ID: 969537328

View in Genome Browser
Species Human (GRCh38)
Location 4:7764655-7764677
Sequence GCCATCTGCAGCCAGCACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 266}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969537328_969537335 27 Left 969537328 4:7764655-7764677 CCTGAGTGCTGGCTGCAGATGGC 0: 1
1: 0
2: 3
3: 24
4: 266
Right 969537335 4:7764705-7764727 AAAGCAGGGACAGTGGGCACTGG 0: 1
1: 0
2: 1
3: 27
4: 366
969537328_969537334 21 Left 969537328 4:7764655-7764677 CCTGAGTGCTGGCTGCAGATGGC 0: 1
1: 0
2: 3
3: 24
4: 266
Right 969537334 4:7764699-7764721 ACTGTGAAAGCAGGGACAGTGGG 0: 1
1: 0
2: 0
3: 27
4: 253
969537328_969537336 28 Left 969537328 4:7764655-7764677 CCTGAGTGCTGGCTGCAGATGGC 0: 1
1: 0
2: 3
3: 24
4: 266
Right 969537336 4:7764706-7764728 AAGCAGGGACAGTGGGCACTGGG No data
969537328_969537333 20 Left 969537328 4:7764655-7764677 CCTGAGTGCTGGCTGCAGATGGC 0: 1
1: 0
2: 3
3: 24
4: 266
Right 969537333 4:7764698-7764720 CACTGTGAAAGCAGGGACAGTGG No data
969537328_969537330 12 Left 969537328 4:7764655-7764677 CCTGAGTGCTGGCTGCAGATGGC 0: 1
1: 0
2: 3
3: 24
4: 266
Right 969537330 4:7764690-7764712 AGTGCCAGCACTGTGAAAGCAGG 0: 1
1: 0
2: 3
3: 28
4: 287
969537328_969537331 13 Left 969537328 4:7764655-7764677 CCTGAGTGCTGGCTGCAGATGGC 0: 1
1: 0
2: 3
3: 24
4: 266
Right 969537331 4:7764691-7764713 GTGCCAGCACTGTGAAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969537328 Original CRISPR GCCATCTGCAGCCAGCACTC AGG (reversed) Intronic
900529101 1:3144122-3144144 GCCACCTGGACCCAGCACTATGG + Intronic
900985317 1:6069760-6069782 GCCATCCGCTGCCAGGCCTCGGG - Intronic
902780768 1:18703345-18703367 GACATCTGCAGACAGCACGTGGG + Intronic
904246616 1:29192610-29192632 GCCCTCTGTACCCTGCACTCAGG - Intergenic
904615444 1:31746935-31746957 CTGCTCTGCAGCCAGCACTCTGG + Intronic
906325011 1:44840057-44840079 GCCATATGAAACCAGCCCTCAGG + Intronic
907417569 1:54324985-54325007 GCCTGCAGCAGCCAGCACTGGGG + Intronic
908143335 1:61210822-61210844 TCCATCTACAGGCAACACTCAGG + Intronic
910395877 1:86793372-86793394 CCCTTCTGCTGCCAGCATTCAGG + Intergenic
911404586 1:97420675-97420697 CCCATCTGTATTCAGCACTCAGG + Intronic
912415597 1:109506547-109506569 GCCTTCAGCAGCCCCCACTCTGG + Exonic
915021960 1:152787579-152787601 GACTGCTGCAGCCAGCCCTCAGG + Exonic
915022924 1:152798062-152798084 GACTGCTGCAGCCAGCCCTCGGG + Exonic
915023575 1:152805177-152805199 GGCTGCTGCAGCCAGCCCTCGGG - Exonic
915024290 1:152812726-152812748 GGCTGCTGCAGCCAGCCCTCCGG + Exonic
915025725 1:152827728-152827750 GGCTGCTGCAGCCAGCCCTCGGG + Exonic
915934446 1:160082526-160082548 GTCCTCTGCAGTCAGCACTCTGG - Intronic
917020461 1:170581115-170581137 GCCATTAGCAGCCAACACTAAGG - Intergenic
918227083 1:182493770-182493792 GCCATCAGCAGCCAACACTCAGG + Intronic
918708333 1:187696357-187696379 GGCGTCTACAGCCAGCACACAGG + Intergenic
919795552 1:201319466-201319488 GCCAGCTGCACCCACCACTCTGG - Intronic
920556600 1:206909186-206909208 GCCAGCTGCATCCAGCACGCAGG + Intronic
920660163 1:207908694-207908716 TCCTGCTCCAGCCAGCACTCTGG + Intronic
921512551 1:216050224-216050246 GGCATTTGGAGCCAGCAATCTGG - Intronic
922161469 1:223081646-223081668 TCCAGCCGCAGCCAGCACACCGG + Intergenic
922234366 1:223712357-223712379 GCCATCTGCGGACAGCTCCCGGG - Exonic
923559141 1:235025253-235025275 GCCATCTGCAACCTGCTCTGAGG + Intergenic
1062954455 10:1530870-1530892 GCACTCAGCACCCAGCACTCAGG + Intronic
1062954459 10:1530919-1530941 GCACTCAGCACCCAGCACTCAGG + Intronic
1063141514 10:3260175-3260197 GCCCTCTGCAGTCTGCTCTCAGG - Intergenic
1064833144 10:19493992-19494014 GTAAACTGCAGCCAGCACTCAGG + Intronic
1065506854 10:26438225-26438247 GCCGCCTGCAGCCCGCCCTCAGG - Exonic
1066956652 10:42179242-42179264 GCCAGCTGCATGGAGCACTCTGG - Intergenic
1067030102 10:42874116-42874138 GCCATCTTGACCCATCACTCAGG + Intergenic
1067956856 10:50801112-50801134 GCCATATGAAGGCAGAACTCAGG + Exonic
1070140016 10:73732108-73732130 GCGGTCTGCGGCCAGCACACTGG - Intergenic
1072711577 10:97718890-97718912 GACATCTGCAGCCAGGAAACAGG + Intergenic
1075417644 10:122277062-122277084 TCCCTCTGGAGCCAGCTCTCAGG + Intronic
1075617701 10:123903558-123903580 GCCATCTCCAGCCAGTCCTTAGG + Intronic
1075705420 10:124497492-124497514 GCCATCTGTGGCCAGGCCTCCGG + Intronic
1077156100 11:1092450-1092472 GCCCTCTGCTGCCAGCCCTGCGG + Intergenic
1077164521 11:1129121-1129143 GCCCTCGGCAGCCAACACTCGGG + Intergenic
1077186076 11:1236019-1236041 GCCATCTGCAGGGAGCATCCCGG - Intronic
1077251769 11:1563912-1563934 GCTGTCTGCGGCCAGCACGCTGG + Exonic
1078414076 11:11150840-11150862 GCCAGCTGCAGCCAACTCTCTGG + Intergenic
1080843706 11:36007601-36007623 GTCCTCCTCAGCCAGCACTCTGG + Intronic
1081580074 11:44346039-44346061 GCCTGATTCAGCCAGCACTCTGG - Intergenic
1081623611 11:44633817-44633839 GCCCTCTGCAGGCAGCAAGCTGG - Intergenic
1082958956 11:58900973-58900995 GCCATCAGCTGGCAGCACGCGGG + Intronic
1082965621 11:58963840-58963862 GTCATCTGCTGGCCGCACTCGGG + Intronic
1083259266 11:61514413-61514435 GCCCTCTGCTCCCAGCACTTGGG - Intergenic
1083431525 11:62615831-62615853 CCCAGCTGCAGCCAGGCCTCTGG + Intronic
1084608539 11:70186508-70186530 CCCAGCTGCAGCCAGCAGCCAGG + Intronic
1084740679 11:71137586-71137608 GCTCCCTGCAGCCAGCACCCTGG - Intronic
1084964893 11:72739362-72739384 CCCATCAGCCACCAGCACTCCGG - Intronic
1085442841 11:76579255-76579277 GCGGTCTGCTGCCAGGACTCTGG + Intergenic
1085529841 11:77184694-77184716 GCATCCTGCGGCCAGCACTCCGG + Exonic
1087304454 11:96472554-96472576 CCCACCTGCAGCCACCACTTTGG + Intronic
1089014981 11:115158181-115158203 GCCATCTGCAACCCTCATTCTGG + Intergenic
1089375278 11:117989546-117989568 GCCGTCCACAGCCCGCACTCTGG - Exonic
1090304699 11:125681254-125681276 GCCAAATCCAGCCAGCATTCAGG - Intergenic
1090512037 11:127385645-127385667 GGCATTTGGAGCCAGAACTCAGG + Intergenic
1091605415 12:1947538-1947560 GCCATGTTCAGCCACTACTCTGG + Intronic
1094443599 12:30506210-30506232 ACCCTCAGCAGCCAGCTCTCTGG - Intergenic
1095942532 12:47736395-47736417 GCCTCCTGCTGCCAGGACTCAGG + Intronic
1096048194 12:48582822-48582844 GCTATCTGCTGATAGCACTCAGG + Intergenic
1097341139 12:58439508-58439530 GCTAGCTGCTGCCATCACTCTGG - Intergenic
1100476668 12:94941487-94941509 GCCAAGAGCAGCCAGCAATCGGG + Intronic
1101989987 12:109476940-109476962 CCCATCTCCAACCAGCACTCAGG + Intronic
1102895786 12:116597369-116597391 GCCACCAGCACCCAGCACTTTGG + Intergenic
1103088358 12:118079567-118079589 GCCATCTGTGCCCAGCACTGGGG + Exonic
1103484691 12:121274536-121274558 GCCAGCTTCATCCAGCACACTGG + Exonic
1103696554 12:122820429-122820451 ACCATCTCAAGCCAGCAATCAGG - Intronic
1104024297 12:125014719-125014741 GGCATCTCCAGGCTGCACTCTGG + Intronic
1104769741 12:131353942-131353964 GCCACCTGCAGCAACCACTCGGG + Intergenic
1104769750 12:131353982-131354004 GCCACCTGCTGCAACCACTCGGG + Intergenic
1113220019 13:108089447-108089469 GGCTTCTGGAGTCAGCACTCAGG - Intergenic
1114951583 14:27761371-27761393 AAGATCTGCAGCGAGCACTCAGG - Intergenic
1115438355 14:33402773-33402795 GGCCTCTACAGCCAGCACTTAGG - Intronic
1116511390 14:45751209-45751231 GCCATATGCAGCAAACAATCTGG - Intergenic
1117980757 14:61340110-61340132 GGCATCTGCAGACAGCTGTCAGG - Intronic
1118824427 14:69367438-69367460 GCCATCTGCAACCTGCAACCTGG + Intergenic
1119348107 14:73942858-73942880 GCCATCTGCAGGCATCTCACAGG - Intronic
1119438178 14:74611540-74611562 GCCAGCAGCAACCAGCACCCCGG - Exonic
1120857284 14:89223415-89223437 GCCATCAGCAACCTGCACCCTGG - Intronic
1121041861 14:90756243-90756265 ACCAACTGCGGGCAGCACTCTGG + Intronic
1122153491 14:99737170-99737192 GCCAAAAGCAGCCAGCACTTCGG - Intergenic
1122153861 14:99738764-99738786 CCCACCTGCTGCCAGCACGCAGG - Intronic
1202936465 14_KI270725v1_random:92518-92540 GCCAGCTGCATGGAGCACTCTGG + Intergenic
1124399388 15:29335064-29335086 GCCATCTCCAGCCATCAGTGAGG + Intronic
1124651347 15:31476523-31476545 GCCTGCTCCTGCCAGCACTCAGG - Exonic
1128316576 15:66663008-66663030 GGACTCTGCTGCCAGCACTCTGG - Intronic
1128749822 15:70140838-70140860 GCCGTCTGCAGGAAGCACCCCGG - Intergenic
1129321170 15:74775810-74775832 GCCTGAGGCAGCCAGCACTCAGG - Intergenic
1131983394 15:98017423-98017445 TCCCTCTGCAGCCACCACACGGG + Intergenic
1132409899 15:101568897-101568919 ACCATCTGCAGCCAGCAGGCTGG + Intergenic
1132554851 16:567935-567957 GGCATCCACAGCCAGCCCTCGGG - Exonic
1133004884 16:2874494-2874516 GCCTTCAGCAGCCTGCACCCCGG + Intergenic
1133320440 16:4910260-4910282 TCCTACTGCTGCCAGCACTCAGG - Intronic
1138029962 16:53552148-53552170 GACATCAGCTGCCAGCACCCAGG + Intergenic
1138059821 16:53878408-53878430 CCCTTATGCACCCAGCACTCTGG + Intronic
1138336559 16:56258089-56258111 GCCATCTGCAGCCTGGATTTGGG - Intronic
1141255346 16:82397083-82397105 GCCAGCAGCAGGCAGCACACAGG - Intergenic
1141460651 16:84176843-84176865 GTCTTCTGCAGCCAGGCCTCTGG - Intronic
1141517766 16:84557740-84557762 GCCAGAGGCAGCCAGCACCCAGG + Intergenic
1141730944 16:85822459-85822481 ACTATCTGCAGCCAGCACAATGG - Intergenic
1142174129 16:88637174-88637196 GACAGCTGCAGCCAGAACTTGGG - Intergenic
1143960188 17:10710652-10710674 GCCATCTACAGCCACATCTCTGG - Intronic
1144872601 17:18380401-18380423 GGCTGCTGAAGCCAGCACTCTGG + Intronic
1145992295 17:29086397-29086419 GGCATCTGCAGCTAGCACGGAGG - Intronic
1147505966 17:41017908-41017930 GCCGTCTGCAGTCAGGTCTCTGG + Intronic
1149508440 17:57216075-57216097 ACCATCAGGAGCCAGCACTAGGG + Intergenic
1150017746 17:61575440-61575462 GACATTTGAAGCCAGCACCCCGG - Intergenic
1150285580 17:63951954-63951976 GCCACCTTCAGCCAGCACAGGGG + Intronic
1151157702 17:72138196-72138218 TCCATCTCCAGCCACCTCTCTGG + Intergenic
1151619785 17:75238678-75238700 GCCACCTGCAGCCATCACCCAGG - Exonic
1152287687 17:79422203-79422225 GCCATGTGCAGACAGCAGTTGGG + Intronic
1152512491 17:80799818-80799840 GGCACCTGCAGCCTGCACTCAGG - Intronic
1152550206 17:81025988-81026010 GCCATCTCTAGCCAGCCCTGGGG + Intergenic
1153353552 18:4109152-4109174 GCCATCCGCAACTGGCACTCGGG + Intronic
1154523813 18:15261217-15261239 GCCAACTGCAGTCCGCAGTCCGG - Intergenic
1156358097 18:36360275-36360297 GCCATGTCCAGCCACCACACTGG - Intronic
1156495097 18:37520298-37520320 GCCAAGTGCACACAGCACTCTGG - Intronic
1156497796 18:37537443-37537465 GCCATTTGAAGTTAGCACTCAGG - Intronic
1157484089 18:48074633-48074655 ACCAATTGCAGACAGCACTCTGG + Intronic
1157574693 18:48735835-48735857 GCGAGCTGCAGCCATCAATCTGG + Intronic
1157926081 18:51767594-51767616 GCCATCTGCAGGCAGGACTCAGG - Intergenic
1159430392 18:68344737-68344759 GCTATCTGTAGCCAGCTTTCAGG - Intergenic
1160111563 18:76037194-76037216 GCCATCTGCAAGCCTCACTCAGG + Intergenic
1160375665 18:78409953-78409975 TCCAGCTGTAGCCACCACTCGGG + Intergenic
1160859991 19:1233683-1233705 GCCACCTGGGGCCAGCACACGGG - Intronic
1161108360 19:2455593-2455615 CCCCTCTGCAGCCCTCACTCAGG + Intronic
1161620676 19:5295398-5295420 GCCAACTGCAGTCACCACTGTGG - Intronic
1161677985 19:5663746-5663768 GCCATCTGCAGGCAGCCCATAGG + Intronic
1163771543 19:19194026-19194048 GCCATCTGCAGCCTCCTCTCCGG - Exonic
1165075502 19:33277960-33277982 GCCATCTGCATCTAGGACCCTGG - Intergenic
1166091085 19:40509584-40509606 CCCAACTGCCGTCAGCACTCAGG - Intronic
1166663532 19:44663016-44663038 AGCATCTGCAGCCAGCAAGCTGG + Exonic
1166688759 19:44810668-44810690 GCCATTTGCCTCCAGCACCCTGG - Intronic
1167379791 19:49132106-49132128 GGCATGAGCAACCAGCACTCTGG - Intronic
1168047620 19:53805283-53805305 ATCATCTGCAGCCTGCACTGGGG + Exonic
1168102275 19:54147596-54147618 GCAATCTGCGGACAGCACTCGGG - Intronic
1168209588 19:54880980-54881002 CAGATCTGCAGCCAGCACTTGGG - Intronic
925105526 2:1287576-1287598 GCCACCTGCACGGAGCACTCCGG - Intronic
925712323 2:6753349-6753371 GCCACCTGCAGAGAGCACACTGG - Intergenic
926253326 2:11168746-11168768 AGCATCTGCACCCAGCTCTCAGG + Intronic
926689812 2:15725480-15725502 GCAATGTGCACCCAGCATTCAGG + Intronic
927640690 2:24843745-24843767 GGCACCTGCAGGCAGCGCTCAGG + Intronic
927935109 2:27071868-27071890 GCCAGCTGCAGCCAGCTGTGCGG - Intergenic
928204385 2:29273576-29273598 GCCCCCTGCAGCCAGCATTTAGG - Intronic
929593341 2:43160816-43160838 CCTATCTGCAGCCTGCACTAGGG - Intergenic
930769935 2:55120737-55120759 GCCATCTCCAGGCAGGGCTCGGG + Intergenic
931268216 2:60679247-60679269 GCCAACTGCAGTCAGCACTGGGG - Intergenic
931511172 2:62996895-62996917 GCGATTTGCAGCCACCTCTCTGG + Intronic
932563705 2:72892759-72892781 GTGGTCTGCAGCCAGCACCCTGG + Intergenic
933800937 2:85959893-85959915 TCCATGTGCAGCCAGAACTTGGG - Intergenic
934201770 2:89891997-89892019 GCCAGCTGCACAGAGCACTCTGG - Intergenic
934466906 2:94271554-94271576 GCCAGCTGCATGGAGCACTCTGG + Intergenic
935106944 2:100053678-100053700 GCCATATGCAGACAGCACAAAGG + Intronic
935319150 2:101868690-101868712 GCCTCCTGCCCCCAGCACTCAGG + Intronic
935343969 2:102087256-102087278 ACCTTCAGCAGCCACCACTCTGG - Intronic
936022265 2:109003816-109003838 GACATCGGCAGGCAGCTCTCAGG + Intergenic
936452077 2:112641344-112641366 GCCATGTGCAGCCAGGACAGAGG + Intergenic
937958912 2:127439574-127439596 TCCATCTGCAGCCAGCCATGAGG - Intronic
938386866 2:130872879-130872901 GCCAGCTGCAGGCAGGGCTCAGG - Intronic
947685184 2:232077695-232077717 CCCATTTGCAGCATGCACTCAGG + Intronic
948602060 2:239112869-239112891 GCCCTGTGCTGCCAGCACTGGGG + Intronic
948873086 2:240813358-240813380 GCCCTCTGCAAGCGGCACTCAGG - Intronic
949077330 2:242069218-242069240 CCCATCTGCACCCAACACTGGGG + Intergenic
1171355677 20:24543817-24543839 GCCATCTGCAGCCATTACCTGGG - Intronic
1173007427 20:39150980-39151002 GCCAGCTGCGGCCAGCTCTGGGG + Intergenic
1173908129 20:46643518-46643540 GCCCTCTGCTCCCAGCGCTCTGG - Intronic
1175491434 20:59383398-59383420 GCTCTCAGGAGCCAGCACTCAGG + Intergenic
1176129246 20:63489265-63489287 GCCCCCTCCAGTCAGCACTCCGG - Intronic
1176300828 21:5098205-5098227 GCCAGATGCTGCCAGCACCCGGG + Intergenic
1176422402 21:6526771-6526793 GCCAGCTTCTGCCAGCTCTCAGG - Intergenic
1176587033 21:8597081-8597103 GCCAGCTGCATGGAGCACTCTGG - Intergenic
1179280426 21:39929570-39929592 GCCATCGCCAGCCAGCACTTAGG - Intergenic
1179609142 21:42538124-42538146 GCCAGCAGCACCCAGCTCTCAGG + Intronic
1179697893 21:43135087-43135109 GCCAGCTTCTGCCAGCTCTCAGG - Intergenic
1179879679 21:44288183-44288205 GCCATGTGCAGACAGCCCACAGG - Intronic
1180041194 21:45281096-45281118 GTCATCTGCCCCCAGCACCCAGG - Intronic
1180269862 22:10574078-10574100 GCCAGCTGCATGGAGCACTCTGG - Intergenic
1180588046 22:16910785-16910807 GCCAGCTGCATGGAGCACTCTGG + Intergenic
1180692217 22:17726893-17726915 GCAATCTGCTGCCAGGACTCAGG - Exonic
1181266363 22:21633185-21633207 GCCAGGTGCCGCCACCACTCGGG + Exonic
1181580708 22:23826604-23826626 CACATCTGCAGTCATCACTCAGG + Intronic
1182750746 22:32640333-32640355 GCCATCTTGTGCCAGCACTTTGG - Intronic
1183156671 22:36081134-36081156 GCCAGATGCAGCCAGCTCTAGGG + Intergenic
1184730676 22:46369461-46369483 ACCATCTGCGTCCAGCACCCAGG - Intronic
1185277944 22:49957822-49957844 GCCCTCTGCAGTCAGTACCCAGG + Intergenic
950023714 3:9806758-9806780 GCCATCTTTAGGCAGAACTCAGG - Intronic
950573779 3:13818671-13818693 GCCTTCTGCAGCAGGAACTCTGG - Exonic
951098403 3:18658249-18658271 GCCACCTGCAGCCACCAGTGTGG + Intergenic
952556270 3:34534834-34534856 GCCATTAGCAGCCAACACTCAGG - Intergenic
953667141 3:44933519-44933541 GCCCTCAGCAGTCAGCACCCTGG - Intronic
953751975 3:45615981-45616003 GGCATCTTCAGCCAGCCTTCAGG + Intronic
954384270 3:50236223-50236245 GCCCTCTGCGGGAAGCACTCGGG - Exonic
954887004 3:53883663-53883685 GTCAAATGCAGCCAGAACTCTGG + Intergenic
960162432 3:114365139-114365161 GCCATCTGCTGCCAGTGCTTAGG - Intronic
960914002 3:122679311-122679333 GCCATCTGCAGGTAGCAAGCTGG + Intergenic
961399042 3:126621418-126621440 GCAACCTGCTGACAGCACTCTGG + Intronic
966500591 3:180634632-180634654 GTGATCTACAGCCAGCACTCAGG + Intronic
966910927 3:184559630-184559652 TCCAACCCCAGCCAGCACTCCGG + Intronic
967433727 3:189419870-189419892 TTCATCTTCAGCCAGCACACTGG - Intergenic
968270215 3:197397700-197397722 GCCATTCACAGCCGGCACTCTGG + Intergenic
968945140 4:3659755-3659777 GGAGTCTGCAGCCAGCTCTCTGG + Intergenic
969228459 4:5814089-5814111 GCCACATGAAGGCAGCACTCAGG + Exonic
969309831 4:6346817-6346839 GCCCTCTGCCGCCGGCACCCAGG + Intronic
969355929 4:6625774-6625796 GCCTGGTGCAGCCAGCACTTTGG + Intergenic
969537328 4:7764655-7764677 GCCATCTGCAGCCAGCACTCAGG - Intronic
969832665 4:9810402-9810424 GGCATCTCCAGCCAGGCCTCAGG + Intronic
971605596 4:28653036-28653058 GACATCTGCAGCCAGTCCTTAGG - Intergenic
972292345 4:37701450-37701472 GCCATCTGCAGACTGCAGTAAGG - Intergenic
974123310 4:57665742-57665764 GACATCTGCAGACAGAGCTCAGG - Intergenic
981337394 4:143582235-143582257 AAGATCTGCAGCCAGCACTCAGG + Intronic
982965463 4:161901325-161901347 ACCATCTACAGACAGCACACAGG + Intronic
983628510 4:169826733-169826755 TAGATCTGCAGCCAGCACTCAGG + Intergenic
985909937 5:2871408-2871430 GCCACCTACCTCCAGCACTCAGG + Intergenic
985922902 5:2993455-2993477 TCTATCTGCAGGCATCACTCAGG - Intergenic
985959395 5:3288496-3288518 GCCGCCAGCAGCCAGGACTCAGG + Intergenic
985998473 5:3611377-3611399 GCCACCTGGGGTCAGCACTCAGG - Intergenic
986758288 5:10857564-10857586 GCTGTCTGCAGCCAACGCTCAGG - Intergenic
994370413 5:98961192-98961214 GCAGTCAGCAGCCAACACTCTGG - Intergenic
996683819 5:126257679-126257701 GCCTACTGCTGCCAGCACTGAGG + Intergenic
997438724 5:133893552-133893574 GCCTTCTGCAGCCAGGGCACTGG + Intergenic
997481054 5:134184782-134184804 GTCGTCTGGAGCCAGCACACTGG + Intronic
997519844 5:134515943-134515965 GCCATCTGTAGCCACCAGGCTGG + Intergenic
997593653 5:135091790-135091812 GCCATCTCCTGTCTGCACTCTGG - Intronic
997596622 5:135111466-135111488 GCCGGCTGCCTCCAGCACTCTGG + Intronic
1001512908 5:172336370-172336392 GCCATCTGCCCCCAACGCTCTGG + Exonic
1001908956 5:175498290-175498312 GCCGTCAGTATCCAGCACTCAGG - Intronic
1002922376 6:1581583-1581605 GCCATGTGGAGCCACTACTCGGG + Intergenic
1005120035 6:22379490-22379512 GCCATTTGCGGACAGCACTGAGG + Intergenic
1007632785 6:43282168-43282190 GCCCTGGGCAGCCAGCTCTCTGG + Intronic
1007762027 6:44138847-44138869 GCCAGCTGCAGGCAGAACTCAGG + Intronic
1008586729 6:52957485-52957507 TCCAGCTGCAGCCAGCAGCCAGG + Intergenic
1013645419 6:112134296-112134318 GCCCTCTGCAGTCAGTCCTCAGG - Intronic
1015376154 6:132512874-132512896 GCGCTCTGCAGCAGGCACTCGGG - Intronic
1017884521 6:158588062-158588084 GCAATCTGCTGCCTGCCCTCTGG - Intronic
1019649181 7:2147372-2147394 GCCATCTGGAGCCTGCACCTTGG + Intronic
1020755956 7:12203243-12203265 ACCATATGCAGCCCGCACTTAGG + Intergenic
1022178839 7:27898699-27898721 GCCAGCTACAGACAGCAATCTGG + Intronic
1023351394 7:39323476-39323498 GCCATCCACAGCCAGCAGACGGG - Intronic
1026823626 7:73567132-73567154 ACCACCTGCATCCAACACTCGGG - Intergenic
1028167856 7:87559759-87559781 CCCATCTGCAGATAGCAGTCAGG + Intronic
1031992982 7:128209902-128209924 GCCACCTGCTGCCAGCATGCGGG + Intergenic
1034835988 7:154351910-154351932 GGCATCTGCTCCCAGCCCTCTGG + Intronic
1034967625 7:155401035-155401057 GCCATCAGCAGCCAGCACACAGG - Intergenic
1035535883 8:391102-391124 CCCATCTGCACCCAACACTGGGG + Intergenic
1039879560 8:41616113-41616135 GGCATCTGCATCCTGCATTCTGG + Intronic
1042761825 8:72279771-72279793 GCTAGCTGCAGCCAGCACCAGGG + Intergenic
1046045117 8:108954986-108955008 GCCTTCTGCCCCCAGAACTCTGG - Intergenic
1047349904 8:124063933-124063955 GCCAACTGTAGGCAGAACTCTGG - Intronic
1048123257 8:131605431-131605453 GAGATCTGCAGCCAGCAAACTGG + Intergenic
1049688649 8:143949326-143949348 GCCATCCGGAGCCAGCACGGAGG + Intronic
1049775486 8:144401937-144401959 GCCCTGTGCGGCAAGCACTCAGG + Intronic
1050135585 9:2459982-2460004 GCCTTCTGCAGCCTGCACATTGG - Intergenic
1050302190 9:4270794-4270816 ACCATCTGCAGTCAGCAAGCTGG - Intronic
1050320647 9:4448892-4448914 GTCTTCTGCACCCATCACTCTGG - Intergenic
1051201353 9:14629722-14629744 GCCTTCAGCAGCCACCACCCTGG - Intronic
1052754266 9:32524859-32524881 GCTCCCTGCAGCCAGCACTTTGG - Intronic
1054945770 9:70794520-70794542 CCCATCTCCATCCTGCACTCTGG + Intronic
1056765309 9:89441475-89441497 GACATCTCCAGCCAGAGCTCAGG - Intronic
1059723035 9:116980094-116980116 TCCATCTGCTGCTAGCACTCGGG - Intronic
1060893353 9:127202367-127202389 GGCATCTGCAGCCTGAACTCTGG - Intronic
1061602550 9:131680928-131680950 GCATTCTCCAGCCATCACTCTGG - Intronic
1061628147 9:131854402-131854424 GCCATCTGCGACCCTCACTCTGG - Intergenic
1061921962 9:133787426-133787448 GCCACCAGCACCCAACACTCTGG - Intronic
1062452061 9:136619994-136620016 GCCATGGGCAGCCAGCCTTCCGG - Intergenic
1062465018 9:136677097-136677119 GCGATCTGCACGCAGCGCTCCGG + Exonic
1062467893 9:136689184-136689206 ACCATGTGCGACCAGCACTCAGG + Intergenic
1062511360 9:136907924-136907946 GCCCTCTGCAGATAGCTCTCAGG - Intronic
1062597870 9:137307197-137307219 GCCATCTGCAGCCAGCGGCAGGG + Exonic
1203754908 Un_GL000218v1:116849-116871 ACCAACTTCAGGCAGCACTCCGG - Intergenic
1203452950 Un_GL000219v1:137656-137678 GTCATCTTCAGCCAGCACAGAGG - Intergenic
1203616990 Un_KI270749v1:74795-74817 GCCAGCTGCATGGAGCACTCTGG - Intergenic
1186713167 X:12221783-12221805 GGCATCTCCACCCAGCATTCAGG - Intronic
1189265949 X:39716181-39716203 GCTTTCTCCAGCCAGCACTGGGG - Intergenic
1189380267 X:40497790-40497812 TCACTCTGCAGCCAGCACCCCGG + Intergenic
1191019057 X:55841125-55841147 GTGAACTGCAGCCAGCAATCAGG - Intergenic
1191182449 X:57577971-57577993 GTCATTTGCAGCCAGCAGTAGGG + Intergenic
1191215138 X:57925700-57925722 GTCATTTGCAGCCAGCAGTAGGG - Intergenic
1193440804 X:81537575-81537597 GAAATCTGTAGCCAGCACTCGGG - Intergenic
1195894691 X:109733384-109733406 GCCGTCTGCAGCCAGCGATTCGG - Exonic
1198142001 X:133813723-133813745 CCCATCAGCAGACAGCCCTCTGG + Intronic
1200184923 X:154175955-154175977 GCCATCAGCAGTAAGCCCTCGGG + Intergenic
1200190576 X:154213093-154213115 GCCATCAGCAGTAAGCCCTCGGG + Intergenic
1200196327 X:154250895-154250917 GCCATCAGCAGTAAGCCCTCGGG + Intergenic
1200201982 X:154288013-154288035 GCCATCAGCAGTAAGCCCTCGGG + Exonic
1200281533 X:154781138-154781160 GTGACCTCCAGCCAGCACTCTGG + Intronic
1200682351 Y:6227082-6227104 GCCTTCTGCACCAAGCTCTCTGG + Intergenic
1201145384 Y:11062276-11062298 GCTCCCTGCAGCCAGCACCCTGG - Intergenic
1201194680 Y:11480303-11480325 GCCAGCTGCATGGAGCACTCTGG + Intergenic