ID: 969537331

View in Genome Browser
Species Human (GRCh38)
Location 4:7764691-7764713
Sequence GTGCCAGCACTGTGAAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969537325_969537331 21 Left 969537325 4:7764647-7764669 CCACAGGCCCTGAGTGCTGGCTG 0: 1
1: 0
2: 5
3: 60
4: 500
Right 969537331 4:7764691-7764713 GTGCCAGCACTGTGAAAGCAGGG No data
969537323_969537331 25 Left 969537323 4:7764643-7764665 CCATCCACAGGCCCTGAGTGCTG 0: 1
1: 0
2: 3
3: 24
4: 332
Right 969537331 4:7764691-7764713 GTGCCAGCACTGTGAAAGCAGGG No data
969537328_969537331 13 Left 969537328 4:7764655-7764677 CCTGAGTGCTGGCTGCAGATGGC 0: 1
1: 0
2: 3
3: 24
4: 266
Right 969537331 4:7764691-7764713 GTGCCAGCACTGTGAAAGCAGGG No data
969537326_969537331 14 Left 969537326 4:7764654-7764676 CCCTGAGTGCTGGCTGCAGATGG 0: 1
1: 2
2: 11
3: 60
4: 295
Right 969537331 4:7764691-7764713 GTGCCAGCACTGTGAAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969537331 Original CRISPR GTGCCAGCACTGTGAAAGCA GGG Intronic
No off target data available for this crispr