ID: 969537326

View in Genome Browser
Species Human (GRCh38)
Location 4:7764654-7764676
Sequence CCATCTGCAGCCAGCACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 2, 2: 11, 3: 60, 4: 295}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969537326_969537334 22 Left 969537326 4:7764654-7764676 CCCTGAGTGCTGGCTGCAGATGG 0: 1
1: 2
2: 11
3: 60
4: 295
Right 969537334 4:7764699-7764721 ACTGTGAAAGCAGGGACAGTGGG 0: 1
1: 0
2: 0
3: 27
4: 253
969537326_969537331 14 Left 969537326 4:7764654-7764676 CCCTGAGTGCTGGCTGCAGATGG 0: 1
1: 2
2: 11
3: 60
4: 295
Right 969537331 4:7764691-7764713 GTGCCAGCACTGTGAAAGCAGGG No data
969537326_969537336 29 Left 969537326 4:7764654-7764676 CCCTGAGTGCTGGCTGCAGATGG 0: 1
1: 2
2: 11
3: 60
4: 295
Right 969537336 4:7764706-7764728 AAGCAGGGACAGTGGGCACTGGG No data
969537326_969537335 28 Left 969537326 4:7764654-7764676 CCCTGAGTGCTGGCTGCAGATGG 0: 1
1: 2
2: 11
3: 60
4: 295
Right 969537335 4:7764705-7764727 AAAGCAGGGACAGTGGGCACTGG 0: 1
1: 0
2: 1
3: 27
4: 366
969537326_969537330 13 Left 969537326 4:7764654-7764676 CCCTGAGTGCTGGCTGCAGATGG 0: 1
1: 2
2: 11
3: 60
4: 295
Right 969537330 4:7764690-7764712 AGTGCCAGCACTGTGAAAGCAGG 0: 1
1: 0
2: 3
3: 28
4: 287
969537326_969537333 21 Left 969537326 4:7764654-7764676 CCCTGAGTGCTGGCTGCAGATGG 0: 1
1: 2
2: 11
3: 60
4: 295
Right 969537333 4:7764698-7764720 CACTGTGAAAGCAGGGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969537326 Original CRISPR CCATCTGCAGCCAGCACTCA GGG (reversed) Intronic
900927264 1:5713440-5713462 GCAGCTGCAGCCAGGACTCAAGG - Intergenic
902885459 1:19401611-19401633 CCATCTGCAGGAAGCACCCTAGG - Intronic
903004715 1:20291004-20291026 CCTTCTGCACCCAGCACTGCTGG - Exonic
903772301 1:25771602-25771624 CCATCTGCCGCCGGCTCTCACGG - Intronic
903789751 1:25884788-25884810 TCATCAGCATCCAGCACACATGG + Intronic
904833420 1:33320149-33320171 CCAGCTGCAGCCAGCCCTCCAGG - Intronic
904944829 1:34191543-34191565 CCATCTGCAGACTGACCTCATGG - Intronic
905246999 1:36621997-36622019 CCAAGTGCAGCCAACTCTCAAGG + Intergenic
905380893 1:37560941-37560963 CCATTTGACACCAGCACTCAAGG - Intronic
906263587 1:44411592-44411614 CCACCTGCATCCACCACTCATGG - Intronic
908939006 1:69409901-69409923 CCCTCTGCAGCCAGCACACCTGG + Intergenic
909051441 1:70773441-70773463 CAATCTACAGCCAGCACTCAAGG - Intergenic
910395879 1:86793373-86793395 CCTTCTGCTGCCAGCATTCAGGG + Intergenic
911218354 1:95220017-95220039 CCATGTGAAGCCTGTACTCAAGG + Intronic
913321886 1:117594432-117594454 GCATCTTCTGTCAGCACTCAGGG + Intergenic
913410262 1:118542992-118543014 CAATCTACAGCCAGCATTCAAGG + Intergenic
915021961 1:152787580-152787602 ACTGCTGCAGCCAGCCCTCAGGG + Exonic
915591785 1:156875007-156875029 CCCTCTGCAGCCCCGACTCACGG - Exonic
915936085 1:160091145-160091167 CCATCTGCAGCCTGAACTGTCGG - Intergenic
916445999 1:164872267-164872289 CCATGTGCGGACAGCATTCATGG + Intronic
917020459 1:170581114-170581136 CCATTAGCAGCCAACACTAAGGG - Intergenic
917173220 1:172201301-172201323 TGATCTACAGCCAGCACTCAAGG - Intronic
917259005 1:173147611-173147633 CAATCTATAGCCAGCACTCAAGG - Intergenic
918534558 1:185559866-185559888 GCAGCTGCTGCCAGCAGTCATGG - Intergenic
918708334 1:187696358-187696380 GCGTCTACAGCCAGCACACAGGG + Intergenic
919795550 1:201319465-201319487 CCAGCTGCACCCACCACTCTGGG - Intronic
920084608 1:203406175-203406197 ACATCTGCAGACACCAGTCAGGG + Intergenic
920438431 1:205962978-205963000 CCAACTGCAGCCAGCTCTCAAGG + Intergenic
922161471 1:223081647-223081669 CCAGCCGCAGCCAGCACACCGGG + Intergenic
924019256 1:239763803-239763825 CCATGTCCAGCCAGCCCCCAAGG - Intronic
924850540 1:247824965-247824987 CCATCTGAAGCCTAGACTCAAGG - Intergenic
924897870 1:248361958-248361980 ACATCTGCATCCCACACTCAGGG - Exonic
924908994 1:248488882-248488904 ACATCTGCATCCCACACTCAGGG - Exonic
924915111 1:248559176-248559198 ACATCTGCATCCCACACTCAGGG + Exonic
924919428 1:248612114-248612136 AGATCTACAGCCAGCACTAAAGG + Intergenic
1064018619 10:11791820-11791842 TCATTTACAGCCTGCACTCAGGG - Intergenic
1065407712 10:25388471-25388493 AAATGTGCAGCCAGGACTCATGG + Intronic
1065506852 10:26438224-26438246 CCGCCTGCAGCCCGCCCTCAGGG - Exonic
1067211728 10:44265175-44265197 CCATCTGCACCCAGATCTAAGGG - Intergenic
1067213814 10:44283837-44283859 CCATCTGCAGCCATCTCTGTTGG - Intergenic
1067236752 10:44457654-44457676 CCGTATGCAGCCAACACTTAGGG - Intergenic
1067768493 10:49107516-49107538 CCCTTTGCAGCCACCACCCAGGG - Intronic
1067952550 10:50756657-50756679 CCTTCTGCACCTAGCACTCTTGG + Intronic
1068698141 10:59991230-59991252 CCTTATGCTGCCAGCACTGAAGG + Intergenic
1071038876 10:81282465-81282487 CCATTAGCAGCCAACACTAATGG - Intergenic
1072210079 10:93238491-93238513 CCCAGTGCAGCCAGCTCTCAAGG + Intergenic
1072806868 10:98429383-98429405 CCAGCTCCAGCCTGAACTCAAGG - Intronic
1073381339 10:103080153-103080175 CCATCAGTATCCAGAACTCAGGG - Exonic
1073783845 10:106866567-106866589 CGATCTGCAGCCAGAACTCAAGG + Intronic
1073875968 10:107921305-107921327 TGATCTACCGCCAGCACTCAAGG + Intergenic
1075143290 10:119860980-119861002 CCATCTACAGCAGGCACTTATGG + Intronic
1075490182 10:122859964-122859986 CCATCAGCTGCCAACACTCCCGG + Intronic
1075497777 10:122941850-122941872 CCACCCTCAGCCAACACTCATGG - Intronic
1075898857 10:126021803-126021825 CCAGCAGCAGCTAACACTCATGG - Intronic
1075986847 10:126795551-126795573 CCATATGCAGCCCACACTTAAGG - Intergenic
1077107731 11:849333-849355 CCACCCGCCGCCGGCACTCAGGG + Intronic
1080639126 11:34148643-34148665 CCTTCTGGTGACAGCACTCATGG - Intergenic
1083156908 11:60828887-60828909 CCAGCCACAGCCTGCACTCAAGG + Intergenic
1083431527 11:62615832-62615854 CCAGCTGCAGCCAGGCCTCTGGG + Intronic
1083573980 11:63776039-63776061 CCAGCAGCAGCCAGCATCCAAGG - Intergenic
1084483700 11:69436172-69436194 CCATGGGCAGCCAGAACTCCTGG - Intergenic
1084608541 11:70186509-70186531 CCAGCTGCAGCCAGCAGCCAGGG + Intronic
1086569064 11:88262509-88262531 CGATCTATAGCCAGCACTCAAGG - Intergenic
1087399781 11:97651276-97651298 TGATCTACAGGCAGCACTCAAGG - Intergenic
1088070444 11:105777837-105777859 CCCACTACAGCTAGCACTCAGGG + Intronic
1088471077 11:110187875-110187897 CCAGCTGCAGCCAACACAGATGG - Intronic
1090267222 11:125360706-125360728 ACAACAGCAGCCAGCTCTCAGGG + Intronic
1092544027 12:9437596-9437618 CCTTCTCCAACCAGCACTCAAGG + Intergenic
1092889412 12:12954770-12954792 CCATCTGCAGCTAGGCCTTAAGG + Intergenic
1094443597 12:30506209-30506231 CCCTCAGCAGCCAGCTCTCTGGG - Intergenic
1094508919 12:31084453-31084475 CCTTCCCCGGCCAGCACTCAAGG - Intronic
1095942534 12:47736396-47736418 CCTCCTGCTGCCAGGACTCAGGG + Intronic
1096210581 12:49762553-49762575 CCATCTGCAGCCTTCACTGTTGG + Intronic
1097500360 12:60393245-60393267 CCAACTGCAGCCAGCATACCTGG + Intergenic
1097874768 12:64632740-64632762 CCAGCTGCAGCCAGAATTAAGGG + Intronic
1098184722 12:67883966-67883988 CCTTCCGTAGCCAGCTCTCATGG - Intergenic
1098939198 12:76515590-76515612 CAATCTACAACCAGCACTCAAGG - Intronic
1102530352 12:113541734-113541756 ATATTTGCAGCCAGCACTCCTGG - Intergenic
1102762243 12:115398241-115398263 TAAGCTGGAGCCAGCACTCATGG - Intergenic
1103479398 12:121241408-121241430 CCTCCTGCAGCCAGCCCTGAGGG + Intronic
1104661903 12:130617204-130617226 CCACCTCCATCCAGCACACAAGG + Intronic
1105241844 13:18615204-18615226 CCATCTCCATCCAGGACTGAGGG + Intergenic
1105542874 13:21329855-21329877 CAAGCTGCATCCAGCACTGAAGG + Intergenic
1106234510 13:27850808-27850830 CCACCTGCCACCAGCACACATGG - Intergenic
1107571941 13:41670987-41671009 ACGTCTGCAGCGATCACTCATGG - Exonic
1107841275 13:44459814-44459836 CCCGCTGCAGCCAGCACACCTGG + Intronic
1109318638 13:60782298-60782320 CGATCTACAGCCAACACTTAAGG - Intergenic
1110034958 13:70672209-70672231 CAATCTACAGCCAGCACTCAAGG - Intergenic
1111187276 13:84755007-84755029 CCATCTGCAAACACCACTTAGGG + Intergenic
1112110906 13:96297570-96297592 CCATTTGCAGGGACCACTCAGGG - Intronic
1112227033 13:97550025-97550047 CCATCTGCAGCCAGGAAGAAAGG + Intergenic
1112701284 13:102011915-102011937 CCATCTTCAGCGATCACTCATGG + Intronic
1113537268 13:111077739-111077761 CCATCTGCAGCCAACACTTCCGG + Intergenic
1115542894 14:34439296-34439318 TCATTAGCAGCCAACACTCACGG + Intronic
1116283824 14:42946124-42946146 AGATCTGTGGCCAGCACTCAAGG + Intergenic
1117729693 14:58710062-58710084 CCATCTTCAGCAAGAAGTCAAGG - Intergenic
1117980756 14:61340109-61340131 GCATCTGCAGACAGCTGTCAGGG - Intronic
1117994919 14:61469470-61469492 CCATCTGCAGCCCACACCCGAGG - Intronic
1118221621 14:63859850-63859872 CTATGTGCAGCCTGCACTAAAGG + Intronic
1118848604 14:69567612-69567634 CCATCTGCAGGCAGACCTGATGG - Intergenic
1119727173 14:76928607-76928629 CAACCTGCAGCCAACACACAAGG + Intergenic
1121034499 14:90689282-90689304 CCATTTGCAGCCATCACTATTGG - Intronic
1121041863 14:90756244-90756266 CCAACTGCGGGCAGCACTCTGGG + Intronic
1121450110 14:94001551-94001573 CCCTCTGCATCCAGGACACATGG - Intergenic
1121573526 14:94965202-94965224 CCATCTGCAGCCAGCAGGGAAGG + Intergenic
1121611782 14:95285906-95285928 CCTTCTGCACTCAGCACTCCAGG + Intronic
1121706120 14:95995233-95995255 CCATGAGCAGGCAGCACTCCTGG + Intergenic
1122153859 14:99738763-99738785 CCACCTGCTGCCAGCACGCAGGG - Intronic
1123489526 15:20770014-20770036 CCTTCTCCATCCAGGACTCAGGG - Intergenic
1123546025 15:21339101-21339123 CCTTCTCCATCCAGGACTCAGGG - Intergenic
1124070739 15:26390953-26390975 CCAACCGCAGCCAGCAGTCCAGG + Intergenic
1124329583 15:28798362-28798384 CCATCTGCATACAGCTCTTAAGG - Intergenic
1124399390 15:29335065-29335087 CCATCTCCAGCCATCAGTGAGGG + Intronic
1124651345 15:31476522-31476544 CCTGCTCCTGCCAGCACTCAGGG - Exonic
1125206157 15:37155514-37155536 CCATCAGCAGGCAACACTCCTGG - Intergenic
1126448795 15:48782177-48782199 CCAGCTGCAGCAAGCACAGAAGG - Exonic
1128851543 15:70962809-70962831 CCATGTACAGCCCACACTCAGGG - Intronic
1129321168 15:74775809-74775831 CCTGAGGCAGCCAGCACTCAGGG - Intergenic
1129885252 15:79032640-79032662 CCATCGGCCACCAGCACTCCTGG - Intronic
1130384155 15:83396667-83396689 GCAGCTGCAGCCAGCACCCATGG + Intergenic
1130619982 15:85452805-85452827 TGAACTACAGCCAGCACTCAAGG - Intronic
1130907492 15:88251000-88251022 CCATCTGCACCCTGGGCTCAGGG - Intronic
1131568203 15:93505743-93505765 CCTGCTGCAGCCAGCACGCATGG - Intergenic
1132156030 15:99495703-99495725 CCAACAGCAGCCAGAACTGAGGG - Intergenic
1132294168 15:100723164-100723186 CATGCTGCAGCCAGCACCCATGG - Intergenic
1132409901 15:101568898-101568920 CCATCTGCAGCCAGCAGGCTGGG + Intergenic
1202954368 15_KI270727v1_random:66373-66395 CCTTCTCCATCCAGGACTCAGGG - Intergenic
1132504812 16:302477-302499 CCATCTGCAGCGACCACACCTGG + Intronic
1133320438 16:4910259-4910281 CCTACTGCTGCCAGCACTCAGGG - Intronic
1135761647 16:25142939-25142961 CCAACTGCAGCCAACTCACAAGG - Intronic
1135963998 16:27021010-27021032 CCTTCTGCAGCCCCCACCCAAGG - Intergenic
1138059823 16:53878409-53878431 CCTTATGCACCCAGCACTCTGGG + Intronic
1138163415 16:54777245-54777267 CCATCTTCCCCCAGCACTGATGG - Intergenic
1139741180 16:69036514-69036536 CCATCTGCAGTCAGCCATCCAGG - Intronic
1141262063 16:82463146-82463168 CCATCTGCAGAAAGAAGTCATGG - Intergenic
1141394074 16:83689737-83689759 ACATGTGCAGCCTACACTCAGGG - Intronic
1141730943 16:85822458-85822480 CTATCTGCAGCCAGCACAATGGG - Intergenic
1148444325 17:47728293-47728315 CCATCCTCAGCCTCCACTCAGGG - Intergenic
1150074191 17:62178808-62178830 CCATCAGCTGCCAACACTCCCGG + Intergenic
1151393357 17:73802695-73802717 CCATCTCCAGCAGGCACCCATGG + Intergenic
1151890605 17:76948709-76948731 CCTTCTGCAGGTAGCACTCCTGG - Exonic
1151904072 17:77036241-77036263 CCACCTTCAGCCCACACTCAGGG - Intergenic
1152530584 17:80916412-80916434 CCCCCTGCAGCCAGCATGCATGG + Intronic
1152553047 17:81039355-81039377 CCACCTGGAGCCAGCAGGCATGG - Intronic
1154181280 18:12142086-12142108 CAATCTACAGCCAGCACTCAAGG - Intergenic
1154182624 18:12149498-12149520 CAATCTACAGCCAGCACTCAAGG + Intergenic
1154447107 18:14444674-14444696 CCATCTCCATCCAGGACTGAGGG - Intergenic
1154998706 18:21665911-21665933 TCATTGGCAGACAGCACTCAAGG - Intronic
1155345932 18:24856645-24856667 CTCTCTACAGCAAGCACTCAAGG - Intergenic
1155761512 18:29574599-29574621 CCATCCACAGCCAACACTCCTGG - Intergenic
1159845648 18:73456529-73456551 CCATGTGCAGCCCACACTTAAGG - Intergenic
1160811397 19:1014511-1014533 CCAGCTGCAGCCGACACCCAAGG + Intronic
1161049621 19:2156227-2156249 CCATCTCCTGCCAGAGCTCAGGG - Intronic
1162469926 19:10866712-10866734 CCATCTGCAGCCTCCACTTCTGG + Intronic
1162736094 19:12747954-12747976 CCATCTGCAGCCAGGGCAGAGGG - Exonic
1163268666 19:16236100-16236122 ATATCAGCAGCCAGCCCTCATGG + Intronic
1163368402 19:16888885-16888907 CCAGCTGCAGCCAGCACCCCCGG - Exonic
1163771541 19:19194025-19194047 CCATCTGCAGCCTCCTCTCCGGG - Exonic
1165050651 19:33139366-33139388 CCTTCTGCAGCCTGGCCTCATGG - Intronic
1165161831 19:33820863-33820885 CCTTCTGCAGCCCGCTCTCCAGG - Intergenic
1166091083 19:40509583-40509605 CCAACTGCCGTCAGCACTCAGGG - Intronic
1166663533 19:44663017-44663039 GCATCTGCAGCCAGCAAGCTGGG + Exonic
924981089 2:222356-222378 CCCTGTGCAGCCAGCACCCCTGG + Intronic
925346329 2:3174683-3174705 CCCTCTGTAACCAGGACTCATGG - Intergenic
925383548 2:3445899-3445921 CCATCTCCAGGCATCAGTCAGGG - Intronic
925503922 2:4539370-4539392 GCCTCTGCAGCCAGCACTCCAGG + Intergenic
925965991 2:9066721-9066743 CCATCTGCAGGGGACACTCAGGG + Intergenic
926253327 2:11168747-11168769 GCATCTGCACCCAGCTCTCAGGG + Intronic
926689813 2:15725481-15725503 CAATGTGCACCCAGCATTCAGGG + Intronic
926923721 2:17965454-17965476 CCCTCTGCAGTCAGCTCTCCTGG - Intronic
927504321 2:23603310-23603332 CCACCTCCAACCAGCAGTCAAGG + Intronic
928462088 2:31484763-31484785 CAATCTACAGCCAGCACTCAAGG - Intergenic
929593340 2:43160815-43160837 CTATCTGCAGCCTGCACTAGGGG - Intergenic
929966515 2:46541511-46541533 CCAGCTGCTCCCAGTACTCAAGG - Intronic
930839235 2:55826548-55826570 AGATCTGCAGCCAGCACTTGAGG + Intergenic
931268214 2:60679246-60679268 CCAACTGCAGTCAGCACTGGGGG - Intergenic
931543461 2:63354434-63354456 TGATCTACAGCCAGCACTCAAGG + Intronic
933484264 2:82897547-82897569 ACACTTGCAGCCAGCACTCAAGG + Intergenic
933800935 2:85959892-85959914 CCATGTGCAGCCAGAACTTGGGG - Intergenic
934623150 2:95828651-95828673 TGATCTACAGCCAGCACTCAAGG - Intergenic
934810609 2:97273436-97273458 TGACCTACAGCCAGCACTCAAGG + Intergenic
934827083 2:97434503-97434525 TGACCTACAGCCAGCACTCAAGG - Intergenic
935106946 2:100053679-100053701 CCATATGCAGACAGCACAAAGGG + Intronic
935319152 2:101868691-101868713 CCTCCTGCCCCCAGCACTCAGGG + Intronic
935569293 2:104642131-104642153 CCTTCTGCAGCCAGCAGGAAAGG + Intergenic
936022266 2:109003817-109003839 ACATCGGCAGGCAGCTCTCAGGG + Intergenic
937034893 2:118772849-118772871 CCAGGTGCAGCCTGCACTGAAGG - Intergenic
937339277 2:121080674-121080696 CCACCAACAGCCAGCATTCATGG + Intergenic
937397270 2:121547644-121547666 CGATCTATAGCCAGTACTCAAGG + Intronic
937661348 2:124433139-124433161 CCAACAGCTGCCACCACTCATGG - Intronic
938386864 2:130872878-130872900 CCAGCTGCAGGCAGGGCTCAGGG - Intronic
939000841 2:136732162-136732184 CCAACTGCTGCCAGCTCTCATGG - Intergenic
939714883 2:145571354-145571376 CCAACAGCAGCCAACACTCCTGG + Intergenic
941536500 2:166728684-166728706 CCATATGCAGCAAGAACTCTAGG - Intergenic
943155673 2:184172018-184172040 CCATCAGCAGTCAGCACTTCTGG + Intergenic
943611835 2:190044125-190044147 TAATCTACAGTCAGCACTCAAGG - Intronic
944427905 2:199602987-199603009 CGATCTGCAGCCAGTACGAAGGG - Intergenic
946381717 2:219353311-219353333 CCCTCTGCAGACATCACTAATGG + Intergenic
947205248 2:227655050-227655072 GCCTCTGCATCCAGCACTCCAGG - Intergenic
948347189 2:237308435-237308457 CCACCAGCAGCCACCACTCCTGG + Intergenic
948423101 2:237872479-237872501 CCATCTGCAGCCGGGGCTCCTGG + Intronic
948873084 2:240813357-240813379 CCCTCTGCAAGCGGCACTCAGGG - Intronic
1172037283 20:32019066-32019088 CCATCTGCAGCCTGGACTGGCGG + Exonic
1174145083 20:48447772-48447794 CTGTCTGCAGCCAACACTCCTGG + Intergenic
1174561289 20:51432475-51432497 CTATCAGCAGCCGGCCCTCATGG - Exonic
1175491435 20:59383399-59383421 CTCTCAGGAGCCAGCACTCAGGG + Intergenic
1176976993 21:15334152-15334174 GGATCTACAGCCAGCACGCAAGG - Intergenic
1177355264 21:19998781-19998803 CCATCTCCTGCCAGGAGTCATGG + Intergenic
1179790567 21:43753827-43753849 ACAACTGGGGCCAGCACTCAGGG - Intronic
1179823498 21:43951115-43951137 TCCTGTGCAGCCAGCACACAAGG + Intronic
1180041193 21:45281095-45281117 TCATCTGCCCCCAGCACCCAGGG - Intronic
1180600098 22:17009848-17009870 CCCTCTGCAGGCTGCAGTCATGG + Intergenic
1180692216 22:17726892-17726914 CAATCTGCTGCCAGGACTCAGGG - Exonic
1180972474 22:19822645-19822667 CCACCTGCAGCCTGCACACAAGG + Intronic
1181580709 22:23826605-23826627 ACATCTGCAGTCATCACTCAGGG + Intronic
1182421254 22:30249520-30249542 CCACCTGGAGACAGCACTCCTGG - Intergenic
1182766072 22:32759651-32759673 CCACCCCCAGCCAGCACCCACGG + Intronic
1183041789 22:35185303-35185325 CAACCTACAGCCAGCACTCAAGG + Intergenic
1183588432 22:38766497-38766519 CCATGTGCACCCTGAACTCAGGG + Intronic
1184648950 22:45910895-45910917 CCAGCTGCAGCCAGCTCCGATGG + Intergenic
1184697441 22:46147906-46147928 TCACCTGCTCCCAGCACTCAGGG + Intergenic
1185208046 22:49551485-49551507 CCATGTGGATCCAGCTCTCAGGG + Intronic
950483831 3:13261184-13261206 CCCTCAGCAGCCAGCACTCCTGG - Intergenic
950532893 3:13563309-13563331 CCATCAGCAGCCAGCACCTGTGG - Intronic
950870426 3:16223645-16223667 CCAACTGAAGGCAGGACTCAAGG + Intronic
950882775 3:16336433-16336455 CCCTCTGCAGCCAGCACAGCTGG + Intronic
952556268 3:34534833-34534855 CCATTAGCAGCCAACACTCAGGG - Intergenic
953751976 3:45615982-45616004 GCATCTTCAGCCAGCCTTCAGGG + Intronic
955064476 3:55522731-55522753 CCATCTCCAGCTCCCACTCAGGG + Intronic
956355414 3:68386644-68386666 CCTTCTGGAGCCAGCATTCTTGG - Intronic
957306047 3:78460059-78460081 CCAACTGTTGCCAGCTCTCAAGG + Intergenic
957486789 3:80871729-80871751 CCTGCTGCAGCCAGCATGCAAGG + Intergenic
960161105 3:114351183-114351205 CCATCTGCTGCGAGCGCTCATGG + Exonic
960685340 3:120288746-120288768 TGAACTACAGCCAGCACTCAAGG + Intergenic
961675031 3:128559583-128559605 CCATGTGCAGCCCACACTGAGGG - Intergenic
961773568 3:129267918-129267940 ACACCTGCAGCCAGGACACAAGG - Exonic
962997633 3:140647378-140647400 CAATCTATAGCCATCACTCAAGG - Intergenic
963074507 3:141333597-141333619 CCCTCTGCAGCCAGCCCTGTTGG - Intronic
966341022 3:178924783-178924805 TGATCTACAGCCAGCACTCAAGG + Intergenic
966910929 3:184559631-184559653 CCAACCCCAGCCAGCACTCCGGG + Intronic
966943156 3:184759699-184759721 CCCTCAGCAGCCAGCACAGACGG + Intergenic
969228461 4:5814090-5814112 CCACATGAAGGCAGCACTCAGGG + Exonic
969537326 4:7764654-7764676 CCATCTGCAGCCAGCACTCAGGG - Intronic
969564172 4:7967875-7967897 ACACATGCAGCCAGCACCCACGG - Intronic
969593342 4:8134085-8134107 ACATCTGCACCAAGCACTGAAGG + Intronic
969832666 4:9810403-9810425 GCATCTCCAGCCAGGCCTCAGGG + Intronic
970678881 4:18484502-18484524 CAATTTACAGCCAGCACTTAAGG + Intergenic
971106088 4:23525209-23525231 TGATCTACTGCCAGCACTCAAGG + Intergenic
971605595 4:28653035-28653057 ACATCTGCAGCCAGTCCTTAGGG - Intergenic
971995458 4:33958112-33958134 TGAACTACAGCCAGCACTCAAGG - Intergenic
973563533 4:52161549-52161571 CCAGCTGCTGCCAGAAGTCAGGG + Intergenic
973574609 4:52274060-52274082 TGAACTACAGCCAGCACTCAAGG + Intergenic
975106106 4:70571132-70571154 TGATCTACAGCTAGCACTCAAGG - Intergenic
977005876 4:91569275-91569297 CAATCTACAGCCAGCACTCAAGG - Intronic
977979407 4:103305605-103305627 AGATCTACAGCCAGCACTGAAGG - Intergenic
978683661 4:111414397-111414419 CAATCTATAGCCAGCACTCAAGG - Intergenic
980124966 4:128765518-128765540 CCTTGTGCAGCCCACACTCAAGG - Intergenic
980884703 4:138749555-138749577 CCATGTCAAGCCTGCACTCAAGG + Intergenic
980980707 4:139652359-139652381 CCTTCTGCAGCAAGAAGTCAGGG - Intergenic
982965465 4:161901326-161901348 CCATCTACAGACAGCACACAGGG + Intronic
985039343 4:185873352-185873374 CTATTGGCAGCTAGCACTCAGGG - Intronic
985832247 5:2242389-2242411 CAGCTTGCAGCCAGCACTCAGGG + Intergenic
985909939 5:2871409-2871431 CCACCTACCTCCAGCACTCAGGG + Intergenic
985959397 5:3288497-3288519 CCGCCAGCAGCCAGGACTCAGGG + Intergenic
986273564 5:6254276-6254298 CCACATGCGGCCAGGACTCACGG + Intergenic
986305991 5:6517316-6517338 CAAGCTGCACCCAGGACTCAAGG - Intergenic
986758287 5:10857563-10857585 CTGTCTGCAGCCAACGCTCAGGG - Intergenic
987674769 5:21061501-21061523 TGATCTACAGCCAGCACTCAAGG - Intergenic
988404143 5:30802723-30802745 CCCTGTGCAGGCAGCATTCATGG - Intergenic
988425559 5:31059209-31059231 CCTTCTTCAGCCAGCACTTGTGG + Intergenic
989570812 5:42944415-42944437 CAATCTGCAGCCAGCAGTCTTGG - Intergenic
989577375 5:43000747-43000769 CCATCTGCAGCCAGCAGTCTTGG - Intergenic
989581162 5:43034387-43034409 CAATCTGCAGCCAGCAGTCTTGG - Intergenic
993351187 5:86852856-86852878 CTATCTACAGCCAGCACTGAAGG - Intergenic
994118312 5:96085724-96085746 CCATCAGCAGCTGTCACTCATGG + Intergenic
995428739 5:112050985-112051007 TGATCTACAGCCAGCACTCGAGG + Intergenic
995585455 5:113643687-113643709 CCATCCTCAGTCAGCACTGAAGG + Intergenic
997485542 5:134227206-134227228 CCATCTTCAGCCAGTACTGTTGG - Intergenic
999074593 5:148781940-148781962 CAATCTACAGCCAGAACTCAAGG + Intergenic
999227393 5:150037415-150037437 CTGTCAGCAGCCAGCACTCCTGG - Exonic
1003409134 6:5847932-5847954 CAAGCTGCATCCAGCACTGAAGG - Intergenic
1003749346 6:9039449-9039471 GGATCTGCACCTAGCACTCATGG - Intergenic
1004883127 6:20028163-20028185 CCATCTGCTGCCAGTCCTCCAGG + Intergenic
1006045961 6:31298680-31298702 CTACCTGCAGCCACCACTGATGG + Intronic
1006786627 6:36672137-36672159 CCATCGGCAACCAACACTCATGG - Intergenic
1006935276 6:37712914-37712936 CCAAGTGCAGGCAGCACTCCTGG - Intergenic
1007379263 6:41476585-41476607 CCATCTGCAGCAGGCCCCCATGG - Intergenic
1007607666 6:43128306-43128328 CCCTGTGCAGCCAGCCCTTAGGG + Intronic
1008586731 6:52957486-52957508 CCAGCTGCAGCCAGCAGCCAGGG + Intergenic
1009888945 6:69656843-69656865 CAGTCTACAGCCAGCACTCAAGG + Intergenic
1010864450 6:80957136-80957158 CAATCTGCAGCCACCAGTCCAGG + Intergenic
1011392412 6:86868203-86868225 TGATCTACAGCCAGCACTCAAGG + Intergenic
1013353072 6:109323337-109323359 GCATCTGCAGGCAGGAGTCAGGG - Intergenic
1014124472 6:117760314-117760336 TGATCTACAGCCAGCACTCAAGG + Intergenic
1015197349 6:130537712-130537734 TGGTCTACAGCCAGCACTCAAGG + Intergenic
1017345060 6:153370345-153370367 TGATCTAAAGCCAGCACTCAAGG + Intergenic
1017535910 6:155348361-155348383 TGATCTACAGCCAGCACTCAAGG - Intergenic
1018490453 6:164287394-164287416 CAAACTGCAGCAAGCAGTCACGG - Intergenic
1018824255 6:167397439-167397461 CCATCTCCTGTGAGCACTCAGGG + Intergenic
1019433235 7:1009311-1009333 CTAGGTGCAGTCAGCACTCAGGG + Intronic
1020242824 7:6409003-6409025 CCATCTGTAGCCAGAACCCCAGG + Intergenic
1021342866 7:19486908-19486930 CCAACAGCAGCCAACAATCAAGG - Intergenic
1022017316 7:26362446-26362468 CCATCTGGAGCCAGAAATGATGG + Intronic
1022113186 7:27243659-27243681 CCCTCAGCACCCCGCACTCAAGG - Intronic
1024321364 7:48074585-48074607 TCATCTGGAGCCATGACTCATGG + Intergenic
1024673195 7:51615357-51615379 TCTTTTGCAGCCACCACTCATGG + Intergenic
1025015316 7:55434755-55434777 CCTTCTGCATCGAGCACCCAGGG - Intergenic
1025943806 7:66091643-66091665 CCCTCTGCAGCCTGGACTCAAGG - Intronic
1028176881 7:87670903-87670925 CAATCTACAGCCAGCATTCAAGG - Intronic
1029052256 7:97701058-97701080 TGATCTACACCCAGCACTCAAGG + Intergenic
1029941140 7:104481967-104481989 CCATTAGCAGGCAACACTCACGG - Intronic
1030200829 7:106901992-106902014 TGATCTACAGACAGCACTCAAGG - Intronic
1031704030 7:124959942-124959964 CCATCAGCAGCCAATACTCCTGG - Intergenic
1032089688 7:128905077-128905099 TCATCTCCAGCCAGCACTCCAGG + Intronic
1032389202 7:131544766-131544788 CCAGCTGCAGCTAGCACCTAAGG - Intronic
1034529997 7:151689676-151689698 CCGGCTGCAGCCAGCACCCCAGG - Intronic
1035218509 7:157390099-157390121 GTTTCCGCAGCCAGCACTCACGG - Intronic
1036116922 8:5969215-5969237 CCATCTGTCGCCAGCATTGAAGG - Intergenic
1037756677 8:21714765-21714787 CAACCTGCAGCCAGCACACCAGG + Intronic
1038758061 8:30360304-30360326 CCAGCAGCAGCCAGCACCTATGG + Intergenic
1039233442 8:35474680-35474702 CCCTCTCCATCCAGAACTCAGGG - Intronic
1041561873 8:59226972-59226994 TGATCTATAGCCAGCACTCAAGG + Intergenic
1041735897 8:61110070-61110092 CCATTAGCAGCCAACGCTCAGGG - Intronic
1042832808 8:73050234-73050256 CCCTCTGCAGCAACCACTCCTGG - Intergenic
1044382020 8:91545143-91545165 CCATGTCCAGCCCTCACTCAAGG - Intergenic
1046482589 8:114841621-114841643 ACCTTTGCAGCCAACACTCAAGG - Intergenic
1047318244 8:123754359-123754381 CCCGCTGCAGCCAGCACACCTGG - Intergenic
1047870917 8:129081136-129081158 CCACCAGCAGCTAGCACCCATGG + Intergenic
1048048988 8:130799542-130799564 TTGTCAGCAGCCAGCACTCATGG - Intronic
1049235560 8:141510654-141510676 CCATCAGCAGCCACCCCCCAGGG + Intergenic
1049688651 8:143949327-143949349 CCATCCGGAGCCAGCACGGAGGG + Intronic
1049763775 8:144343484-144343506 GCAGCTGCAGCCATCCCTCAAGG - Intergenic
1049775488 8:144401938-144401960 CCCTGTGCGGCAAGCACTCAGGG + Intronic
1052094546 9:24368977-24368999 CAATCTGCAGCCAGCATTCAAGG - Intergenic
1052626526 9:30982585-30982607 CAACGTACAGCCAGCACTCAAGG + Intergenic
1052703087 9:31960867-31960889 CAGTCTACAACCAGCACTCATGG + Intergenic
1054721091 9:68604704-68604726 CCATCTGCAGCCCACACTTAAGG - Intergenic
1055132792 9:72794332-72794354 TAATCTACAGCCAGCTCTCAAGG + Intronic
1055225092 9:73985470-73985492 TGATCTACAGCCAGCACTCAAGG + Intergenic
1056187561 9:84150690-84150712 CCCTCAGCAGCCAGTGCTCAAGG - Intergenic
1056765308 9:89441474-89441496 ACATCTCCAGCCAGAGCTCAGGG - Intronic
1056797471 9:89668687-89668709 CCAGCTGCAGCATGCACTCATGG - Intergenic
1058461599 9:105189047-105189069 TAATCTGCAGCCAGCACTCAAGG - Intergenic
1059684607 9:116623025-116623047 ACATCTCCAGCCAACACTGAAGG + Intronic
1059723033 9:116980093-116980115 CCATCTGCTGCTAGCACTCGGGG - Intronic
1062277585 9:135738030-135738052 CCTGCTACAGCCAGCCCTCAAGG + Intronic
1062288070 9:135782271-135782293 CCTTCTGGAGCCAGCCCTCAAGG - Intronic
1062511358 9:136907923-136907945 CCCTCTGCAGATAGCTCTCAGGG - Intronic
1062694537 9:137866683-137866705 CCATCTGCAGCCTGTGCTGAGGG - Intronic
1186713166 X:12221782-12221804 GCATCTCCACCCAGCATTCAGGG - Intronic
1186792743 X:13014936-13014958 TCATTTGCACCCAGCATTCAGGG + Intergenic
1188691901 X:33139566-33139588 CCATCTGAAGACAGCACCAATGG - Intronic
1189517552 X:41730577-41730599 CCATTTACAGCTAGCATTCAGGG - Intronic
1190221443 X:48514863-48514885 CTATCTCCTGCCAGCACTCCTGG - Intronic
1190323637 X:49193244-49193266 CCTCCTCCAGCCAGCACCCAGGG + Intronic
1190708624 X:53049781-53049803 CCTTCCACAGCCAGCACACAAGG - Intronic
1191094557 X:56660890-56660912 CAATCTACAGTCATCACTCACGG - Intergenic
1192254263 X:69442651-69442673 TGAACTACAGCCAGCACTCAAGG - Intergenic
1192696369 X:73420267-73420289 CCATCTACAGCCAGCACTCAAGG + Intergenic
1192696554 X:73422279-73422301 TGATCTATAGCCAGCACTCAAGG - Intergenic
1192734569 X:73837090-73837112 CTATGTGCAGCCAGCACTTAAGG - Intergenic
1193482738 X:82047096-82047118 CAATCTGCAGCCAGCACTCATGG + Intergenic
1193790882 X:85813950-85813972 CCATCTTCAGCTTGCACTCCTGG + Intergenic
1196241276 X:113345901-113345923 CGACCTACACCCAGCACTCAAGG - Intergenic
1197373218 X:125649816-125649838 CTGACAGCAGCCAGCACTCAGGG + Intergenic
1199249106 X:145638618-145638640 TGATCTACAGCCAGCACTCAAGG + Intergenic
1199306938 X:146278652-146278674 CAATCTACAGCTAGCACTAAAGG - Intergenic
1200151533 X:153953743-153953765 CCACCTGCTGCCAGCGATCAGGG - Exonic
1200152862 X:153959801-153959823 CCCACCGCAGCCAGGACTCAAGG - Exonic