ID: 969544776

View in Genome Browser
Species Human (GRCh38)
Location 4:7818561-7818583
Sequence GGCCTGCGGCGTCACAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969544772_969544776 29 Left 969544772 4:7818509-7818531 CCAAGGAAACAATATCAGTTGGA 0: 1
1: 0
2: 3
3: 13
4: 180
Right 969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG 0: 1
1: 0
2: 0
3: 5
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969544776 Original CRISPR GGCCTGCGGCGTCACAGTGA TGG Intronic
900125326 1:1066661-1066683 GGCCTCCGCCCTCACAGGGAAGG - Intergenic
902300704 1:15500738-15500760 GGCCTGAGGCGTGAATGTGATGG + Intronic
902412565 1:16219963-16219985 GGCCTGGGGCCACCCAGTGAGGG + Intergenic
903217111 1:21849328-21849350 GGCCTTGGGGGTCAGAGTGAGGG - Intronic
903685445 1:25128378-25128400 AGTCTCCGGCCTCACAGTGATGG - Intergenic
907554663 1:55333835-55333857 GGCCTGGGTGGGCACAGTGATGG + Intergenic
908127326 1:61044062-61044084 GGCCTGGTGGGTGACAGTGAGGG + Intronic
909047635 1:70729175-70729197 GGCCTGGGGTATTACAGTGAGGG - Intergenic
909365093 1:74811646-74811668 GGCCTGGAGCGTCACTGTGGAGG - Intergenic
909649273 1:77955417-77955439 GGCCTGCAATGTGACAGTGAGGG + Intronic
1063855166 10:10242053-10242075 GGCATGCCTCGTCACAGTGATGG - Intergenic
1070670603 10:78374900-78374922 GGACTGGGGAGTTACAGTGAGGG - Intergenic
1070682145 10:78456148-78456170 GGCCTGCGGTGGCCCAGGGATGG + Intergenic
1071251949 10:83827579-83827601 GGCCTTCGGCCACAGAGTGAAGG + Intergenic
1072900113 10:99399720-99399742 GGAGTGCGGCGTCACAATCATGG - Intronic
1073423700 10:103443503-103443525 GGCCTGTGGGGTCAAGGTGAGGG + Intronic
1076142515 10:128091096-128091118 GGAATGTGGCGTCACAGTGCAGG + Intergenic
1091235172 11:134017128-134017150 TGCCTGCTCCCTCACAGTGATGG + Intergenic
1091767597 12:3131917-3131939 GGCCTGGGGGGTCACAGGTAAGG - Intronic
1092761861 12:11818035-11818057 GGCCTGCGGGGTGACAGGGAGGG + Intronic
1093892440 12:24538406-24538428 GGCCTGTTGAGTCACCGTGAAGG - Intergenic
1096369882 12:51060174-51060196 GGACTGCTGCATCACAGTGGAGG - Exonic
1100689953 12:97029055-97029077 GGCCTGGGGGGTAGCAGTGAAGG + Intergenic
1100830899 12:98515932-98515954 GGCCGGCAGCGTCACATTGTTGG - Exonic
1102799703 12:115721245-115721267 GGCCTGAGGCGTCTCTGTCAGGG - Intergenic
1103270333 12:119668216-119668238 GGTCTGCGGGGACACAGGGAAGG - Exonic
1104841521 12:131828234-131828256 GGTCCGCGGCATCACAGGGAAGG - Intergenic
1105603438 13:21907878-21907900 GGCCTGGGGTCTCACAGTGGTGG - Intergenic
1108747695 13:53411612-53411634 GGCCTGCTGTGCCACAGTCAGGG + Intergenic
1113720783 13:112554410-112554432 GGCCTGCGGTGTGGCAGAGAAGG + Intronic
1113881481 13:113629126-113629148 GTGCTGCGGAGACACAGTGAGGG + Intronic
1114038472 14:18652954-18652976 GGCCTTCGGCCTCAGACTGAAGG - Intergenic
1114120149 14:19662089-19662111 GGCCTTCGGCCTCAGACTGAAGG + Intergenic
1120693731 14:87621311-87621333 ACCCTGCAGAGTCACAGTGATGG - Intergenic
1122071009 14:99205319-99205341 GGCCTGGGCCGTCTCAGTTAGGG - Intronic
1122613459 14:103001248-103001270 GGCTGGCGGGGCCACAGTGAGGG - Intronic
1122687484 14:103516708-103516730 GGCCTGAGGCCTCACAGACAGGG - Intergenic
1123676663 15:22715524-22715546 TGCCTGCAGCGTCACACCGATGG + Intergenic
1124328879 15:28789787-28789809 TGCCTGCAGCGTCACACCGATGG + Intergenic
1126334446 15:47570854-47570876 GGCCAGGGGTGTCTCAGTGATGG + Intronic
1127854193 15:62941372-62941394 TGCCTGCAGAGCCACAGTGAAGG - Intergenic
1128979562 15:72176316-72176338 GGCCTGCGTGGTCACAGGCAGGG + Intronic
1132481253 16:167244-167266 GGGCTGCAGGGTCACAGGGAGGG - Intergenic
1132998774 16:2838730-2838752 GGGCTGAGGCGTCAGGGTGACGG + Intronic
1134020539 16:10918420-10918442 AGACTGCGGGGACACAGTGAGGG - Exonic
1137565287 16:49528887-49528909 CGCCTGCGGGGTGAGAGTGATGG - Intronic
1141754645 16:85983179-85983201 TGCCTGAGGCCACACAGTGATGG + Intergenic
1142262263 16:89048502-89048524 GGGCTGGGGCGTCCCAGTCAGGG + Intergenic
1142976180 17:3645971-3645993 GGCCTGGGGGGTCTGAGTGACGG + Intronic
1145289824 17:21534332-21534354 GGGCTCCAGCATCACAGTGAAGG + Exonic
1146940224 17:36839335-36839357 CTCCTGAGGGGTCACAGTGAGGG - Intergenic
1147311187 17:39596937-39596959 GGCCCGCGGCGTGGCAGTGGCGG + Intergenic
1147626038 17:41900777-41900799 TGCCTGCTGTCTCACAGTGATGG + Intronic
1150003211 17:61454847-61454869 GGCCTGCGGGGTCGCAAGGAGGG - Intronic
1152041727 17:77907896-77907918 GGCCTGCCACCCCACAGTGATGG - Intergenic
1161410206 19:4112761-4112783 GGCCTGTGGGGTCACCATGAGGG - Intronic
1163492973 19:17627796-17627818 GGCCTGCAGGGACACAGTGGTGG + Intronic
1163860602 19:19740790-19740812 GGCCGGCGGCGTCTCAGAGTTGG + Intergenic
1165965122 19:39570905-39570927 GGCCTGCAGTGTCACCGGGAAGG - Intergenic
1166224031 19:41383886-41383908 GGCCTCAGGGTTCACAGTGAGGG - Exonic
1166360069 19:42249350-42249372 GGCCAGAGGCGACACAGGGAAGG + Exonic
1167592026 19:50409298-50409320 GCCCTGGGGTGTCCCAGTGAGGG - Intronic
1167887726 19:52515970-52515992 GGGCTGTGGAGCCACAGTGAGGG - Intergenic
1167910914 19:52700955-52700977 GGGCTGTGGAGCCACAGTGAGGG + Intergenic
1167918571 19:52762225-52762247 GGGCTGTGGAGCCACAGTGAGGG + Intergenic
1168076379 19:53982699-53982721 GGGCGGCGGCGTCACGGTCACGG + Exonic
925336485 2:3102492-3102514 GGCCTTCTGGGTCACAGTGCTGG + Intergenic
925449175 2:3953607-3953629 GGCCTTTGGAGTCACAGTGATGG + Intergenic
925541901 2:4975998-4976020 GGCCTTCGGCCCCAGAGTGAAGG + Intergenic
928170949 2:29002666-29002688 GGCCAGCGGAGTCAAAGAGAAGG + Exonic
931928132 2:67097663-67097685 GGCCTGGGGAGTCACAGTCCCGG + Intergenic
933990402 2:87629801-87629823 GGCCTGCTGAGTCACACTGCAGG - Intergenic
936303444 2:111321023-111321045 GGCCTGCTGAGTCACACTGCAGG + Intergenic
940112414 2:150169418-150169440 GGCCTTTGGCCTCAGAGTGAGGG - Intergenic
944076919 2:195743187-195743209 GGCCTGCGGCCACAGACTGAAGG + Intronic
948887762 2:240892588-240892610 GGCCAGCAGGCTCACAGTGACGG + Intronic
948887775 2:240892642-240892664 GGCCAGCAGGCTCACAGTGACGG + Intronic
948938220 2:241182238-241182260 TGTCTGCTGTGTCACAGTGATGG + Intronic
1171330150 20:24330321-24330343 GCCCTGAGGCAGCACAGTGAAGG + Intergenic
1171419100 20:25005914-25005936 CGCCTGCGGCCTCCAAGTGATGG + Intergenic
1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG + Intronic
1175561820 20:59937243-59937265 GGCCAGGGGCGTAGCAGTGAAGG + Exonic
1179886652 21:44317000-44317022 CGCCTGTGGCGTCACAGTCTGGG + Intronic
1179896351 21:44365738-44365760 TGCCTGTGGCCTGACAGTGAGGG + Intronic
1180182949 21:46126059-46126081 CGACCGCGACGTCACAGTGACGG + Exonic
1181311039 22:21944996-21945018 GGCCTGAGGCCTTACAGTCAAGG - Intronic
1182451433 22:30424094-30424116 GGTCTCCGCCGTCACTGTGAAGG - Exonic
1183009457 22:34932868-34932890 GGCCTGCAGAGCCAAAGTGAGGG + Intergenic
1184255063 22:43281827-43281849 GGACTGTGCCGTGACAGTGAAGG - Intronic
1184522523 22:45003554-45003576 GGCCTGCAGAGCCACAGGGATGG - Intronic
969149979 4:5161026-5161048 GGCCTGGGGATCCACAGTGAAGG + Intronic
969514792 4:7641074-7641096 GGCCTGCGGTGGCACAGGGAAGG - Intronic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
978615280 4:110587769-110587791 GGGCTGCGGCGTCCCAGGCAGGG - Intergenic
984102331 4:175500140-175500162 GGCCTGGGGCGGCAGTGTGAGGG + Intergenic
985391789 4:189497995-189498017 GGCCTGCGCCAGCCCAGTGATGG + Intergenic
985528225 5:418587-418609 GGCCTGCGGCTGCTCAGGGAGGG + Intronic
985613863 5:907729-907751 TGCCCGGGGCGGCACAGTGAGGG - Intronic
990594651 5:57300670-57300692 GGCCTTGGGCCACACAGTGAAGG + Intergenic
995858986 5:116622186-116622208 GGAATGTGGGGTCACAGTGAGGG + Intergenic
997585436 5:135040499-135040521 GGCCTGCGGGGCCACAGGGGTGG - Intronic
1006750025 6:36371352-36371374 GGCCTGCGGCATCGCGGGGAAGG + Exonic
1006838717 6:37014791-37014813 GGACTGGGGGGTAACAGTGAGGG - Intronic
1013838331 6:114359465-114359487 TGCCTGCTGGGTCACAGTAAAGG - Intergenic
1015680484 6:135802287-135802309 GGCCAGCTGCTTCAGAGTGATGG + Intergenic
1019373483 7:676328-676350 GGTCTGCAGGGTCGCAGTGAGGG - Intronic
1020232545 7:6330916-6330938 GGCCTCTGGCTTCACAGTGGCGG - Exonic
1022515917 7:30974910-30974932 TGCCTGCGTCACCACAGTGAAGG + Intronic
1025253139 7:57365410-57365432 GGCCTGAGGCAGCACAGTCAGGG - Intergenic
1028222050 7:88209348-88209370 CGCCTGCTGCGTCAAACTGAGGG - Exonic
1029707408 7:102283099-102283121 GGCCTCCCCCGTGACAGTGACGG + Intronic
1035269620 7:157711723-157711745 GAACTGCTGCGTCCCAGTGACGG - Intronic
1041990179 8:63978765-63978787 GGGCTGCAGTTTCACAGTGAAGG + Intergenic
1042435505 8:68760101-68760123 GGCCTGTGGCTTGATAGTGAAGG + Intronic
1047940943 8:129826912-129826934 GGCCTGAGGGGTCACACTGAGGG + Intergenic
1049370523 8:142262107-142262129 GGCCTGCGGCGACTCCGTGGTGG + Intronic
1053320345 9:37092846-37092868 GGCCTGTGGTTTCACAGTGGTGG - Intergenic
1058143202 9:101380325-101380347 GGTCTGGGGAGTAACAGTGAGGG + Intronic
1060047638 9:120353462-120353484 GGCCTGCGGGGGGACAGGGAGGG + Intergenic
1060892643 9:127198511-127198533 GGCCAGTGGGGTCACAGAGAGGG - Intronic
1061238049 9:129353305-129353327 GGACTGGGGAGTCACAGGGAAGG + Intergenic
1061569802 9:131470207-131470229 GACCTACGGTGTTACAGTGAGGG - Intronic
1062100758 9:134727334-134727356 GTACTGCGGTGTCACAGTCAGGG - Exonic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1062454200 9:136628027-136628049 GGGCTGCGGCGCCACATGGATGG + Intergenic
1192166414 X:68829947-68829969 GGCGTGCGGCCTCACCCTGAAGG - Intronic
1200905305 Y:8475696-8475718 GGAGTGCAGTGTCACAGTGATGG - Intergenic