACAGAGGCCCTGTGG + Intergenic
1167543866 19:50108080-50108102 CAGCCAGTACAGAGGCCCTGTGG + Intergenic
1167544540 19:50113434-50113456 CAGCCAGTACAGAGGCCCTGTGG + Intergenic
1167545215 19:50118784-50118806 CAGCCAGTACAGAGGCCCTGTGG + Intergenic
1167545892 19:50124136-50124158 CAGCCAGTACAGAGGCCCTGTGG + Intergenic
1167546569 19:50129471-50129493 CAGCCAGTACAGAGGCCCTGTGG + Intergenic
1167547229 19:50134805-50134827 CAGCCAGTACAGAGGCCCTGTGG + Intergenic
1167745221 19:51346864-51346886 CAGCGGGCACTGAGGGCCTGGGG - Intronic
1167939837 19:52937702-52937724 CAGGGAAGACTCAGGGCCTGGGG - Intronic
1167988466 19:53338135-53338157 CAGGGAAGACTCAGGGCCTGGGG + Intronic
1168122043 19:54256961-54256983 CTGCCTGCACGCAGGTCCTGGGG + Exonic
1168173679 19:54607883-54607905 CTGCCTGCACGCAGGTCCTGAGG - Intronic
1168295034 19:55374178-55374200 CAGCCAGGGCCCAGGCCCTGGGG + Intergenic
925200990 2:1967786-1967808 CAGGCAGGGCTCGGGGCCTGCGG - Intronic
925878353 2:8330434-8330456 CAGCCAGGAAGCAGAGCCTGTGG - Intergenic
926111842 2:10188680-10188702 CAGCTGGGACCCAGGGCCTGGGG + Intronic
926742511 2:16124600-16124622 GAGCCACCACTCCTGGCCTGGGG - Intergenic
927519632 2:23690978-23691000 CAGCCAGCAGCCATGACCTGGGG - Intronic
927861624 2:26563291-26563313 AAGCCAGCGCTCAGGGCAAGTGG - Intronic
928099850 2:28430577-28430599 GAGGCAGCACTTAGGGCGTGAGG - Intergenic
928135977 2:28687775-28687797 CTGCCAGCTCTCAGGTTCTGTGG + Intergenic
929488559 2:42376326-42376348 CAGGCAGCACTCGGGGCCCTAGG - Intronic
929602053 2:43210608-43210630 CAGCCAGCCCACGGGGCCTCAGG + Intergenic
931242594 2:60466527-60466549 CACCCAGCCCTCAGGACCTGAGG + Intronic
931442044 2:62296924-62296946 CACTCAGCATTCAGAGCCTGTGG + Intergenic
932376008 2:71236346-71236368 CAGCCCGCACTCTATGCCTGCGG - Intergenic
932501183 2:72183934-72183956 CTGACAGCACCCAGGGCCTATGG + Intronic
932598251 2:73107537-73107559 CAGCCAGGGCTCAGGGCCAGGGG + Intronic
932836437 2:75042392-75042414 TAGCCAGCACTCAGGATCTCTGG + Intergenic
933247023 2:79987039-79987061 CACACAGCACTCTGGGCCCGGGG - Intronic
933857470 2:86429512-86429534 CAGCCAGTTCTCAAGCCCTGGGG - Intergenic
934300146 2:91772081-91772103 CAGTCTGCACTCAGGGCCCCAGG + Intergenic
934687730 2:96333953-96333975 CATACACTACTCAGGGCCTGAGG + Intergenic
935066912 2:99657115-99657137 AAGGCAGACCTCAGGGCCTGAGG + Intronic
935082209 2:99809307-99809329 CACCCAGCTCTCAGGGTCTACGG + Intronic
935124798 2:100214001-100214023 CAGCCAGCATTCCTAGCCTGAGG + Intergenic
935184708 2:100721698-100721720 CAGGCAGCACTCAGAACCAGAGG - Intergenic
935758697 2:106298557-106298579 AAGACAGCACTCAGGGGATGGGG + Intergenic
936155425 2:110043653-110043675 CAGCCACCCCTCTGAGCCTGGGG + Intergenic
936189261 2:110327781-110327803 CAGCCACCCCTCTGAGCCTGGGG - Intergenic
937248727 2:120510398-120510420 CAGCCACGTCTCAGGGGCTGGGG + Intergenic
938370336 2:130764282-130764304 CAGCCAGCACACAGGACCAGAGG + Exonic
938417124 2:131112944-131112966 CAGCCACAAGTCAGGGCCTCTGG - Intronic
939588298 2:144032065-144032087 GAGCCACCGCTCCGGGCCTGGGG + Intronic
941805298 2:169706549-169706571 CAGCCACCACGCCTGGCCTGTGG - Intronic
943991808 2:194705620-194705642 CAGACAGCATTCAGGGACTGGGG - Intergenic
944995783 2:205292014-205292036 CAGCATGCACTGAGGTCCTGAGG - Intronic
945034998 2:205697083-205697105 CAGCCAGCAGTCAGGGCTCTGGG - Intronic
945061066 2:205909369-205909391 CAGCAGGCACTGAGGGCTTGGGG - Intergenic
946026500 2:216674841-216674863 CAGCCTGCAATGAGGGACTGAGG - Exonic
946201877 2:218075367-218075389 CACCCAGCACCCAGGGACAGGGG + Exonic
947471324 2:230403866-230403888 CAGCCACCACTCAGCAGCTGGGG - Intergenic
947503715 2:230690993-230691015 CAGCCAGCAGGCACTGCCTGGGG + Intergenic
948458993 2:238120208-238120230 CAGCCGGCACTCCTGGGCTGTGG - Intronic
949017029 2:241719322-241719344 CAGCCCTCACTCAGTGCATGAGG + Intronic
1170071902 20:12378485-12378507 CAACCAGCACCCAGGAGCTGCGG + Intergenic
1170601806 20:17847051-17847073 CAGCCAGCACTCTGGTTTTGGGG + Intergenic
1170733251 20:18991864-18991886 CAGCAAGCACAAAGGTCCTGAGG - Intergenic
1171386924 20:24776760-24776782 CAGCCATGCCTCAGGGCCTTTGG - Intergenic
1171388627 20:24786826-24786848 CAGAGAGCACTCGGGGCATGAGG + Intergenic
1171401980 20:24879618-24879640 GAGGCAGCACAGAGGGCCTGGGG + Intergenic
1172440034 20:34958887-34958909 CAGGCACCAGTCAGGTCCTGGGG - Intergenic
1172830239 20:37827811-37827833 CAACCATCATGCAGGGCCTGTGG + Intronic
1172933000 20:38599603-38599625 CACACAGCACACAGGCCCTGGGG + Intergenic
1172987909 20:39007749-39007771 TAGGCAGAACCCAGGGCCTGAGG + Intronic
1173132522 20:40408129-40408151 GAGCCAGAACTCTGGGCATGTGG - Intergenic
1173224837 20:41156355-41156377 CAGCCATCACCATGGGCCTGGGG + Intronic
1173893393 20:46530914-46530936 CAGCCAGGGCTGAGGGCCAGTGG - Intergenic
1174097310 20:48099555-48099577 CAGCCATCACTGAGTGCCAGGGG + Intergenic
1174128774 20:48327305-48327327 CAGACCGCCCTCGGGGCCTGAGG - Intergenic
1174183011 20:48686838-48686860 CAGCTGGCACTCATGGCCTGAGG - Intronic
1174375408 20:50123581-50123603 CAGCAAGTACACAGGCCCTGAGG - Intronic
1174423080 20:50413175-50413197 CAGCCGGCACAAAGGCCCTGAGG + Intergenic
1174895985 20:54450391-54450413 CAACCAGCACCCTGGGCCTTAGG + Intergenic
1175045389 20:56100133-56100155 CAGCAAGCACCAAGGCCCTGGGG + Intergenic
1175736139 20:61388557-61388579 CAGGCAACACTCACGGCCAGTGG - Intronic
1175886347 20:62293289-62293311 CGGCTGGCACTCAGGGCCCGAGG - Intronic
1176018660 20:62951879-62951901 CAGCCACCACCCAGGGGCCGAGG - Intergenic
1176969961 21:15253737-15253759 CAGCCAGGACTCAAGGAATGTGG + Intergenic
1177342999 21:19828783-19828805 CCCCCAGCACACAGAGCCTGAGG - Intergenic
1179469580 21:41601596-41601618 GAGTGAGCACTCAGGGGCTGTGG + Intergenic
1179678881 21:43003723-43003745 CAGGCAGCATGCTGGGCCTGGGG - Intronic
1179801408 21:43813112-43813134 CGGCCAGGACTCCGGGGCTGTGG - Intergenic
1179820826 21:43935862-43935884 CAGCCAGGGCTCGGGGCTTGGGG + Intronic
1180050956 21:45330776-45330798 CAGTCAGGACTCAGGGCCTGAGG + Intergenic
1180071874 21:45440712-45440734 CCGGAAGCAGTCAGGGCCTGCGG + Intronic
1180120905 21:45747525-45747547 CAGCCAAGACCCAGGGCCTGCGG + Intronic
1180557713 22:16591393-16591415 GAGCCACCACCCAGGGGCTGCGG - Exonic
1181041894 22:20196233-20196255 CAGGCAGAACTCAGGGACAGAGG - Intergenic
1181555876 22:23671442-23671464 CAGTCTGCACTCAGGGCCCCAGG - Intergenic
1181603160 22:23964256-23964278 CAGCCAGCACTGATGGGCTAGGG - Intergenic
1181605353 22:23977051-23977073 CAGCCAGCACTGATGGGCTAGGG + Intronic
1181698501 22:24607211-24607233 CAGTCTGCACTCAGGGCCCCAGG + Intronic
1182042672 22:27250585-27250607 CAGCCAGTACAAAGGCCCTGGGG + Intergenic
1182436287 22:30332650-30332672 CAAGCAGCACACTGGGCCTGTGG + Exonic
1182754309 22:32666490-32666512 CAGCAAGGACGAAGGGCCTGAGG - Intronic
1183315380 22:37134063-37134085 CAGTCAGCACTCAGGATCCGTGG + Intronic
1183405342 22:37627785-37627807 CAGCCTGCAGCCTGGGCCTGGGG + Intronic
1184101902 22:42345161-42345183 CAGCCAGGTCTCAGGGCCACCGG + Intergenic
1184121423 22:42452912-42452934 CAGCCCACACACAGGGCCAGGGG - Intergenic
1184510173 22:44928846-44928868 CACCCACCATTCAGGCCCTGGGG + Intronic
1184728046 22:46357686-46357708 CAGCAAGAACTCAGGGCATCTGG - Intergenic
1184738380 22:46412341-46412363 CAGCCAACACCCAAGTCCTGGGG + Intronic
1184755261 22:46512237-46512259 CAAGAAGCACTCAGGGACTGAGG + Intronic
1185073253 22:48668765-48668787 CCCCCAGCACTCAGGGCCACAGG + Intronic
1185087413 22:48748440-48748462 CAGCCAGCCCTCTCTGCCTGTGG - Intronic
1185109739 22:48894278-48894300 CGTCCTGCAGTCAGGGCCTGAGG - Intergenic
1185385453 22:50529703-50529725 CTGCCATCGCTCCGGGCCTGCGG + Exonic
1185399164 22:50607065-50607087 CGGGCAGCCCTCAGGGTCTGTGG - Intronic
949484816 3:4527819-4527841 GTGCCAGCACTCTGGGACTGGGG - Intronic
949517742 3:4822255-4822277 CAGCCAGGAAGCAGGGGCTGCGG + Intronic
950041535 3:9922831-9922853 TAGCCAGCAAAAAGGGCCTGGGG + Intronic
950483828 3:13261177-13261199 CAGCCAGCACTCCTGGCAGGCGG - Intergenic
950643019 3:14360519-14360541 CAGCCAGACCCCAGGGCCTGGGG - Intergenic
952423072 3:33148692-33148714 CAGCCAACACTCAGGGCAGCTGG + Intergenic
952791527 3:37204425-37204447 GAGCCAGCACAAAGGCCCTGAGG + Intergenic
953863634 3:46565574-46565596 CTCCCAGAACTCAGGGACTGGGG - Intronic
953867058 3:46593295-46593317 CAGCCAGCACACAGGTACCGAGG - Intronic
953907766 3:46876862-46876884 CAGCCGGGTCACAGGGCCTGGGG + Intronic
954145377 3:48631821-48631843 CAGCTAGCACTCAAGGCCATGGG + Intronic
954334575 3:49908904-49908926 CAGCCAGCGGGCAGGGACTGTGG - Exonic
954385581 3:50242232-50242254 GAGGCAGCACTCAGGCTCTGGGG - Intronic
954426166 3:50444188-50444210 AAGCCACCAGTCAGGCCCTGGGG + Intronic
954466858 3:50660368-50660390 CCCCCAGCACCCAAGGCCTGAGG - Intergenic
955409038 3:58643999-58644021 CAGCCAGGCCTCACGGCCTGGGG - Intronic
955953907 3:64268383-64268405 CTGCCAGCTCTCAGGACCTCTGG - Intronic
957046529 3:75379219-75379241 AAGGCAGCAGTCAGGGCCCGAGG + Intergenic
960553308 3:119001058-119001080 CAGCCAGTACAAAGGTCCTGAGG - Intronic
960955578 3:123028148-123028170 ACCCCAACACTCAGGGCCTGAGG + Intronic
961822985 3:129584685-129584707 TGGCCAGGACTCAGGGCCAGAGG + Intronic
961878587 3:130043462-130043484 AAGGCAGCAGTCAGGGCCCGAGG + Intergenic
962649727 3:137476337-137476359 CAGCCAGTACAAAGGCCCTGAGG - Intergenic
964518095 3:157534301-157534323 CAGCCAGCACAGAGGCCCTGAGG - Intergenic
964679203 3:159318631-159318653 CAGCCTGCACTGATGGCCTCAGG - Intronic
966300575 3:178475251-178475273 CGGCCAGCAGTCAGTGCCAGAGG + Intronic
966372369 3:179263057-179263079 CATCCACCACTCAAGGTCTGAGG - Intronic
966852041 3:184170467-184170489 CAGCGAGCGCTCAGGGCCGGCGG + Exonic
966910935 3:184559638-184559660 CAGCCAGCACTCCGGGGCATGGG + Intronic
966924423 3:184635184-184635206 CAGCCAGGACTCAGCGACTTTGG + Intronic
967906743 3:194507762-194507784 CAGCCAGGACGCAGGCCCTAAGG - Intergenic
968266781 3:197368932-197368954 CAGCCAGACCTCGGGACCTGTGG + Intergenic
968629330 4:1642064-1642086 CAGCCACCTCTGAGGCCCTGTGG + Intronic
968668824 4:1836855-1836877 CGGCCAGCACTCTGGGCTCGGGG + Intronic
968764241 4:2459755-2459777 CAGCCAGGCTTCGGGGCCTGGGG - Intronic
968815791 4:2820989-2821011 CAGCCTGCAGCCAGGACCTGGGG + Intronic
969113230 4:4856421-4856443 CAGCGAGCAGGCAGGCCCTGGGG - Intergenic
969228464 4:5814097-5814119 AAGGCAGCACTCAGGGCCAGGGG + Exonic
969311249 4:6354057-6354079 CAGCCAGCCTTCAGGTCCTGGGG + Intronic
969317337 4:6390170-6390192 CAGCCGGCACTCAGGACCTAAGG - Intronic
969537325 4:7764647-7764669 CAGCCAGCACTCAGGGCCTGTGG - Intronic
969824526 4:9747012-9747034 AAGGCAGCAGTCAGGGCCCGAGG - Intergenic
972287506 4:37663043-37663065 CAGCCATCAGTGAGGGTCTGTGG - Intronic
972379346 4:38504719-38504741 CTGCCAGCACTCAGGTCCTCAGG + Intergenic
972594469 4:40517598-40517620 CAGTCAGCCCTCAGTGTCTGTGG + Intronic
973931081 4:55793714-55793736 CAGGGAGCCCTCAGGGCTTGGGG + Intergenic
976482688 4:85563204-85563226 CAGCCAACATTCAGACCCTGTGG + Intronic
977005873 4:91569268-91569290 CAGCCAGCACTCAAGGGGAGAGG - Intronic
977151487 4:93518817-93518839 CAGCCAGTACAAAGGCCCTGAGG + Intronic
977384060 4:96315973-96315995 CAGCCAGCACTTAGCAGCTGAGG - Intergenic
979940732 4:126758957-126758979 AGGTCAGCTCTCAGGGCCTGAGG - Intergenic
981741613 4:148008051-148008073 CAGCTTGCAATCATGGCCTGTGG + Intronic
982965466 4:161901333-161901355 CAGACAGCACACAGGGCCTCAGG + Intronic
983904615 4:173169725-173169747 CCCCCAGCCCTCAGCGCCTGGGG + Intronic
983978013 4:173960379-173960401 CAGCCAACACTCAGGGAGAGGGG - Intergenic
984028482 4:174573700-174573722 GAGCCATCACGCCGGGCCTGTGG + Intergenic
984840110 4:184060351-184060373 GAGGCAGCACCCAGGGCCTGGGG - Intergenic
985731237 5:1550196-1550218 CTGACAGCACTCAGGCCCAGGGG - Intergenic
985777490 5:1852384-1852406 CAGCCGCCACTCATGTCCTGCGG - Intergenic
986018357 5:3777945-3777967 CAGCTAGCACTTAGAGCATGAGG + Intergenic
986427352 5:7647431-7647453 CAGCCAGCACACAGTGCATGTGG + Intronic
986969108 5:13311314-13311336 CAGCCAGCACCCAGGCTCTCAGG - Intergenic
987306663 5:16643877-16643899 CAGCCAGCCCTCTGTACCTGTGG + Intergenic
988517355 5:31916475-31916497 CAGCCAGCGCTCCGGGTATGAGG - Intronic
989126037 5:38053237-38053259 CAGGCAGCCCACAGGGCCTGAGG - Intergenic
992155656 5:73952930-73952952 CAGCCAGTGCTCAGAGCCTCTGG - Intergenic
992465453 5:76999721-76999743 CAGGCAGCTCTAAGGGCCTGGGG - Intergenic
992860546 5:80904780-80904802 CAGCCAGTTCTCAGAGCCTTTGG - Intergenic
995725781 5:115179495-115179517 CAGCCCGCAGTCAGAGCGTGTGG - Intronic
996803586 5:127429984-127430006 CAGCTAAAACTCAGGGGCTGGGG - Intronic
996958634 5:129216490-129216512 CAGCCAGGATTCTGGGGCTGTGG + Intergenic
997524027 5:134541089-134541111 CAGGCAGACCTCAGAGCCTGCGG - Intronic
997654934 5:135547639-135547661 CACCCATCACAGAGGGCCTGGGG - Intergenic
998175964 5:139902307-139902329 CAGCCAGCACTCCTGCACTGAGG + Intronic
998367430 5:141640197-141640219 GAGCCAACACTGAGGGCCGGAGG + Exonic
998716443 5:144889783-144889805 CTGGCAGCACTCATGGCCAGGGG + Intergenic
998777861 5:145623164-145623186 GAGCCACCACTCCCGGCCTGTGG - Intronic
999372869 5:151066827-151066849 CAGCCAGGACACAGAGCCAGAGG + Intronic
1000165459 5:158643874-158643896 CAGCCAGTACAAAGGCCCTGAGG - Intergenic
1001042040 5:168343048-168343070 CATCCAGCCCTAAGAGCCTGGGG + Intronic
1001199126 5:169699862-169699884 CACCCAGCCCACAGGGCCTCTGG - Intronic
1001402157 5:171451834-171451856 CAGCCAGGACTCAGGGCAAGTGG - Intronic
1001936585 5:175709855-175709877 GTCCCAGCACACAGGGCCTGAGG - Intergenic
1002199568 5:177520128-177520150 CAGCTGGCAGTCAGGGCCTCAGG + Exonic
1002206148 5:177563929-177563951 CTGCCACAACTCAGGGGCTGCGG - Intergenic
1002343459 5:178532036-178532058 CAGCCTGCACTCATGGGATGTGG - Intronic
1002391644 5:178917896-178917918 CAGCCAGTGCTAAGGCCCTGAGG - Intronic
1002570095 5:180135295-180135317 CAGACATCACTCAGGCTCTGAGG - Intronic
1002573931 5:180161076-180161098 CAGCCTGTGCTCAGGACCTGGGG + Intronic
1005134086 6:22546864-22546886 GAGCCACCACTCCCGGCCTGAGG - Intergenic
1005726602 6:28655330-28655352 GAGCCAGAACTCATGGCCTGGGG + Intergenic
1006798899 6:36747062-36747084 CAGCCATCACCAAGGTCCTGAGG - Intronic
1007293911 6:40806694-40806716 CAGGCTGCACAGAGGGCCTGGGG + Intergenic
1008194234 6:48498525-48498547 AAGCCAGCACTAAGGGAGTGCGG + Intergenic
1011392415 6:86868210-86868232 CAGCCAGCACTCAAGGGGAGAGG + Intergenic
1011626885 6:89290395-89290417 CAGCCACCTCTCAGGACCAGGGG + Intronic
1013289478 6:108708187-108708209 CAGACAGCCCTCAGGGGCTCTGG + Intergenic
1013388787 6:109661621-109661643 CAGCCACCACTCATGGCCAGGGG - Intronic
1015811739 6:137167698-137167720 CAGCCACCACCCAGGACCAGTGG + Intronic
1018784626 6:167098503-167098525 CAGAGAGCACTCCAGGCCTGAGG - Intergenic
1019129397 6:169862652-169862674 CAGCCAGGAGCCAGGACCTGGGG - Intergenic
1019272393 7:157662-157684 TTGCCAGCACTCAGGGCCTGTGG + Intergenic
1019419738 7:945496-945518 GAGTCAGCACCCACGGCCTGTGG + Intronic
1019527043 7:1485060-1485082 CAGCCAGCAGTGTGGCCCTGGGG - Intronic
1019659870 7:2218238-2218260 GAGCCAGCCCACAGGGGCTGGGG - Intronic
1019701076 7:2475335-2475357 GTGCCAGCCCCCAGGGCCTGGGG + Intronic
1021480333 7:21108256-21108278 CAACCAACAGTCAGGTCCTGTGG - Intergenic
1024181618 7:46901027-46901049 CTGCCAGCACTCAAGGCAGGAGG + Intergenic
1024230336 7:47358857-47358879 GAGCCAGCACTCAGGCCGTTAGG + Intronic
1024301264 7:47889460-47889482 CAGTCAGTAGTCGGGGCCTGTGG + Intronic
1025247895 7:57331205-57331227 CAGCCAGCGCAAAGGCCCTGAGG - Intergenic
1025801847 7:64794297-64794319 CATCTGTCACTCAGGGCCTGAGG + Intergenic
1025848039 7:65217819-65217841 CAGCCACCACTCCCTGCCTGCGG + Intergenic
1025898277 7:65723684-65723706 CAGCCACCACTCCCTGCCTGCGG + Intergenic
1026525039 7:71146169-71146191 CAGCAGTCACTCAGGGCGTGGGG - Intronic
1026792721 7:73345318-73345340 CAGGCAGCTCTGAGGGCCTTAGG + Intronic
1026876920 7:73884733-73884755 CATCCAGCAGGTAGGGCCTGGGG - Intergenic
1026992107 7:74592501-74592523 CAGCCACCACACCTGGCCTGTGG + Intronic
1028041272 7:86058130-86058152 CAGCCTGACCTCAGGCCCTGAGG + Intergenic
1029623733 7:101706807-101706829 CAGCCAGTGCTCAGGGCCAATGG + Intergenic
1029658930 7:101946071-101946093 AAACCAGCAGTCAGGGACTGAGG + Intronic
1032322454 7:130897589-130897611 CAGCCACCCCTCAGGGCCCCTGG + Intergenic
1032710010 7:134453063-134453085 CGGACACCACTCAGGGCCTGTGG - Intronic
1034619604 7:152446612-152446634 GAGCCACCACCCAGGGGCTGCGG + Intergenic
1034942221 7:155237881-155237903 CAGCCAGCACCTGGGGCCTGAGG + Intergenic
1035391844 7:158509356-158509378 CACCCTGCAGTCAGGGCCAGCGG + Intronic
1035406618 7:158602810-158602832 CACCCAACACACAGAGCCTGGGG + Intergenic
1035674871 8:1449540-1449562 CAGACAGGACTCAGTGGCTGTGG - Intergenic
1036185027 8:6615171-6615193 CACCCAGGTCTCAGGACCTGAGG + Intronic
1037074804 8:14701550-14701572 CAGGCAGCACGGACGGCCTGTGG - Intronic
1038481079 8:27902224-27902246 CAGCCTCCCCTCAGGGACTGAGG - Intronic
1038947453 8:32376725-32376747 CAGCCAGGTTTCAGGGCCTCAGG - Intronic
1041394046 8:57373811-57373833 CAGCCAGAACTCAGGGCTCCAGG + Intergenic
1041914581 8:63126430-63126452 CATCCACCACTCAAGGGCTGAGG + Intergenic
1043284392 8:78511615-78511637 CTCCCAGCACACAGGGCCTCTGG + Intergenic
1044316026 8:90751074-90751096 CAGCCTGACCTCAGGCCCTGAGG + Intronic
1045271780 8:100668317-100668339 CAGCCAAAAACCAGGGCCTGAGG - Intergenic
1045546849 8:103137300-103137322 CAGCCAGAGCTGGGGGCCTGTGG - Intronic
1047223870 8:122940409-122940431 CAGTCAGAACTCAGGGGCAGAGG - Intronic
1048781682 8:138008440-138008462 TTGAAAGCACTCAGGGCCTGAGG - Intergenic
1048998707 8:139810521-139810543 CAGCCAGCTCTCAGGGGATGGGG - Intronic
1049375602 8:142287716-142287738 CAGCCAGATCTCAGGGACAGTGG + Intronic
1049375636 8:142287824-142287846 CAGCCAGATCTCAGGGACAGTGG + Intronic
1053057084 9:34999702-34999724 CAGCCACCACTCAGGTCCTGAGG - Intergenic
1055165324 9:73184969-73184991 CAGCCATCTCTCAGGCTCTGAGG - Intergenic
1057483365 9:95462943-95462965 CAGCCAGCGCTCAGACCCTAAGG - Intronic
1057729717 9:97597877-97597899 CTGCCAGCTCTCAGGGACTGGGG + Intronic
1058774212 9:108267937-108267959 CAGCCAGCAGACAGGATCTGAGG - Intergenic
1060872938 9:127057256-127057278 CAGCTAGCACACAGGGCCTGGGG + Intronic
1061264456 9:129497213-129497235 AAGCCAGCTGGCAGGGCCTGGGG + Intergenic
1061265852 9:129504671-129504693 CAGCCAGTTCAAAGGGCCTGGGG - Intergenic
1061391957 9:130321662-130321684 CAGCCAGGACTGAGAGCCCGGGG - Intronic
1061551519 9:131337443-131337465 CAGCAAGCTCTCAGATCCTGGGG - Intergenic
1061591795 9:131602734-131602756 GGGCCAGCTCTCAGGCCCTGGGG + Intronic
1062043687 9:134415579-134415601 CTGCCACCTCTCTGGGCCTGTGG - Intronic
1062101954 9:134733113-134733135 CCGCCAGGACTCAGTTCCTGAGG + Intronic
1062245277 9:135562902-135562924 GAGCCAGCCCTTGGGGCCTGGGG - Intronic
1062390201 9:136330818-136330840 CAGCCACCACGGAGGGTCTGAGG + Intronic
1062439196 9:136562058-136562080 AAGCCAGAACTGAGGGCATGCGG - Intergenic
1062528059 9:136986141-136986163 GAGCCAGGAGTCAGGGGCTGGGG - Intronic
1062642125 9:137524379-137524401 CAGCCAGCACTCAGGAGCCAAGG - Intronic
1185464156 X:345448-345470 CACCCTTCTCTCAGGGCCTGCGG - Intronic
1185587616 X:1252218-1252240 GAGCCACCACTCCCGGCCTGGGG + Intergenic
1186026344 X:5317686-5317708 CAGCCATTCCCCAGGGCCTGTGG + Intergenic
1186329656 X:8518580-8518602 CAGCTGGCACTCAGGGCCATGGG - Intergenic
1187670128 X:21658518-21658540 CGGCCAGCAGTCAGGGCACGGGG - Intergenic
1189324183 X:40103075-40103097 CCCCCCGCACTCAGGGCCGGGGG - Intronic
1190108767 X:47576304-47576326 CAGCCCGAACTCAGGGTGTGAGG - Intronic
1190110096 X:47583707-47583729 CAGCCAGCATGCAGATCCTGTGG - Intronic
1192252871 X:69427886-69427908 CAGCCAGTACAAAGGGCCTGTGG + Intergenic
1192370057 X:70505728-70505750 AAGCCAGCACTAAAGGCCAGTGG + Intergenic
1193441089 X:81539681-81539703 CTGCCACCACTCCAGGCCTGTGG - Intergenic
1194121723 X:89971375-89971397 CAGCCTGACCTCAGGCCCTGGGG + Intergenic
1194779875 X:98011162-98011184 GGGCCAGCATTCAGGGTCTGTGG - Intergenic
1196678736 X:118448529-118448551 CTGCCAGCACTCCAGTCCTGGGG + Intronic
1197252088 X:124227122-124227144 CACCAAGCACCCAGGCCCTGGGG + Intronic
1199441051 X:147867754-147867776 CTGGAACCACTCAGGGCCTGGGG + Intergenic
1199755676 X:150862712-150862734 CAGCCACCATCCTGGGCCTGGGG + Intronic
1199819778 X:151433051-151433073 CAGGCAGCAATCAAGGGCTGTGG - Intergenic
1200120135 X:153786286-153786308 CAGCCAGCCTTCAGTCCCTGGGG + Intronic
1200474579 Y:3628826-3628848 CAGCCTGACCTCAGGCCCTGGGG + Intergenic
1200827127 Y:7657448-7657470 CAGCCAGGAGGCAGGGCATGGGG + Intergenic
1200829848 Y:7679338-7679360 CAGCCAGGATTCAGGACATGGGG + Intergenic
1200988330 Y:9326237-9326259 CAGCCAGGATTCAGGGCATGGGG + Intergenic
1201059987 Y:10036677-10036699 CAGCCAGGATTCAGGGCATGAGG + Intergenic
1202109593 Y:21406151-21406173 CAGCCAGGATTCAGGACATGGGG + Intergenic
1202119687 Y:21509955-21509977 CAGCCAGGATTCAGGGCATGGGG - Intergenic
1202122140 Y:21533496-21533518 CAGCCAGGATTCAGGGCATGGGG - Intronic
1202156867 Y:21895887-21895909 CAGCCAGGATTCAGGGCATGGGG + Intronic
1202159313 Y:21919428-21919450 CAGCCAGGATTCAGGGCATGGGG + Intergenic
1202185762 Y:22184343-22184365 CAGCCAGGATTCAGGGCATGGGG + Intergenic
1202197081 Y:22307439-22307461 CAGCCAGGATTCAGGGTATGGGG - Intergenic
1202205598 Y:22402053-22402075 CAGCCAGGATTCAGGGCATGGGG - Intronic