ID: 969545085

View in Genome Browser
Species Human (GRCh38)
Location 4:7820746-7820768
Sequence GTGAGGATGTGGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1590
Summary {0: 1, 1: 1, 2: 15, 3: 123, 4: 1450}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969545079_969545085 -3 Left 969545079 4:7820726-7820748 CCATTTTAATGAAAGGCAGAGTG 0: 1
1: 0
2: 1
3: 26
4: 277
Right 969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG 0: 1
1: 1
2: 15
3: 123
4: 1450
969545077_969545085 14 Left 969545077 4:7820709-7820731 CCTGCTGAAGGATGGTTCCATTT 0: 1
1: 0
2: 1
3: 17
4: 117
Right 969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG 0: 1
1: 1
2: 15
3: 123
4: 1450
969545073_969545085 30 Left 969545073 4:7820693-7820715 CCAAAGTGTTCCTTCTCCTGCTG 0: 1
1: 0
2: 4
3: 31
4: 324
Right 969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG 0: 1
1: 1
2: 15
3: 123
4: 1450
969545076_969545085 20 Left 969545076 4:7820703-7820725 CCTTCTCCTGCTGAAGGATGGTT 0: 1
1: 0
2: 0
3: 13
4: 149
Right 969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG 0: 1
1: 1
2: 15
3: 123
4: 1450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969545085 Original CRISPR GTGAGGATGTGGAGGGAAGA GGG Intronic
900003836 1:30975-30997 GTGAGGATGCGAAGAGAAGGTGG + Intergenic
900023558 1:201495-201517 GTGAGGATGCGAAGAGAAGGTGG + Intergenic
900149096 1:1170533-1170555 GAGAGGAGGAGGAGGGAGGAGGG - Intergenic
900561673 1:3310157-3310179 GTGAGGAGGTGGAGGTAGGAAGG - Intronic
901056290 1:6450050-6450072 TGCAGGCTGTGGAGGGAAGAAGG - Intronic
901125895 1:6928520-6928542 GTTAGGGTGGGGAGGGCAGATGG - Intronic
901153890 1:7122758-7122780 GGGAGGCTGCGGAGTGAAGATGG - Intronic
901183104 1:7355277-7355299 GGGAGGCTGAGGTGGGAAGATGG + Intronic
901253163 1:7797162-7797184 TCGTGGATGTGGAGGGAAGCTGG + Intronic
901272451 1:7963166-7963188 GGGAGGCTGAGGTGGGAAGATGG - Intronic
901313167 1:8285310-8285332 GTGGGGCAGTGGAAGGAAGATGG + Intergenic
901453811 1:9352076-9352098 GTGAGGGGGTGGAGGGAAGGTGG + Intronic
901558516 1:10050803-10050825 GGGAGGCCGAGGAGGGAAGATGG - Intronic
901625447 1:10622117-10622139 GTGAGGGTGTGGAGGGGTGGAGG - Intronic
901636067 1:10670762-10670784 GTGAGGTAGAGGAGGGAGGAGGG - Intronic
901689284 1:10962056-10962078 GTGAGGAGGAGGAGGAAGGAAGG - Intronic
901740385 1:11338179-11338201 GGGAGGAGGAGGAGGGGAGAAGG - Intergenic
901911797 1:12464709-12464731 GTGGGGGTGGGGAGAGAAGAGGG + Intronic
902175852 1:14650149-14650171 GTGGGTATGTGGAAGGAAGTAGG + Intronic
902218097 1:14947324-14947346 GTGAGGATGTGGAGGGAAGCAGG + Intronic
902276482 1:15343507-15343529 GTGAGGATGGAGATGAAAGAGGG - Intronic
902328287 1:15717011-15717033 GGGAGGCTGAGGAGGGAGGATGG + Intronic
902346043 1:15818435-15818457 GGGAGGCTGAGGGGGGAAGATGG + Intergenic
902638133 1:17748348-17748370 GTGGCGAGGTGGAGGTAAGATGG + Intergenic
902982358 1:20134118-20134140 GAGAGGATGAGAAGGAAAGAGGG - Intergenic
902993675 1:20207227-20207249 GGTGGGATGTGGAGGGAGGAGGG - Intergenic
903026143 1:20430962-20430984 GAGAGGAGGTGGAGAGGAGACGG - Intergenic
903076282 1:20769451-20769473 GGGAGGCTGAGGTGGGAAGACGG + Intronic
903186141 1:21630371-21630393 GGGAGGCTGAGGAGGGAGGATGG - Intronic
903187895 1:21639697-21639719 GTGCGGATGTGGAGTGAGCAAGG + Intronic
903284835 1:22270074-22270096 GTGAAGCTCTGGAGGGAACATGG - Intergenic
903815196 1:26059746-26059768 GTGAGACTGTTGAGGGCAGAAGG - Intronic
904128374 1:28258714-28258736 GAGAGTGTCTGGAGGGAAGAGGG + Intergenic
904441656 1:30535722-30535744 GTGAGGGTGGGGAAGGGAGAGGG + Intergenic
904910991 1:33934084-33934106 GTGTGCATGTGGCAGGAAGAAGG + Intronic
905090773 1:35429736-35429758 TTGAGGCTTTGGAGGGAACAAGG + Intergenic
905204410 1:36334930-36334952 GTGAGGAGGAGAAGGGAAGGAGG - Intergenic
905595509 1:39203305-39203327 GGGAGGCTGAGGTGGGAAGATGG - Intronic
906509079 1:46400881-46400903 GTGAGGAAGGGAAGGGGAGAAGG + Intronic
907252202 1:53146892-53146914 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
907324437 1:53627756-53627778 GAGAGGAGGTGGAGGGGAGGAGG + Intronic
907339783 1:53726699-53726721 GGGAGGTTGGGGAGGGAGGAGGG - Intronic
907797184 1:57729394-57729416 GAGAGGATGTGGCGGGCAGCGGG - Intronic
908127352 1:61044157-61044179 GAGAGGATGGGAAGGGAAGGAGG + Intronic
908135564 1:61128497-61128519 GGGAGGCTGAGGTGGGAAGATGG + Intronic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
908391416 1:63686913-63686935 ATGAAGAAGTGGATGGAAGAAGG - Intergenic
908434981 1:64096877-64096899 GTGAGGTTGTGGAGAAAAAAAGG - Intronic
908658799 1:66416537-66416559 GTGAGGAGGTGGGGAGAAGAGGG - Intergenic
908680802 1:66659047-66659069 ATGAGGATGGGAAGGGAAGTTGG + Intronic
908999471 1:70201061-70201083 GACAGGCTGAGGAGGGAAGATGG + Intronic
909044939 1:70698540-70698562 ATGAATCTGTGGAGGGAAGATGG + Intergenic
909152898 1:72031299-72031321 GGGAGGAAGTGGATGTAAGATGG + Intronic
909320448 1:74279241-74279263 GTGAGCCTGTGGTGGGAAGGAGG - Intronic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
909442762 1:75716364-75716386 GGGAGGCTGAGGAAGGAAGATGG + Intergenic
909891281 1:81010259-81010281 GTGACGATGTAGCAGGAAGATGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
910067092 1:83167249-83167271 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
910107622 1:83648402-83648424 GTGAGTATGTGAAGGAGAGAGGG + Intergenic
910130700 1:83902058-83902080 ATGGGAATGTGGTGGGAAGATGG - Intronic
910977699 1:92924609-92924631 GTGAGAAGGTGGGTGGAAGAAGG + Intronic
910992821 1:93073527-93073549 GGGAGACTGAGGAGGGAAGATGG - Intergenic
910996128 1:93106065-93106087 ATGAGGAGGTGGTGGGAAGGGGG + Intronic
911344622 1:96681526-96681548 GTGAGGAAGAGGAGGAAGGAAGG - Intergenic
911574465 1:99558342-99558364 GGGAGGCTGAGGCGGGAAGATGG - Intergenic
911649939 1:100376498-100376520 GGGATGATGTGAAGGAAAGATGG + Intronic
911653018 1:100411091-100411113 GTGAGGATGGGGAGTGGAGAAGG - Intronic
911950167 1:104163269-104163291 GGGAGGCTGTGGGGGGAGGAGGG + Intergenic
912088847 1:106044704-106044726 GTAAGGATGTGGAGAGAAAAAGG + Intergenic
912258984 1:108090205-108090227 GCAAGGATGGGGAGGGAAGGAGG - Intergenic
912370168 1:109167712-109167734 GGGAGGTTGAGGTGGGAAGATGG - Intronic
912398349 1:109366798-109366820 GGGAGGCTGAGGTGGGAAGATGG + Intronic
912506734 1:110161753-110161775 GGGAGGAGGAGAAGGGAAGAGGG - Intronic
912616326 1:111103333-111103355 TTGAAGAAGTGGAGTGAAGAAGG - Intergenic
912703454 1:111895207-111895229 GTGAGGACGGAGAGGGAGGAGGG + Intronic
912706787 1:111920664-111920686 GAGTGGATGAGGAGGGAAGTAGG - Intronic
912774941 1:112500665-112500687 GGGAGACTGAGGAGGGAAGATGG + Intronic
912814134 1:112815451-112815473 GTGAAGGTGAGGAGGGGAGAAGG - Intergenic
912861347 1:113216583-113216605 GTGAGGATGTTCAGAGGAGAGGG + Intergenic
912875584 1:113355359-113355381 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
912887427 1:113489484-113489506 GTGACCATTTGGAGGAAAGAAGG - Intronic
913063913 1:115232255-115232277 ATGGGGATGGGGAGGGCAGAGGG + Intergenic
913144373 1:115975773-115975795 GTTAGGAGGTGGAGGCATGAGGG + Intergenic
913262338 1:117010900-117010922 CTGAGGATGTGGTGGGAAAGAGG - Intronic
913415733 1:118604639-118604661 GGGAGGCTGAGGCGGGAAGATGG + Intergenic
913528295 1:119713858-119713880 GTGGGGATAGGGAGGGATGAGGG + Intronic
913971875 1:143422603-143422625 GGGAGGATGTCGAGGGGAGGAGG + Intergenic
914066254 1:144248216-144248238 GGGAGGATGTCGAGGGGAGGAGG + Intergenic
914112899 1:144718138-144718160 GGGAGGATGTCGAGGGGAGGAGG - Intergenic
914837238 1:151217684-151217706 GTGAGGCTGAGGTGGGAAGATGG - Intronic
915294159 1:154908470-154908492 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
915355513 1:155253441-155253463 GGGAGGATGAGAAGGGGAGATGG - Intronic
915511816 1:156390799-156390821 GTGAGGAATTGCAGGGAGGAGGG - Intergenic
915586006 1:156844364-156844386 GTGAGGATGGGGAGGGATGCGGG + Intronic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
915841085 1:159213568-159213590 GGGAAGAAGTGGAGGGAGGAAGG + Intergenic
915923714 1:159999336-159999358 GAGAGGTTGAGGAGAGAAGAGGG - Intergenic
916098114 1:161369280-161369302 ATGAGGATTTTGGGGGAAGAAGG - Exonic
916141392 1:161702408-161702430 GTGAGAATGTTTACGGAAGAGGG + Intergenic
916242920 1:162657820-162657842 GTGGGGAGGGGAAGGGAAGAAGG - Intronic
916689894 1:167180125-167180147 GGGAGGCTGTGGTGGGAGGATGG + Intergenic
917322387 1:173796792-173796814 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
917658854 1:177157417-177157439 GGGAGGCTGAGGTGGGAAGATGG - Intronic
917737192 1:177932196-177932218 GTGAAGACGTGGAAAGAAGATGG + Intronic
918076700 1:181176110-181176132 GCGGGAATGTGGAGGGAAGATGG + Intergenic
918147739 1:181772342-181772364 GTGGGGGTGTGGAGAGAGGAGGG - Intronic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
918693856 1:187517543-187517565 ATGAGGTTGTGAAGGGAAAATGG - Intergenic
919009583 1:191942767-191942789 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
919167618 1:193916057-193916079 GTGAGAGTGTGGAGGGAAGTAGG - Intergenic
919470678 1:197975645-197975667 GTAAGGTTCAGGAGGGAAGATGG - Intergenic
919518480 1:198556847-198556869 GTGAAGATGGGATGGGAAGATGG + Intergenic
919693071 1:200544735-200544757 GTGAGGAAGGGGAGGGAGGGAGG + Intergenic
919787861 1:201271309-201271331 GTGGAGATGGGGTGGGAAGATGG + Intergenic
919840414 1:201605216-201605238 GAGAGGATGGAGAGGGAAGGTGG - Intergenic
920025321 1:202989870-202989892 GGGAGGCTGTGGTGGGAGGATGG - Intergenic
920302367 1:204996876-204996898 GTGAGGATGAGACGGGAAGGGGG - Intronic
920441643 1:205984867-205984889 GGGAGGAGGGAGAGGGAAGAAGG - Intronic
920541184 1:206779272-206779294 GTGAGGATGTGGGGGTAGAAAGG - Intergenic
920678518 1:208055405-208055427 CTGAGGATGGGGAGAGATGAAGG + Intronic
920820836 1:209379197-209379219 TTGGGGATGTGGAGGGGAGGAGG + Intergenic
920855204 1:209656231-209656253 GTGAGGGTGGGGAGAGGAGAAGG - Intergenic
920948789 1:210553800-210553822 GAGAGGAAGAGGTGGGAAGAGGG - Intronic
921204722 1:212838804-212838826 GGGAGGCTGAGGTGGGAAGATGG - Intronic
921301359 1:213754236-213754258 GTGAGGACGTAGAGAGAAGACGG - Intergenic
921618877 1:217304605-217304627 GCTAGGAGGTGGGGGGAAGAGGG - Intergenic
921883825 1:220283716-220283738 GTGATGGTGGGGAGGGAGGAAGG - Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922079336 1:222279628-222279650 TTGAGACTGTGGAGGGAACATGG + Intergenic
922209974 1:223479173-223479195 GTGAGGAGGTGGGGGGGAGGGGG + Intergenic
922322443 1:224500566-224500588 GGGAGGCTGAGGAGGGAGGATGG + Intronic
922477657 1:225917835-225917857 GGGAGGCTGAGAAGGGAAGATGG - Intronic
922614145 1:226951228-226951250 CTGAGAAAGTGGAGGGATGAAGG + Intronic
922716717 1:227879479-227879501 GTGACAAGGAGGAGGGAAGAAGG + Intergenic
922825850 1:228517921-228517943 AGGAGGAGGAGGAGGGAAGAAGG - Intergenic
923071587 1:230570111-230570133 GTGAGGATATGGAGAGAAATTGG - Intergenic
923236421 1:232037536-232037558 GTGAGGCTGTGGATGGATCAGGG + Intronic
923334182 1:232952613-232952635 GGGAGGCTGAGGTGGGAAGATGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923469471 1:234277952-234277974 GGGAAGCTGAGGAGGGAAGATGG + Intronic
923518987 1:234721516-234721538 GTCAGGATGGGAAGGGAAGTTGG - Intergenic
923805248 1:237250587-237250609 CTGAGAATGGGAAGGGAAGACGG - Intronic
924078670 1:240369136-240369158 GGCAGGAGGTGGAGGGAAGTGGG - Intronic
924226480 1:241926393-241926415 GTGGGGATGTGGAGGGAAAAAGG - Intergenic
924256901 1:242191814-242191836 GAGAGAATGAGGAGGGAAGGAGG + Intronic
924330321 1:242935031-242935053 GTGAGGAAGGGGAGTGATGAAGG - Intergenic
924474998 1:244375133-244375155 GGGAGGTTGTGGTGGGAGGAGGG + Intronic
1062833580 10:622264-622286 GGGAGGAGGGGGAGGGAGGAGGG + Intronic
1063503820 10:6579280-6579302 TGGAGAAGGTGGAGGGAAGAGGG - Intronic
1063522861 10:6757036-6757058 GTGGGGGTGTGGAGGGACAAGGG + Intergenic
1063538211 10:6906105-6906127 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1063866131 10:10367314-10367336 GTGGGGAAGCGGAGGGAAGAGGG - Intergenic
1064047775 10:12033426-12033448 AGGAGGATGTGGTGGGAGGATGG + Intronic
1064114752 10:12568302-12568324 GAGAGGAGGTGGAGGGGAGGGGG - Intronic
1064273116 10:13882656-13882678 GTGAGGATGAAGAGGGCACATGG - Intronic
1064534958 10:16349313-16349335 TTCAAGATGAGGAGGGAAGAGGG - Intergenic
1064627243 10:17273848-17273870 GAGAGGAGGAGGAGGGAAGAAGG - Intergenic
1064629968 10:17300133-17300155 GAGAGGCTGAGGAGGGAGGATGG + Intergenic
1065236150 10:23654621-23654643 GGGAAGATGTGGAGAGAATACGG + Intergenic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1065396037 10:25239073-25239095 GGGAGGATGTGGAGAGTACATGG + Intronic
1065504585 10:26416481-26416503 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1065759973 10:28973363-28973385 GGGAGGATGAGGTGGGAGGAAGG - Intergenic
1065855181 10:29824349-29824371 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1065960398 10:30729577-30729599 GAGAGGCTGAGGAGGGAGGATGG - Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066093510 10:32050181-32050203 GTGGGGATGTGGAGGGTAGTAGG - Intronic
1066440199 10:35431334-35431356 GGGAAGATGTGGGGGGAGGAGGG - Intronic
1066731263 10:38439068-38439090 ATGAGAGTGTGGAGGGAAGGGGG + Intergenic
1066761679 10:38760441-38760463 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1066959908 10:42211980-42212002 ATGAGGCTGAGGTGGGAAGATGG + Intergenic
1067056606 10:43056275-43056297 TTGCGGATGTGAAGGGAAGCTGG - Intergenic
1067322004 10:45230018-45230040 TTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1067386016 10:45818202-45818224 GTGAGGATGTGGAGGTTGAAAGG + Intergenic
1067399717 10:45959954-45959976 GTGAGGAACTGGAGAAAAGATGG - Intergenic
1067449051 10:46370253-46370275 GTGAGGATGTGGAGGTTGAAAGG - Intronic
1067508848 10:46878348-46878370 GAGAGGAGGTGGAGGGGAGGGGG + Intergenic
1067523827 10:47026737-47026759 GTGGGGAGGGGGAGGGCAGAGGG + Intergenic
1067588318 10:47490512-47490534 GTGAGGATGTGGAGGTTGAAAGG + Intronic
1067635443 10:47998603-47998625 GTGAGGATGTGGAGGTTGAAAGG + Intergenic
1067653401 10:48173502-48173524 GAGAGGAGGTGGAGGGGAGGGGG - Intronic
1067702705 10:48585268-48585290 GTGAGGATGTGGAGGTTGAAAGG - Intronic
1067868045 10:49929248-49929270 GTGAGGAACTGGAGAAAAGATGG - Intronic
1068939993 10:62671257-62671279 GCAAGGAAGTGGTGGGAAGAAGG + Exonic
1068997670 10:63225989-63226011 GAGTGTATGTGGAGGGAAGGGGG - Intronic
1069041422 10:63699476-63699498 GTGTGGAAGTGGAGAGGAGAGGG + Intergenic
1069089286 10:64179927-64179949 GGGAGGAGGTGGGGCGAAGAGGG + Intergenic
1069400715 10:68042516-68042538 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1069414149 10:68183355-68183377 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1069415367 10:68195905-68195927 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1069746334 10:70717274-70717296 GTGGGGTTGTGGAGAGAGGAGGG + Intronic
1069930798 10:71880433-71880455 GTGGAGAGGTGGAGGGGAGAAGG - Intergenic
1069933794 10:71901196-71901218 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933801 10:71901215-71901237 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933808 10:71901234-71901256 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1070049429 10:72872881-72872903 GTGAGGATGTGGAGAAATGCTGG - Intronic
1070086643 10:73244390-73244412 GGGAGGCTGAGGTGGGAAGATGG + Exonic
1070269376 10:74938048-74938070 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1070295835 10:75160725-75160747 GTGAGGTTGTGGGTGGAAGGTGG + Intronic
1070756469 10:78996635-78996657 GTGGTGATGTGGAGGGGAGGAGG - Intergenic
1070892923 10:79955543-79955565 GTGAGGTTGTGGTGGAGAGAGGG - Intronic
1070962973 10:80511888-80511910 GGGAGGTTGAGGTGGGAAGATGG - Intronic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1071345041 10:84684650-84684672 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1071399705 10:85257254-85257276 GATTGGATGTGGAGGGCAGAGGG - Intergenic
1071543795 10:86511824-86511846 GGGAGGCCGAGGAGGGAAGATGG + Intronic
1071755021 10:88527665-88527687 GTGTATATGTGGGGGGAAGAGGG - Intronic
1071843529 10:89498225-89498247 GTGGGGGTGAGGTGGGAAGATGG + Intronic
1072032754 10:91537080-91537102 GGGAGGATCAGGAGGGCAGAGGG + Intergenic
1072034370 10:91551051-91551073 GAGAGGCTGTGGTGGGAGGATGG - Intergenic
1072078903 10:92008446-92008468 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1072587251 10:96793560-96793582 GGGAGGCTGTGGTGGGAGGATGG + Intergenic
1072802781 10:98404992-98405014 GTGAGGGAGGGGAGGGAGGATGG + Intronic
1073073861 10:100811130-100811152 GAGAGGTGGGGGAGGGAAGATGG + Intronic
1073147789 10:101291996-101292018 GTGAGGACGGGGAGGGGGGAAGG - Intergenic
1073232422 10:101983384-101983406 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1073357391 10:102868199-102868221 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1073394021 10:103203457-103203479 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1073481563 10:103789170-103789192 GGGAGGATGGGGGGGGTAGAAGG + Intronic
1073860424 10:107732270-107732292 GGGAGGTTGTGGTGGGAGGAAGG + Intergenic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1074389281 10:113043594-113043616 GGGAGTATGGGGAAGGAAGAAGG - Intronic
1074585310 10:114762618-114762640 GTAAGGGTGAGGAGGGAAGGTGG - Intergenic
1074585703 10:114766476-114766498 CTGAGGATGTGAAATGAAGATGG - Intergenic
1074902718 10:117833027-117833049 GTGGGGAGGGGGAGGGAGGAGGG - Intergenic
1074960725 10:118443002-118443024 GGGAGGCTGTGGCGGGTAGATGG + Intergenic
1075199715 10:120392356-120392378 GTGGGGAAGTGGAGGCAACAGGG + Intergenic
1075265562 10:120997529-120997551 GTGAGAAGGTGCAGGGAAGAAGG - Intergenic
1075492648 10:122885959-122885981 ATGAGGTTGAGGAGGCAAGAAGG - Intergenic
1075578501 10:123598237-123598259 GTGAGGATCTGAAGGCCAGAGGG - Intergenic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076290695 10:129343399-129343421 GTAGGGAGGTGGAAGGAAGATGG - Intergenic
1076386190 10:130057659-130057681 GTCAGCATGTGGATGGCAGAGGG + Intergenic
1076817425 10:132921737-132921759 GTGAGGATGCGGGGAGGAGATGG + Intronic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077307986 11:1876433-1876455 GGGAGGATGTCGAGGGGAGGGGG - Intronic
1077343763 11:2037281-2037303 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1077355343 11:2114271-2114293 GTGAGGTGGTGGAGGGTGGAGGG - Intergenic
1077884181 11:6373877-6373899 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1077917686 11:6621971-6621993 GTGAGAAGCTGGTGGGAAGATGG + Exonic
1077955357 11:7013533-7013555 GTGAGAATGTGGAGGTCAAAAGG - Intronic
1078248761 11:9600147-9600169 GGGAGGATGAGGTGTGAAGATGG - Intergenic
1078444787 11:11395974-11395996 GTGGAGATGGGGAGGGGAGAGGG + Intronic
1078540447 11:12209155-12209177 GGGAGAATGTGAAGAGAAGATGG + Intronic
1078657186 11:13252671-13252693 GTGAGAATGGGAAGGGAGGATGG + Intergenic
1078738102 11:14040027-14040049 GTGAGGATATGGAGGAAATTAGG + Intronic
1078931860 11:15918747-15918769 GAGAGTGTGTGCAGGGAAGAGGG - Intergenic
1079023318 11:16925908-16925930 CTGAGGAGGGGGAGGGAAAAGGG + Intronic
1079255202 11:18821906-18821928 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
1080084344 11:28259932-28259954 GTGAGGAAGAGGAGTCAAGAAGG - Intronic
1080528495 11:33150749-33150771 GGGAGGATGAGGTGGGAGGATGG + Intronic
1080614339 11:33932961-33932983 GAGAGGAAATGGAGGGCAGAGGG - Intergenic
1081031373 11:38088507-38088529 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1081132671 11:39399682-39399704 CTGATGATGGGGAGGTAAGAGGG + Intergenic
1081177593 11:39947533-39947555 GTGATCATTTGGAGGAAAGAGGG - Intergenic
1081654977 11:44851139-44851161 GTGAGTGCGTGGAGAGAAGAGGG + Intronic
1081747702 11:45484537-45484559 GGGAGGAAGTGGAGGGAAAGAGG + Intergenic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1082757807 11:57095423-57095445 GTATTGATGTGGAGGGAGGAGGG + Intergenic
1082785618 11:57314678-57314700 GGGAGGACGTGGAGAGAAGAGGG + Intronic
1083235564 11:61348630-61348652 GTGAGGTTATGGTGAGAAGATGG + Exonic
1083273845 11:61586096-61586118 GTGAGGGTGAGGTGGGAATATGG - Intergenic
1083482930 11:62961242-62961264 GTGAGGACATGGTGGGAAGGCGG + Intronic
1083704100 11:64501285-64501307 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1083857728 11:65401369-65401391 GGGAGGCTGGGGAGGGAAGCAGG - Intronic
1083865006 11:65448931-65448953 GTCAGCAGGAGGAGGGAAGATGG - Intergenic
1083891480 11:65597964-65597986 GAGGGGAGGTGCAGGGAAGAGGG - Exonic
1083923087 11:65790888-65790910 GGGAGGATGGCGAGGGAAGCTGG + Intronic
1084312969 11:68327245-68327267 GTGAGGAAATGGAACGAAGAGGG - Intronic
1084402660 11:68954132-68954154 GGGAGGATGAGGTGGGAGGATGG + Intergenic
1084424072 11:69074984-69075006 GTGATGATGTGGAGGAAGGGCGG + Intronic
1084668006 11:70586912-70586934 GTGAGGTGGGGGAGGGAAGAGGG - Intronic
1084670402 11:70603426-70603448 GTCAGGATGTGGAGGGACACTGG - Intronic
1085056299 11:73406078-73406100 GTGGGGAAGGAGAGGGAAGAAGG - Exonic
1085068911 11:73523686-73523708 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1085117110 11:73939078-73939100 GTGAGGATGTGGGGGTAGAAAGG + Intergenic
1085206295 11:74734259-74734281 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1085421926 11:76370140-76370162 GTTAGGTTTTGGGGGGAAGAGGG - Intronic
1085471126 11:76758776-76758798 GAGAGGGTGTGGAGTGAGGAAGG + Intergenic
1085592641 11:77778204-77778226 GAGAGGATGGGGAGGGGAGGGGG + Intronic
1085620279 11:78032655-78032677 GAGAAGATGTGGAGGAAAGAGGG - Intronic
1085908095 11:80788809-80788831 GTGAGGATATGGAAAGAAGGTGG - Intergenic
1086748110 11:90455719-90455741 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1086875243 11:92087928-92087950 GTGAGGAGGGAGAGGAAAGATGG - Intergenic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087524241 11:99287851-99287873 GGGAGGATGTGGAGGAATAAAGG + Intronic
1087624373 11:100580243-100580265 TTAAGGGTGTGTAGGGAAGAAGG - Intergenic
1088140490 11:106609910-106609932 GTGTGGAAGTAGTGGGAAGAAGG - Intergenic
1088276428 11:108091449-108091471 GGGAGGCTGAGGAGGGCAGATGG + Intronic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088356773 11:108952317-108952339 GGGAGGCTGTGGTGGGAGGAAGG + Intergenic
1088537042 11:110872652-110872674 GTCTGGATGTGGGGGTAAGATGG - Intergenic
1088789382 11:113211046-113211068 AGGAGGATGAGAAGGGAAGATGG - Intronic
1088884121 11:113993896-113993918 ATGAGGCTGTGGTGGGGAGACGG + Intergenic
1089085628 11:115814822-115814844 GAGACCATGTGGAGGGAGGAGGG - Intergenic
1089259352 11:117212816-117212838 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1089282617 11:117384991-117385013 GTGAGGATTTCCAGAGAAGAGGG + Intronic
1089500147 11:118927192-118927214 GTGAGGAGGGGCAGGGGAGAGGG - Intronic
1089690292 11:120182896-120182918 GGGAGGATGTGGCAGGAGGAGGG + Intronic
1089821952 11:121236726-121236748 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1089843358 11:121438443-121438465 GTGAGAATGTAGAGGGAGGGTGG - Intergenic
1090013695 11:123066506-123066528 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1090761468 11:129840408-129840430 ATGAGGAAGTGCAGGGAGGAGGG + Intronic
1090888207 11:130898041-130898063 TTGATGATGTGGAGAGAAGTGGG - Intronic
1091070514 11:132558409-132558431 GGGAGGAGGAGGAGGGGAGAAGG - Intronic
1091124406 11:133082518-133082540 GAGAGGATGAGGAGGGGAGGAGG - Intronic
1091304889 11:134530579-134530601 ATGCGGACGGGGAGGGAAGAGGG - Intergenic
1202826749 11_KI270721v1_random:92470-92492 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1091377255 12:33029-33051 GTGAGGATGCGAAGAGAAGGTGG + Intergenic
1091388755 12:112286-112308 GTGGGGAAGTGGGGGGAAGGGGG + Intronic
1091555351 12:1569341-1569363 GTGGGGTTGAAGAGGGAAGAAGG - Intronic
1091577729 12:1754612-1754634 GGGAGGATGGGGTGGTAAGAAGG + Intronic
1091733370 12:2898402-2898424 GGGAGGCTGAGGCGGGAAGATGG - Intronic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1091962860 12:4713384-4713406 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1092085793 12:5758416-5758438 GTGGGGCTGTGGAGGGAAATAGG - Intronic
1092229699 12:6769712-6769734 GAGATGATTGGGAGGGAAGATGG - Intronic
1092451121 12:8603217-8603239 GGGAGGTTGAGGAGGGAGGATGG - Exonic
1092495961 12:8995463-8995485 GTGGGGAGGGAGAGGGAAGAAGG - Intronic
1092509938 12:9144212-9144234 GTGAGGATGAGGGAGGAGGAGGG + Intergenic
1092798202 12:12135316-12135338 GTGAGGATGGGGAGAGGAGGGGG + Intronic
1092955232 12:13543385-13543407 GTGAGGATTTTTAGGGAAGGAGG - Exonic
1092973886 12:13725320-13725342 AGGAGGATGTGCAGGTAAGAGGG + Intronic
1093106118 12:15089732-15089754 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1093302332 12:17472407-17472429 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1093348826 12:18071656-18071678 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1093497868 12:19778705-19778727 GTGGGCATTTGGAGGAAAGAAGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094168263 12:27464610-27464632 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1094196767 12:27757904-27757926 GGGAGGCTGTGGTGGGAGGATGG + Intergenic
1094552713 12:31468147-31468169 GGGAGGTTGAGGTGGGAAGATGG + Intronic
1094620570 12:32076678-32076700 GGGAGGATGAGGTGGGCAGATGG - Intergenic
1094631585 12:32180660-32180682 GTGAGGATTAGGAAAGAAGAAGG - Intronic
1094802047 12:34048412-34048434 GTGAGGATGTGGGGGTAGAAAGG - Intergenic
1095251944 12:39989312-39989334 TTGAGGATATTGAGGCAAGAGGG - Intronic
1095753876 12:45741300-45741322 GGGAGGCTGTGGTGGGAGGATGG - Intronic
1095818867 12:46455101-46455123 TGGAGGCAGTGGAGGGAAGATGG - Intergenic
1095884588 12:47175963-47175985 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1096245202 12:49980971-49980993 AGGAAGATGGGGAGGGAAGAAGG + Intronic
1096556083 12:52404857-52404879 GTGAGGAAGGGGAGGAATGACGG - Intronic
1096673869 12:53216000-53216022 GTTAGACTGTGGAGGGTAGAGGG - Intronic
1096870815 12:54590940-54590962 GAGAGGAGGGAGAGGGAAGAGGG + Intergenic
1097008011 12:55932474-55932496 GAGAGGATGGGGTGGGAAGTTGG - Intronic
1097190586 12:57217581-57217603 GTGAGGTCGTGCAGGGGAGATGG - Intronic
1097214981 12:57403705-57403727 GTGAGGCTGAGGTGGGAGGAGGG + Intronic
1097215183 12:57405527-57405549 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1097655920 12:62363386-62363408 GTGAGGGTGAGGATGGAACAAGG - Intronic
1097728070 12:63097165-63097187 GAGAGAATGTGGAGGCTAGAAGG + Intergenic
1097874909 12:64634027-64634049 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1098174953 12:67780788-67780810 GTGACTATGTAGAGGAAAGATGG - Intergenic
1098959385 12:76723410-76723432 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1099148060 12:79073204-79073226 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1099795141 12:87391017-87391039 GTGATAATGTGAAGGGAATATGG - Intergenic
1100388926 12:94130046-94130068 GTGGGGTTGGGGAGGGAGGAGGG - Intergenic
1100535319 12:95503438-95503460 GTGAGGGAGTGGAGGGGAAAGGG + Intronic
1100595478 12:96068237-96068259 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1101087887 12:101254807-101254829 GGGTGGATGTGGAGAGAACATGG + Intergenic
1101242017 12:102848351-102848373 CTGAAGAGGTGGAGGGTAGACGG + Intronic
1101479776 12:105085087-105085109 GGGAGGCCGAGGAGGGAAGATGG + Intergenic
1101619596 12:106372224-106372246 GTGAGGAAGGGGAGAGAAGGAGG - Intronic
1102016333 12:109650356-109650378 GAGAGGCTGAGGAGGGCAGATGG + Intergenic
1102230375 12:111257662-111257684 GGGAGGAAGAGGGGGGAAGAGGG - Intronic
1102503149 12:113366779-113366801 GAGAGGAGGAGGAGGGAAGGAGG - Intronic
1102732096 12:115120631-115120653 TTGAGGGTGGGGGGGGAAGAGGG + Intergenic
1102792344 12:115657926-115657948 ATGAGGAGGAGGGGGGAAGATGG - Intergenic
1102832510 12:116017718-116017740 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1103080426 12:118019609-118019631 CTGAGGATCAGGAAGGAAGAAGG - Intronic
1103185620 12:118954656-118954678 GAGAGGATGAGGAGGGGACAAGG + Intergenic
1103202251 12:119097252-119097274 GTGGGGCTGTGGAGGGCTGAGGG + Intronic
1103435563 12:120922797-120922819 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1103583809 12:121936340-121936362 GGGAGGCTGAGGCGGGAAGATGG + Intronic
1103649355 12:122421664-122421686 GTGGGGCTGTGCAGGGAGGAGGG + Intronic
1103857696 12:123984953-123984975 GTGAGAATGTGCAGGGAACTGGG + Intronic
1103960421 12:124605942-124605964 GTAGGGAAGAGGAGGGAAGAGGG - Intergenic
1104609214 12:130214896-130214918 GAGAGCATCTGGAAGGAAGAGGG + Intergenic
1104638789 12:130454155-130454177 GTGAGGATGTGGATAGGAGGTGG + Intronic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1105234538 13:18536520-18536542 GTGAGGATGTAAAGAAAAGACGG - Intergenic
1105446542 13:20462095-20462117 GAGAGGATGGGGTGGGAGGATGG + Intronic
1105544117 13:21339435-21339457 GGGAGGGTGAGGAGGGAAAATGG - Intergenic
1105862974 13:24433244-24433266 GTGAGAATGTGGAGGTCAAAAGG - Intronic
1106045288 13:26134182-26134204 GAGACGATGTGGATGGCAGAAGG - Intronic
1106117464 13:26829858-26829880 GTGGGGCTGGGGAGGGGAGATGG + Intergenic
1106176775 13:27338521-27338543 GTGGGGATGTGGAGGGCATGAGG - Intergenic
1106456370 13:29930752-29930774 GGGAGGATATAAAGGGAAGAGGG + Intergenic
1106506651 13:30376342-30376364 ACAAGGATGTGGAGGGAAGGGGG + Intergenic
1107312496 13:39094114-39094136 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1107379880 13:39845399-39845421 GTGTGGATCTGTAGGGAAAATGG + Intergenic
1107733408 13:43370920-43370942 GGGAGGAGGCGGAGGGAGGAAGG - Intronic
1107851667 13:44577415-44577437 CGGAGGAGGAGGAGGGAAGATGG + Intergenic
1107944843 13:45408948-45408970 GTGAGGATAGGCAGAGAAGAAGG - Exonic
1108199815 13:48032040-48032062 GTGAGGATGTGGAGGTTGAAAGG + Intergenic
1108626721 13:52236227-52236249 GTGGGGGTGTGGGAGGAAGATGG - Intergenic
1108659347 13:52570258-52570280 GTGGGGGTGTGGGAGGAAGATGG + Intergenic
1108875111 13:55037724-55037746 GTGAGGAAGTTGAGGAAAGATGG + Intergenic
1109272703 13:60272238-60272260 GTGTGGATTTTGAGGGAAGCTGG - Intergenic
1109606473 13:64704525-64704547 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
1109607049 13:64709258-64709280 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
1109644322 13:65233653-65233675 GTGAGGATGTGGAGAACAAAAGG - Intergenic
1109775254 13:67032246-67032268 GCGAGGTTGAGGTGGGAAGATGG - Intronic
1109909776 13:68893753-68893775 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
1110641517 13:77830182-77830204 GGGAGGGAGGGGAGGGAAGAAGG - Intergenic
1110641536 13:77830223-77830245 GGGAGGGAGGGGAGGGAAGAAGG - Intergenic
1111032062 13:82614255-82614277 GAGAGGCTGAGGTGGGAAGATGG + Intergenic
1111198970 13:84909288-84909310 GTGAGGCTGTGGAGAGAAATAGG + Intergenic
1111773023 13:92623059-92623081 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1111797045 13:92935064-92935086 ATGAGGATTTGGAGGGAGAAGGG + Intergenic
1111847713 13:93532668-93532690 GTGAGGATGAGCATAGAAGAAGG - Intronic
1111962287 13:94824849-94824871 GAGAGGCTGAGGTGGGAAGATGG - Intergenic
1112358722 13:98696933-98696955 GTGAGGACCTAGAGGGAAGGTGG + Intronic
1112598247 13:100829915-100829937 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
1113541405 13:111112587-111112609 GTGAGGAAGGGGAGTGAAGCAGG - Intergenic
1113634102 13:111908349-111908371 GTCAGGATGTGGGCTGAAGAAGG - Intergenic
1114069540 14:19096602-19096624 GTGAGTGTGTGGGGGGGAGAGGG + Intergenic
1114092722 14:19303401-19303423 GTGAGTGTGTGGGGGGGAGAGGG - Intergenic
1114258965 14:21024331-21024353 GTGCTGATGTGGAGGTAAGAGGG + Exonic
1114263007 14:21052486-21052508 GGGAGGACTTGCAGGGAAGAGGG + Intronic
1114289607 14:21276959-21276981 GGGAGGGTGAGGTGGGAAGATGG - Intergenic
1114441002 14:22747528-22747550 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1114562386 14:23602798-23602820 GTGAGAATGTGGTGGGAAAGAGG - Intergenic
1115241477 14:31254559-31254581 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116427334 14:44807018-44807040 GAGGGGAAGGGGAGGGAAGAAGG + Intergenic
1116637441 14:47415807-47415829 GTGAGGATGCAGCAGGAAGACGG - Intronic
1116898129 14:50337111-50337133 GGGAGGCTGAGGTGGGAAGACGG - Intronic
1117079020 14:52132585-52132607 GTGAGGAAGTGGAGGTCTGAGGG + Intergenic
1117398025 14:55330684-55330706 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1117831136 14:59752070-59752092 GTGTGGATGTGGAGGTTGGAAGG - Intronic
1118017375 14:61673928-61673950 GTGAGGAGGTGGAGGTGAAAGGG - Intergenic
1118036163 14:61869795-61869817 GTGAGGTTATGAAGAGAAGATGG + Intergenic
1118247793 14:64128256-64128278 GGGAGGATGTAGAGGGAAGAAGG + Intronic
1118284748 14:64461370-64461392 GTGAGGATGTGGAGGCAGGGAGG - Intronic
1118338008 14:64870979-64871001 ATGATGATGGGGAGGGATGATGG + Intronic
1118354079 14:64997357-64997379 ATAGGGATGTGGAAGGAAGATGG - Intronic
1118613313 14:67558136-67558158 GTGAGATTGTGAAGGGGAGAAGG - Intronic
1118963623 14:70559189-70559211 GGGAGGAGGTGGTGGGAGGAGGG - Intergenic
1119484277 14:74977960-74977982 GGGAGGATGTGGAGGGATAGAGG + Intergenic
1119500488 14:75122901-75122923 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1119568107 14:75646054-75646076 GTCAGAATGTGGAGGGAAAAGGG + Intronic
1119664323 14:76473693-76473715 GGAGGGAGGTGGAGGGAAGAAGG + Intronic
1119682500 14:76603396-76603418 GAGGGGATGTGGAGGGACTAAGG + Intergenic
1119688766 14:76654319-76654341 GGGAGGAGGTGGTGGGAACAGGG - Intergenic
1119867796 14:77988603-77988625 GTGGGGAGGTGGAGGCCAGATGG + Intergenic
1119869181 14:78000594-78000616 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1119905897 14:78301693-78301715 ATGAGGATGTTGAAGAAAGAAGG + Intronic
1120242603 14:81966647-81966669 GTGAAGATTTTGAGGGTAGAGGG + Intergenic
1120265480 14:82244124-82244146 GTGTGGATTTGGAGGAAGGATGG - Intergenic
1120963152 14:90143310-90143332 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1121004522 14:90480671-90480693 GGGAGGCTGAGGCGGGAAGAGGG - Intergenic
1121021806 14:90584792-90584814 GAGATGCTGTGGAGGGCAGAGGG + Intronic
1121234118 14:92379901-92379923 GTGAGGGTGGAGAGGGGAGAGGG - Intronic
1121277327 14:92677251-92677273 GGGAGGATGTGGTGGGAAGGAGG - Intronic
1121561089 14:94876148-94876170 GGGAGGCTGGGAAGGGAAGATGG - Intergenic
1121574463 14:94972197-94972219 GTGAGAATGCAGAGGGAAGAAGG + Intergenic
1122307444 14:100774701-100774723 GTGAGGCTGAGGCGGGAGGATGG - Intergenic
1122519517 14:102333686-102333708 GGGAGTCTGTAGAGGGAAGAAGG - Intronic
1122565823 14:102655048-102655070 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1122606048 14:102948228-102948250 GTGTGGAGGTGGAGGGGAGTCGG + Intronic
1122852187 14:104541771-104541793 GTGAGAATGTGGATGGACTAGGG + Intronic
1122874062 14:104655161-104655183 GGAAGGAAGGGGAGGGAAGAGGG + Intergenic
1123038416 14:105480614-105480636 GTGTGGCTGAGGAGGGAAGGGGG + Intergenic
1202879121 14_KI270722v1_random:41108-41130 GTGAGGATGTGGGGGTTAAAAGG - Intergenic
1123436645 15:20259377-20259399 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1123773518 15:23554021-23554043 GTGAGGATACAGAGAGAAGATGG + Intergenic
1123978087 15:25571557-25571579 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1124009541 15:25826455-25826477 GAGAGGCTGAGGTGGGAAGATGG + Intronic
1124031551 15:26016815-26016837 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
1124216736 15:27813348-27813370 GTGAAGAAGTGGATGGAAGTGGG - Intronic
1124354806 15:28986965-28986987 GTGAGGATGTAGTGAGAAGATGG - Intronic
1124389819 15:29244413-29244435 GTGAGGATTTACAGGGAAAAAGG - Intronic
1124710463 15:32005939-32005961 GTAAGGATCAGGAGTGAAGAAGG - Intergenic
1124789982 15:32718189-32718211 GTGAGTGGGCGGAGGGAAGAGGG + Intronic
1124791544 15:32731705-32731727 GTGAGGAGGAGGAGGAAAGGAGG - Exonic
1125102135 15:35926463-35926485 GGGAGGCAGTGGTGGGAAGATGG + Intergenic
1125124992 15:36209776-36209798 GTGAAGATAGAGAGGGAAGAAGG + Intergenic
1125251771 15:37713270-37713292 GTGAGGCTGTGCAGGGCAGTGGG - Intergenic
1125456518 15:39865552-39865574 GTGAGGAGGTGGAAGGAGGATGG + Intronic
1125542075 15:40475370-40475392 GTGAGGAAGAGGAGAGGAGAGGG + Intergenic
1125624847 15:41099675-41099697 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1126526001 15:49654934-49654956 GTGAGGATATAGCAGGAAGATGG - Exonic
1126593255 15:50360572-50360594 TTGGGGAGGTGGAGGGAATAAGG + Intergenic
1126938978 15:53744817-53744839 ATGAGGAAGTGGAGGAAAGGTGG + Intronic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1127680819 15:61296184-61296206 CTAAAGATGTTGAGGGAAGAAGG - Intergenic
1127946733 15:63763000-63763022 GTGAGAATGTGGAGGTCAAAAGG - Intronic
1127982920 15:64047169-64047191 GTGAGGGGGTGAAGGGAGGAAGG + Intronic
1128083209 15:64868567-64868589 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1128184896 15:65636475-65636497 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1128677822 15:69624691-69624713 GAGAGGAGAGGGAGGGAAGATGG - Intergenic
1128832729 15:70784682-70784704 GTGAGGAGGAGGTGTGAAGATGG - Intergenic
1129023080 15:72541121-72541143 GTGAGGATGTGGGGGTTAAAAGG + Intronic
1129155264 15:73713698-73713720 GGGAGGATGGGCAGGGGAGAGGG - Exonic
1129233179 15:74208098-74208120 GTGAGGAGGAGGAGGGTAGCCGG + Intronic
1129591665 15:76920579-76920601 CTGAGGATGTGGTGGAGAGAAGG - Intergenic
1129601972 15:77004393-77004415 GTGGGGATGTGGTGGCCAGATGG + Intronic
1129687837 15:77696590-77696612 GTGAGGATGAGGAGGATAGGGGG - Intronic
1130095215 15:80850666-80850688 TTGAAGGTGTGGAGGGAAGGGGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130261504 15:82357619-82357641 GGGAGGCTGAGGTGGGAAGACGG - Intergenic
1130279731 15:82511392-82511414 GGGAGGCTGAGGTGGGAAGACGG + Intergenic
1130510708 15:84587051-84587073 GAGAGGATGGGGAGGGGAAAAGG - Intergenic
1130512621 15:84601783-84601805 GGGAGGCCGAGGAGGGAAGATGG - Intronic
1130553735 15:84908660-84908682 GTGAGGCTGGGAAGGGAGGAGGG - Intronic
1130559229 15:84945469-84945491 GTTTGGATGTGGAGGGGAAACGG - Exonic
1130570569 15:85039459-85039481 GTGAGGATGTGGAGGAGAGAAGG + Intronic
1130631586 15:85574808-85574830 ATGAGGAAGTGCAAGGAAGATGG - Intronic
1130843967 15:87726930-87726952 GTGAGTCAGAGGAGGGAAGATGG + Intergenic
1130877588 15:88028039-88028061 GTGAGGGTGAGGAGGGAAAATGG + Intronic
1130971498 15:88737195-88737217 GGGAGGTTGAGCAGGGAAGATGG + Intergenic
1131077647 15:89505864-89505886 GGGAAGATGTGGAGGAAAGAAGG + Intergenic
1131085271 15:89570553-89570575 GTGAGGAAGTGATGGGAAGGAGG - Intergenic
1131850787 15:96541314-96541336 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1132177212 15:99725351-99725373 GTGAGAATGTGGAGGTCAAAAGG - Intronic
1132284712 15:100654509-100654531 GGGAGGCGGCGGAGGGAAGAAGG - Intergenic
1132449666 15:101959961-101959983 GTGAGGATGCGAAGAGAAGGTGG - Intergenic
1132718378 16:1303606-1303628 GGGACGACGTGGAGGGAATACGG + Intergenic
1132989995 16:2787452-2787474 GTGAGGACGAGGAGGGGTGAAGG - Intronic
1133034551 16:3027562-3027584 GTCAGGACCTGGAGGAAAGAGGG - Exonic
1133235543 16:4385787-4385809 GTGAGGATGAGGAGGGGACGGGG + Intronic
1133236806 16:4391181-4391203 GGGAGGCTGTGGTGGGAGGACGG + Intronic
1133279503 16:4657200-4657222 GTGAGGCTGCGGCAGGAAGAGGG - Intronic
1133332549 16:4984162-4984184 GTGGGGGTGTTGAGGGATGAGGG - Intronic
1133520249 16:6549432-6549454 GGGAGGAGGAGGAGGGAGGAGGG + Intronic
1133742170 16:8659963-8659985 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1133935668 16:10267332-10267354 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1134122781 16:11596656-11596678 GGGAGGATGTGGAGGGAAAAAGG + Intronic
1134155043 16:11836123-11836145 GTGAGAATGTGAAGGTCAGAAGG - Exonic
1134186453 16:12088704-12088726 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1134449313 16:14353997-14354019 GGGAGGAGGGGGAGGGAAGGAGG + Intergenic
1134523322 16:14928123-14928145 GAGAGGAGGAGGAGGGGAGAGGG - Intronic
1135053780 16:19213767-19213789 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1135093094 16:19537860-19537882 GGGAGGATGAGGTGGGAGGATGG - Intronic
1135164773 16:20129560-20129582 GGGGGGATGGGGAGGGAAGAAGG - Intergenic
1135465315 16:22679870-22679892 GAGAGGATGTGGAGCTAAGGAGG - Intergenic
1135621601 16:23960620-23960642 GTCAGAGTGGGGAGGGAAGAGGG - Intronic
1135694713 16:24575806-24575828 GGGAGGAGGGGGAGGGAGGAGGG + Intergenic
1135711571 16:24721700-24721722 GTGAGGCTGAGGTGGGAAGATGG + Intergenic
1135723324 16:24835150-24835172 GGGAGGATGAGGTGGGAGGATGG + Intergenic
1135788767 16:25374533-25374555 GTGAAGATCTGGTGGGAATAAGG + Intergenic
1135942439 16:26834264-26834286 GGGAGGAGGAGGAGGGAAGAAGG + Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136171625 16:28493404-28493426 GTGGGGCTGGGGAGGGGAGAAGG + Intronic
1136229474 16:28878139-28878161 GTGAGGCCGGGGATGGAAGAGGG + Intergenic
1136568910 16:31085304-31085326 GTGAGGATTTGATGGGAAGTGGG - Intronic
1136649915 16:31660318-31660340 GTGAGGATGTGGGGGTAGAAAGG - Intergenic
1137434676 16:48445655-48445677 GGGAGGATGAGGTGGGAGGATGG + Intronic
1137456095 16:48618965-48618987 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1137458747 16:48638593-48638615 ATGAGGACGTGGGGAGAAGACGG + Intergenic
1137557137 16:49477610-49477632 AAGAGGAGGAGGAGGGAAGAAGG + Intergenic
1137594649 16:49715638-49715660 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1137628913 16:49928339-49928361 GTGGGGATGTGGAGGGCCCAAGG - Intergenic
1137738955 16:50746140-50746162 GTGAGGCTGAGGTGGGAGGATGG - Intronic
1137774242 16:51042276-51042298 GTGAGGAAGTGAGTGGAAGAAGG - Intergenic
1137977926 16:53046578-53046600 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1138015926 16:53428671-53428693 GTGAGGATGAAGGGGCAAGAGGG + Intergenic
1138344964 16:56315061-56315083 GAAAGGATGAGGAGGCAAGAGGG + Intronic
1138499187 16:57428353-57428375 GTGAGCATTTAGAGGGAAGCAGG - Exonic
1138659306 16:58508247-58508269 GTGCTGCTGGGGAGGGAAGAGGG - Intronic
1138674002 16:58637751-58637773 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1139449006 16:67015526-67015548 GGGAGGCTGTGGCGGGCAGATGG + Intergenic
1139500238 16:67357512-67357534 GAGAGGAAGGGGAGGAAAGAGGG + Intronic
1139559963 16:67735654-67735676 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1140566512 16:76049063-76049085 GGGAGGCTGTGGTGGGAGGAGGG + Intergenic
1140992802 16:80230701-80230723 GTCAGGATGTGAAGAGAAGGCGG - Intergenic
1141034781 16:80617709-80617731 GTGAGGACGATGAGCGAAGATGG - Intronic
1141150968 16:81564499-81564521 GAGTTGATGTGGGGGGAAGAAGG + Intronic
1141155496 16:81593997-81594019 GGGAGGAAGAGGAGGAAAGAGGG - Intronic
1141560228 16:84862924-84862946 GTGGGGATGGGGATGGAAGAAGG + Intronic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141876174 16:86826091-86826113 GTGCTGATGTGGAGGTGAGAGGG + Intergenic
1142099649 16:88264563-88264585 AGGAGGATGTGGGAGGAAGATGG - Intergenic
1142119215 16:88377647-88377669 GGGAGGATGGGGAGTGAGGAAGG - Intergenic
1142168951 16:88610342-88610364 GTGAGCTTGCAGAGGGAAGAGGG + Intronic
1142354600 16:89596618-89596640 GTGAAGATGTGGAGGGCGTAGGG + Exonic
1142365838 16:89649214-89649236 GTGGGGAGGTTGAGGGAAGCTGG - Intronic
1142402939 16:89870500-89870522 GGGAGGAAGGGGAGGGAACAGGG + Exonic
1142666943 17:1468651-1468673 GTCAGGAAGTGGAGGGTTGATGG - Intronic
1142737983 17:1913656-1913678 GGGAGGCTGGGGAGGGAGGATGG + Intergenic
1142787532 17:2235852-2235874 GTGTGGAAGTAGAGGGGAGAAGG - Intronic
1142857655 17:2740859-2740881 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1142958237 17:3535425-3535447 GTGAGGAGGGAGAGGGAGGAAGG - Intronic
1142990754 17:3729210-3729232 ATGACGCTGTGGAGGGAAGAAGG - Intronic
1143136826 17:4716796-4716818 CTGGGGATGAGAAGGGAAGAAGG - Intronic
1143329317 17:6121840-6121862 GTGAGGCTGTGGAGGCCAGGAGG + Exonic
1143370651 17:6436891-6436913 AGGAGGAGGAGGAGGGAAGAGGG + Intergenic
1143646653 17:8234724-8234746 ATGAGGATGTGGGGGAAGGATGG - Intronic
1143688774 17:8542311-8542333 ATGGGGAGGTGGAGGGAAAATGG + Intronic
1143720766 17:8807497-8807519 TGGAGGATGTGGAAGGAAGGGGG + Intronic
1143724672 17:8836954-8836976 GGGAGGAGGTGGAGGTAAGAGGG + Intronic
1143836769 17:9699225-9699247 GTGAGGATGAGGAGGCAGCATGG + Intronic
1143971241 17:10797439-10797461 GTGAGGATGTAGAGAGAAAAGGG - Intergenic
1144722084 17:17478098-17478120 GGGAGGATGAGGTGGGAGGATGG - Intronic
1145722700 17:27088542-27088564 GTGATGAGGAGGAGGAAAGAGGG - Intergenic
1145923686 17:28630259-28630281 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1146049168 17:29535204-29535226 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1146137638 17:30337258-30337280 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1146457193 17:33017319-33017341 GGAAGGATGGGGAGGGATGAGGG - Intronic
1147311053 17:39596476-39596498 GGGAGGATGTGGAGGGACGTTGG - Intergenic
1147361816 17:39935546-39935568 GGGAGGGTGAGGTGGGAAGACGG + Intergenic
1147496105 17:40917271-40917293 GGGAGGGTGAGGTGGGAAGATGG + Intergenic
1147598671 17:41732934-41732956 GGGAGGATGTGGGGGGCAGGAGG - Intronic
1147993737 17:44350360-44350382 GGGGGTATGTGGAGGGAAGTGGG + Intronic
1148343786 17:46890115-46890137 GCGAGGAGGAGGAGGGATGAGGG - Intergenic
1148721220 17:49754648-49754670 GAGAAGAAGGGGAGGGAAGAGGG + Intronic
1148982748 17:51593008-51593030 TTGATGATGGGGAGGGGAGAAGG + Intergenic
1149109906 17:53016175-53016197 GTGTGGATTTAGAGGGGAGAGGG - Intergenic
1149261285 17:54882549-54882571 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
1149342239 17:55699002-55699024 GGGAGGATGTGAAGGTGAGAAGG + Intergenic
1149590155 17:57823077-57823099 GTGAGCATGTGCAGGGGAGAGGG - Intergenic
1149628633 17:58100129-58100151 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1149758035 17:59204289-59204311 GTGAGGCTGAGGTGGGAGGATGG + Intronic
1149879275 17:60271914-60271936 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1150009446 17:61490630-61490652 GTCAGGCTGTGAAGGGATGAAGG - Intergenic
1150266478 17:63835377-63835399 GGGAGGTTCTGGAGGGAAGGAGG - Intronic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150639928 17:66942651-66942673 GGGAGGAGGTGGAGGGCAGCAGG - Intergenic
1150653827 17:67026883-67026905 GAAAGGAGGTGGGGGGAAGAAGG - Intronic
1150706493 17:67491725-67491747 GGGAGGTTGAGGTGGGAAGATGG + Intronic
1150710146 17:67524201-67524223 GTGAGGCTGTGGCGGGAGGATGG + Intronic
1150737347 17:67751824-67751846 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1150929881 17:69573098-69573120 GGGAGGGAGGGGAGGGAAGAGGG - Intergenic
1150947615 17:69765406-69765428 GAGAGGGAGGGGAGGGAAGAAGG - Intergenic
1150947688 17:69765606-69765628 GAGAAGAGGGGGAGGGAAGAGGG - Intergenic
1150963551 17:69940876-69940898 CTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1150979451 17:70125163-70125185 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1151052643 17:70995874-70995896 GAGAAGATGGAGAGGGAAGATGG - Intergenic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151247252 17:72804394-72804416 GTGGGGAGTGGGAGGGAAGAGGG - Intronic
1151352763 17:73541447-73541469 GTGAGGATGTTGAGAGGGGATGG - Intronic
1151586016 17:75008978-75009000 GTGGTGATCAGGAGGGAAGAAGG - Intergenic
1151673461 17:75585904-75585926 GTGAGGATGTGGAGGTTGAAAGG + Intergenic
1151775364 17:76197671-76197693 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1152128251 17:78460250-78460272 GTGACGTTCTGGAAGGAAGATGG + Exonic
1152210786 17:79001958-79001980 GTGGGGCTGGGGAGGGAGGAGGG - Intronic
1152217237 17:79040797-79040819 GTGAGGCTGAGGTGGGAGGATGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152329005 17:79659823-79659845 GGGGGGAAGGGGAGGGAAGAGGG - Intergenic
1152615271 17:81334924-81334946 GTGAGGGCGTGGATGGCAGAGGG - Intergenic
1152638507 17:81439904-81439926 GTGAGTATGAGGTGGGGAGAAGG - Intronic
1152660067 17:81537945-81537967 CTGTGGATGTGGACGGAAGTGGG - Intergenic
1152701928 17:81823651-81823673 GTGAGGCTGGGGTGGGCAGAGGG - Intronic
1152763626 17:82122849-82122871 ATGAAGATGTGGAGTCAAGAGGG - Intronic
1152901935 17:82947316-82947338 GTGGGTGTGTGGAGGGAAGGTGG - Intronic
1203159869 17_GL000205v2_random:39285-39307 GTGGGGAAGCGGAGGGACGAGGG - Intergenic
1153376982 18:4391854-4391876 GTGTAGATGTGGAGGGAATGAGG - Intronic
1153543750 18:6185321-6185343 GTATGGATCTGGAGGGGAGAAGG - Intronic
1153586056 18:6621873-6621895 GGAAGGATGGGGAGGGCAGAAGG - Intergenic
1153699993 18:7683272-7683294 GAGAGGCTGAGGAGGGAGGATGG - Intronic
1153804798 18:8702836-8702858 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1153837059 18:8972830-8972852 GGGAGGTTGTGGAGGGGAGGTGG - Intergenic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1154347301 18:13552599-13552621 GTTAGGAAGTGGAGGGAGGAGGG - Intronic
1154487563 18:14886777-14886799 GTGAGCATATTGAGGGCAGAGGG - Intergenic
1154515004 18:15153338-15153360 GTGAGGATGTAAAGAAAAGACGG + Intergenic
1155066566 18:22273843-22273865 GGGAAGAGGAGGAGGGAAGAGGG - Intergenic
1155318883 18:24598620-24598642 GTGAGAATGTTGATGGAAGCTGG + Intergenic
1155792639 18:29993713-29993735 GTTAGAAAGTGGAGGGAAAATGG + Intergenic
1156064597 18:33124991-33125013 GTGTGCAGGTGGAGGTAAGAGGG - Intronic
1156134927 18:34026269-34026291 GTGTGCATGGGGAGGGAGGAGGG - Intronic
1156347524 18:36271064-36271086 GGGAGGCTGTGGCGGGAGGATGG - Exonic
1156469305 18:37367454-37367476 GTGGGGATGGGGAGGACAGAGGG + Intronic
1156578615 18:38349385-38349407 GTGAGGATGCAGTGAGAAGATGG + Intergenic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1156699946 18:39814300-39814322 GTGATCATTTGGAGGAAAGAGGG + Intergenic
1156738353 18:40292256-40292278 GGGGGGATGGGGAGGGAGGAAGG - Intergenic
1157264563 18:46206879-46206901 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1157421934 18:47554989-47555011 GTGTGGAAGGTGAGGGAAGAGGG - Intergenic
1157446701 18:47751624-47751646 GTGTGGATGAGGAGGGGACAAGG + Intergenic
1158270172 18:55704362-55704384 GTGGGGATGGGGAGGAAAAATGG + Intergenic
1158614581 18:58974806-58974828 GTGAGCTTGTGGAGGTCAGAGGG - Intronic
1158907676 18:62029665-62029687 GTGGGGAGGCGGAGGGGAGAAGG + Intergenic
1159514104 18:69435277-69435299 GTCAGGATATTGAGGGGAGAAGG - Intronic
1159927388 18:74281462-74281484 GACAGGAGGTGGAGGGAGGAGGG + Intronic
1160174517 18:76581639-76581661 GTGTGCATGAGGAGGGAGGAAGG - Intergenic
1160175936 18:76594041-76594063 GGGAAGTTTTGGAGGGAAGATGG - Intergenic
1160265817 18:77340158-77340180 GTGAGGATGTGGCAAGAAGGTGG + Intergenic
1160428898 18:78797865-78797887 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1160448628 18:78946982-78947004 GGGAGGAGGAGGAGGGAAGAGGG + Intergenic
1160591462 18:79947184-79947206 GTGAGTATGTGGAGGAAAAGCGG - Intronic
1160635589 19:72584-72606 GTGAGGATGCGAAGAGAAGGTGG + Intergenic
1160676372 19:393535-393557 GTGATGATGGGGAAGGATGACGG + Intergenic
1160676607 19:394531-394553 GAGAGGATGGAGAAGGAAGATGG + Intergenic
1160872219 19:1282593-1282615 GTGAAGGTGTGAAGGGAGGAGGG + Intergenic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161220756 19:3116979-3117001 GGGAGGATGCGGCGTGAAGATGG + Intronic
1161226154 19:3146905-3146927 GTGAGGAGGGGGAGAGAGGAAGG - Intronic
1161369410 19:3902071-3902093 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1161625404 19:5323649-5323671 GTGAGGACGGGGAGAGAGGAAGG + Intronic
1161636991 19:5395228-5395250 GGGACGGTGGGGAGGGAAGAGGG - Intergenic
1161749256 19:6082535-6082557 GGGAGGCTGTGGTGGGAGGATGG - Intronic
1161756429 19:6137460-6137482 GTGAGGAGGGGGAGGGAGGAAGG + Intronic
1161756664 19:6138760-6138782 GGAAGGAAGGGGAGGGAAGAAGG + Intronic
1161968870 19:7564713-7564735 GGGAGGATGAGGTGGGAGGATGG - Intergenic
1162185255 19:8899974-8899996 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186055 19:8905986-8906008 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162252704 19:9459696-9459718 GTGAGGATGTGGGGGTAGAAAGG + Intergenic
1162318272 19:9954490-9954512 CTCAGGAGGTGGAGGCAAGAGGG + Intergenic
1162376193 19:10306708-10306730 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1162418561 19:10552870-10552892 CTGAGGACCTGGCGGGAAGAGGG - Exonic
1162731248 19:12720423-12720445 GGGAGGATGAGGTGGGAGGATGG - Intronic
1162833209 19:13299615-13299637 GTGAGGAGGTGAAGGCAAGGAGG - Intronic
1163054599 19:14708849-14708871 GTGAAGATATAGAGAGAAGATGG - Intronic
1163082340 19:14953085-14953107 GGGAGCAGATGGAGGGAAGAAGG + Intronic
1163153031 19:15425836-15425858 GGGAGGAGGAGGAGGGAGGAGGG + Intronic
1163172775 19:15544038-15544060 GTGAGGATGTGGGGTGAGGCTGG + Intronic
1163245743 19:16092957-16092979 GGGACGCTGAGGAGGGAAGATGG - Intronic
1163276739 19:16289520-16289542 GGGAGGCTGAGGCGGGAAGATGG - Intergenic
1163324996 19:16597825-16597847 GTGAGGCTGAGGTGGGAAGATGG - Intronic
1163344375 19:16730787-16730809 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1163414443 19:17177580-17177602 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1163421699 19:17217068-17217090 GTGAGGAGGTTGAGGTCAGAAGG + Intronic
1163750027 19:19071244-19071266 GGGAGGATGAGGCGGGAGGATGG - Intronic
1163779552 19:19239383-19239405 GGGAGGAGTGGGAGGGAAGATGG - Intronic
1163779570 19:19239439-19239461 GAGAGGAGGGGGAGGGAGGATGG - Intronic
1163779688 19:19239840-19239862 GGGAGGAGTTGGAGGGAGGAGGG - Intronic
1163791791 19:19310880-19310902 GGGAGGATGAGGTGGGAGGATGG - Intronic
1164404110 19:27927162-27927184 GTGAGGCAGTGGAGAGAGGAAGG + Intergenic
1164531485 19:29051656-29051678 TTGAGGGTGTGGAGGGGAGGAGG - Intergenic
1164721269 19:30433319-30433341 TTGGGGAAGTGGGGGGAAGATGG - Intronic
1164740542 19:30572451-30572473 GTTAGGGAGTGGAGGGTAGAGGG - Intronic
1164806578 19:31121571-31121593 GTGCGGATGTGGAGGAGAGAGGG - Intergenic
1164956668 19:32392362-32392384 GGGAGGAAGGGGAGGGAGGAAGG + Intergenic
1165238606 19:34444700-34444722 GTGAGGTTGAGACGGGAAGATGG + Intronic
1165329216 19:35132037-35132059 ATGAAGCTGTGGAGGGAAGCTGG + Exonic
1165602302 19:37065017-37065039 GTGAGAATGTGGAGGTCAAAAGG + Intronic
1165764043 19:38339121-38339143 GTGAGAATGTGGAGGTCAAAAGG + Intronic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1165915029 19:39253238-39253260 GTGAGGCTGGGGTGGGAGGATGG - Intergenic
1166158827 19:40936311-40936333 GGGAGTATATGGGGGGAAGAAGG + Intergenic
1166322577 19:42027781-42027803 GTGAGTAGGAGGAGGGAAGGGGG - Intronic
1166692400 19:44830911-44830933 AGGAGGCTGTGGCGGGAAGAGGG + Intergenic
1166915313 19:46191435-46191457 GTGAGGATGAGGATGAAGGAAGG + Intergenic
1166975629 19:46603515-46603537 ATGAGGTGGGGGAGGGAAGAGGG - Intronic
1167017402 19:46850125-46850147 GAGAGGACCTGGAGGTAAGATGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167130542 19:47582326-47582348 GAGAGGAAGAGGAGGGAAGGAGG - Intergenic
1167417881 19:49386710-49386732 GGGAGGAAGGGGAGGGAGGAGGG + Intergenic
1167538149 19:50068596-50068618 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1167662921 19:50806706-50806728 GTGAGGCTGAGGTGGGTAGATGG - Intergenic
1167775472 19:51551815-51551837 GTGAGGAAGAGGAGGAAGGAAGG - Intergenic
1168260240 19:55189469-55189491 GTGAGGAAGGGGAGGGCAGTGGG - Intronic
1168302680 19:55415309-55415331 GTGTGGATGTGGAGGGTAGGAGG - Intergenic
1168432246 19:56290617-56290639 GGGAGGCTGTGGTGGGAGGAAGG + Intronic
1202654742 1_KI270708v1_random:10116-10138 GTGAGGATGTGGGGGTTAAAAGG - Intergenic
924987253 2:283400-283422 GTGGGGCAGCGGAGGGAAGAGGG + Intronic
925149200 2:1602947-1602969 GTGAGGTTATGGTGAGAAGACGG - Intergenic
925264640 2:2558567-2558589 GGGATGATGTGAAGGGAAGATGG - Intergenic
925391674 2:3499389-3499411 GAGAGGAGGTGGAGGGTACATGG - Intronic
925689373 2:6505618-6505640 GTGGGGTAGAGGAGGGAAGAGGG - Intergenic
925858896 2:8156282-8156304 GTGAGGATGTGTAGGGAGGTTGG - Intergenic
925866885 2:8235894-8235916 GGGAGGCTGAGGCGGGAAGATGG + Intergenic
925904796 2:8534123-8534145 GTGAGGAGGTGGGTGGAAGAGGG - Intergenic
925907094 2:8546053-8546075 GCGTTGATGTGGAGGGAAGGGGG + Intergenic
926093570 2:10065799-10065821 GTGAGGACCTGGAGGAAAGTGGG + Intronic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926266787 2:11330727-11330749 GGGAAGATGAGGAGGGAGGAGGG + Intronic
926608554 2:14922510-14922532 GTGAGGATGTAAAGGAAAGGTGG - Intergenic
926624961 2:15083299-15083321 GTGGAGATGGAGAGGGAAGAAGG - Intergenic
926734083 2:16059251-16059273 GGGAAGAGGAGGAGGGAAGAGGG - Intergenic
927543238 2:23930617-23930639 GGGAGGCTGAGGTGGGAAGATGG + Intronic
927634886 2:24806453-24806475 GTGAGGGGGTGGAGCCAAGATGG - Intronic
928031438 2:27783201-27783223 GGGAGGATGAGGTGGGCAGATGG + Intronic
928101849 2:28442880-28442902 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
928549730 2:32358063-32358085 GTGGGGGTGGGGAGGGAAGTAGG + Intronic
928927757 2:36596705-36596727 GAGAGGCTGTGGTGGGAGGATGG - Intronic
929012614 2:37460278-37460300 GTGAGAATTTGGAGGTGAGAGGG + Intergenic
929280391 2:40072008-40072030 GTGGTGATTTGGAGGAAAGAGGG + Intergenic
929510452 2:42562406-42562428 GTGGGGAGGGGGAGGGAAGATGG - Intronic
929621949 2:43364117-43364139 GGGAGGCTGAGGAGGGAGGATGG + Intronic
929736485 2:44555441-44555463 GTGAGGATGGGGAGGGAGGATGG + Intronic
929881065 2:45837767-45837789 GTGAGGCTGAGGTGGGAGGAAGG + Intronic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
930527121 2:52544019-52544041 GTGAGGATGTGGAGAGGATGTGG - Intergenic
930638494 2:53831227-53831249 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
930713049 2:54567225-54567247 GTGAGGATGGGGTGGTAGGAAGG + Intronic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931385620 2:61795289-61795311 GGGAGGATGAGGTGGGAGGATGG + Intergenic
931706295 2:64949029-64949051 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
931749718 2:65319655-65319677 GTGAGGAAGAGGAGGGAACCTGG - Intronic
931812732 2:65870397-65870419 GTGAGGATGTGAAGGAAGCAGGG - Intergenic
931979740 2:67681837-67681859 GTGAGGCTGGGGAGGTCAGAAGG - Intergenic
932010397 2:67971958-67971980 TTTAGGATGTGGAGAGAAGAAGG - Intergenic
932035756 2:68245255-68245277 GGGAGGCTGAGGAGGGAGGATGG + Intronic
932336663 2:70935684-70935706 TGGAGGATGTGGAGGGAGAAGGG - Intergenic
932779961 2:74553809-74553831 GAGAGGATGTGGAGGGACCAGGG - Intronic
932781270 2:74560118-74560140 GTAAGGAAGAGGAGGGAAGGAGG + Intronic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
933428884 2:82149460-82149482 GTGAGGTTGAAGAGAGAAGAGGG + Intergenic
933658435 2:84907296-84907318 GTGGGGATGTGGTGGGAGGGAGG + Intergenic
933813472 2:86047886-86047908 GGGCGGAGGTGGTGGGAAGAGGG + Intronic
934158454 2:89225365-89225387 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
934176566 2:89583535-89583557 GGGAGGATGTCGAGGGGAGGAGG + Intergenic
934208817 2:89957062-89957084 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
934286876 2:91657896-91657918 GGGAGGATGTCGAGGGGAGGAGG + Intergenic
934324990 2:92005108-92005130 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
934638849 2:96014007-96014029 GGGAGGATGTGGGGGGACCAGGG - Intergenic
934744361 2:96749257-96749279 GGGAGGCTGAGGAGGGAAGATGG + Intergenic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG + Intronic
935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG + Intergenic
935913896 2:107927867-107927889 GTGAGGCTATGGGGAGAAGATGG - Intergenic
936376214 2:111943432-111943454 GGGAGGCTGAGGTGGGAAGATGG + Intronic
936565892 2:113582464-113582486 GTGAGGATGCGAAGAGAAGGTGG - Intergenic
937075796 2:119105508-119105530 GTGATGATGTGGAGAGAGGCAGG - Intergenic
937094964 2:119229356-119229378 GTGAGGATGTGCAGGGGTGGAGG + Intronic
937197682 2:120174214-120174236 GGGAGGCTGAGGAGGGCAGATGG + Intronic
937224726 2:120361847-120361869 GTGAGGATCTGGAAGGCTGAGGG + Intergenic
937416993 2:121723320-121723342 TTTGGGATGAGGAGGGAAGACGG + Intergenic
937662864 2:124450924-124450946 GGGAGGCTGAGGAGGGAGGATGG + Intronic
937759318 2:125581418-125581440 GAGAGGCTGTGCTGGGAAGAAGG - Intergenic
937887704 2:126911407-126911429 GTGAGGGTGTGGTGGGGTGAGGG - Intergenic
938014698 2:127857884-127857906 GTGGGGCTGGGGAGGGAACATGG - Intronic
938405382 2:131030005-131030027 GTGAGGCTGTGCAGGGCTGATGG + Intronic
938548890 2:132361313-132361335 GTGGGGAAGGGGAGGGACGAGGG + Intergenic
938663848 2:133513501-133513523 GAGTGGATCTGGAGGGAAAATGG + Intronic
938877353 2:135546341-135546363 GAGAGGAAGGGAAGGGAAGAGGG - Intronic
939990902 2:148875967-148875989 GTGGGGATGGGGGGCGAAGACGG + Intronic
939995034 2:148911980-148912002 GTTGGGATGGGGAGGAAAGAGGG - Intronic
940310015 2:152268635-152268657 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
940488891 2:154331405-154331427 GAGAGGCTGAGGTGGGAAGATGG - Intronic
940696390 2:156984698-156984720 GGGAGGACGTGGAGGGGGGAGGG + Intergenic
940745789 2:157566344-157566366 GTGGGAATGTGGAGCCAAGATGG + Intronic
940778057 2:157905270-157905292 GTGAGGCTGAGGTAGGAAGATGG - Intronic
941161874 2:162044760-162044782 GTGAGGATGTGGAGTTGAGCTGG + Intronic
941245028 2:163085738-163085760 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
941245036 2:163085811-163085833 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
941584402 2:167339409-167339431 GTGTGGATGTGGGGGGATGTAGG + Intergenic
942245293 2:174002639-174002661 GCTAGGGTTTGGAGGGAAGAAGG + Intergenic
942255521 2:174093205-174093227 TTGGGGATTTGGTGGGAAGATGG + Intronic
942301095 2:174563330-174563352 GAGAGGTTGAGGAGGGATGATGG + Intronic
942507356 2:176657069-176657091 GGGAGGAGGAGGAGGGAGGAAGG + Intergenic
942803626 2:179903617-179903639 GTGAGGCTGTGAAGGGCAGTGGG + Intergenic
942816143 2:180056704-180056726 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
943019703 2:182557605-182557627 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
943043729 2:182833097-182833119 GGGAGGCTGAGGAAGGAAGACGG - Intergenic
944652804 2:201848544-201848566 GGGAGTGTGGGGAGGGAAGATGG - Intronic
945102694 2:206275707-206275729 GTGGGGAGGGGGAGGGACGATGG + Intronic
945476468 2:210287604-210287626 GTGGGTATGTGGCTGGAAGAGGG + Intergenic
945498798 2:210542751-210542773 ATGAGAATGTGGAGCCAAGAAGG - Intronic
945662975 2:212709140-212709162 GAGAGGATGTGGAGGACAGAGGG - Intergenic
946003807 2:216505926-216505948 GGGAGGATGAGGTGGGAGGACGG - Intronic
946261451 2:218495379-218495401 GGGAGGATGAGGTGGGCAGATGG - Intronic
946846825 2:223866636-223866658 GGGAGGCTGGGGAGGGAGGATGG - Intronic
946899106 2:224355309-224355331 AGGAGGAGGAGGAGGGAAGAAGG - Intergenic
947030513 2:225787928-225787950 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
947641062 2:231708128-231708150 GGAAGGAGGGGGAGGGAAGAGGG - Intronic
947736776 2:232459300-232459322 AAGGGGATGCGGAGGGAAGAAGG - Exonic
947847818 2:233259738-233259760 GGGAAGATCTAGAGGGAAGAAGG - Intronic
947976088 2:234367748-234367770 GGGAGGCTGAGGGGGGAAGATGG - Intergenic
948229109 2:236336748-236336770 GTGAGGACTTGGAGGTAAGATGG - Intronic
948606280 2:239137621-239137643 ATGAGGATGTGGGGGGAGCAGGG - Intronic
948685109 2:239665367-239665389 GTGAGGAGGAGGATGGAAGGAGG + Intergenic
948685137 2:239665445-239665467 GTGAGGAGGAGGATGGAAGGAGG + Intergenic
948685165 2:239665523-239665545 GTGAGGAGGAGGATGGAAGGAGG + Intergenic
948685193 2:239665601-239665623 GTGAGGAGGAGGATGGAAGGAGG + Intergenic
948685221 2:239665679-239665701 GTGAGGAGGAGGATGGAAGGAGG + Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948903636 2:240967879-240967901 GTGAGGCAGTGGGGGGCAGAAGG - Intronic
1169004755 20:2197197-2197219 ATGAGGTTGGGGATGGAAGAGGG - Intergenic
1169236570 20:3934409-3934431 GGGAGGCTCTGGAAGGAAGAGGG - Intronic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1169860054 20:10141675-10141697 AGGAGGATGAGGCGGGAAGATGG - Intergenic
1170171575 20:13419290-13419312 GTGTGCATGTAGAGGGAGGAGGG + Intronic
1170276250 20:14593382-14593404 GTGAGGTGAGGGAGGGAAGAAGG + Intronic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1170934852 20:20800711-20800733 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1171877713 20:30593840-30593862 GTGGGGAAGGGGAGGGACGAAGG + Intergenic
1172292151 20:33784179-33784201 GTGAGGAGGCGGAGGGAGGGGGG - Intronic
1172374811 20:34429911-34429933 TAGAGGAATTGGAGGGAAGAAGG + Intronic
1172473749 20:35221560-35221582 GAAAGGAGGTGAAGGGAAGAGGG + Intergenic
1172562934 20:35905510-35905532 GTGAGGATGTAGCAAGAAGATGG + Intronic
1172766880 20:37355768-37355790 GTGAGGGTGGGCCGGGAAGAAGG + Intronic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173125947 20:40336224-40336246 GGGAGGGTGTTGAGGGAGGAGGG - Intergenic
1173826878 20:46053471-46053493 GTGAGGAGTGGGTGGGAAGAGGG + Intronic
1173966861 20:47119117-47119139 GTGAGTAGTTGGAGGGGAGACGG - Intronic
1174010697 20:47447281-47447303 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1174085406 20:48004542-48004564 GTGAGGATGACAAGGGAAGAAGG + Intergenic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174128798 20:48327440-48327462 CTGAGGATGAGGAGATAAGAAGG - Intergenic
1174130816 20:48342188-48342210 GTGAGGATGACGAGGGAAGAAGG - Intergenic
1174147911 20:48464951-48464973 GTGAGGAGGTGGAGGGGAGGGGG - Intergenic
1174198432 20:48789931-48789953 GTGAAGAAGGGGAGGAAAGAAGG + Intronic
1174206055 20:48840117-48840139 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1174474596 20:50787499-50787521 GGGAGGCTGTGGTGGGAGGATGG + Intergenic
1174579231 20:51559315-51559337 GGGAGGATGTGGAGGGTATAAGG - Intronic
1174827908 20:53785534-53785556 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1174883674 20:54308005-54308027 TTGAGGATGTGGTGGGAAACTGG + Intergenic
1174910789 20:54605484-54605506 TTGGGGAGGTGGTGGGAAGAGGG - Intronic
1175124814 20:56743292-56743314 GTGGGGCTGAGGCGGGAAGATGG - Intergenic
1175180692 20:57144775-57144797 GTGAGGATATAGCGAGAAGATGG - Intergenic
1175491586 20:59384044-59384066 GGGAGGAGGTGGGGGGAAGGAGG + Intergenic
1175610013 20:60342910-60342932 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1175619025 20:60427677-60427699 GTGAGGAGCAGGAGGGAAGGAGG - Intergenic
1175917053 20:62430794-62430816 GAGACCATGTGGAGGAAAGACGG - Intergenic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1175973021 20:62696761-62696783 GTGAGGATGTGGAGTGAGTGCGG + Intergenic
1176090762 20:63317695-63317717 GAGAGGATGGTGAGGGAAGCCGG - Intronic
1176099117 20:63356953-63356975 GTGGGGATGTGGAAGGAGGTGGG - Intronic
1176243682 20:64086867-64086889 GTGAGCCTGTGGAAGGAGGAGGG + Intronic
1176778526 21:13164806-13164828 GTGAGGATGTAAAGAAAAGACGG - Intergenic
1178195198 21:30337026-30337048 GTGAAGATCTGTAGGGGAGATGG - Exonic
1178349905 21:31865322-31865344 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1178944099 21:36931935-36931957 TTGGGGATGTGGGGGGAAAACGG - Intronic
1179105619 21:38397713-38397735 GTGAGGAAGTGCTGGGAAGGTGG + Intronic
1179184916 21:39078116-39078138 GTGAGGATGAGCAAGGGAGACGG + Intergenic
1179647502 21:42784672-42784694 GTGGGGGTGTGGTGGGATGAGGG - Intergenic
1179799132 21:43802757-43802779 GGGAAGAAGTGGAGGGAAGAAGG - Intronic
1179876888 21:44273152-44273174 GGGAAGATGTGGAGGGTGGAAGG + Intergenic
1180388759 22:12204282-12204304 GTGAGGATGTGGGGGTTAAAAGG + Intergenic
1180488007 22:15819165-15819187 GTGAGTGTGTGGGGGGGAGAGGG + Intergenic
1180584495 22:16874893-16874915 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1180613597 22:17113434-17113456 GGGAGGATGAGGCGGGCAGATGG - Exonic
1180613856 22:17114800-17114822 GTGCAGATGTGGGAGGAAGAAGG + Exonic
1180692862 22:17731985-17732007 GTGGGGCTGTGGAGTGAAGTAGG + Intergenic
1180825486 22:18858161-18858183 ATGAGGATGTGGTGGGCAGAGGG - Intronic
1181187246 22:21116386-21116408 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1181211952 22:21294107-21294129 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
1181316383 22:21973379-21973401 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1181397545 22:22632779-22632801 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1181500294 22:23312154-23312176 GTGAGGATGCGGCAGGCAGAGGG + Intronic
1181651861 22:24263279-24263301 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
1181705516 22:24647460-24647482 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1181830091 22:25553617-25553639 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1181901551 22:26160323-26160345 GAGAGGAAGTAGAGGGAAGGAGG + Intergenic
1182012263 22:27010825-27010847 GTGAGGAAGTTGAGAGGAGATGG - Intergenic
1182351675 22:29703278-29703300 GTGAGGAGGGGGAAGGATGAAGG - Intergenic
1182424957 22:30266919-30266941 GTGGGGATGGGGAGGGGGGAGGG + Intergenic
1183385414 22:37511397-37511419 GTGAGGAGGAGGAGGGGAGGAGG + Intronic
1183387482 22:37523440-37523462 GTGAGGATGAGGAGTGGAGCAGG + Intergenic
1183440315 22:37819179-37819201 GAGCGGAGGTGGAGGGAAGGAGG - Intergenic
1183775417 22:39961048-39961070 GAGAGGCTGAGGTGGGAAGATGG - Intronic
1184050152 22:41998430-41998452 GGGAGGTTGAGGTGGGAAGATGG + Intergenic
1184153435 22:42651425-42651447 GGGAGGCTGTGGTGGGAGGATGG - Intergenic
1184251000 22:43260255-43260277 ATGACTATGTGGAGGGAACAAGG - Intronic
1184325589 22:43781426-43781448 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1184463255 22:44652465-44652487 GTGAAGATGTAGACTGAAGAAGG + Intergenic
1184463267 22:44652859-44652881 GTGAAGATGTAGACTGAAGAAGG + Intergenic
1184463279 22:44653216-44653238 GTGAAGATGTAGACTGAAGAAGG + Intergenic
1184509354 22:44924062-44924084 GGGAGGGAGGGGAGGGAAGAGGG + Intronic
1185015872 22:48342232-48342254 GTGAGGATGAGGAGGGAAGGAGG + Intergenic
1185061940 22:48611713-48611735 GGAAGGAGGTGGAAGGAAGAGGG - Intronic
1185173786 22:49307715-49307737 GTGAAGATGGGGAGGGGAGGAGG + Intergenic
1185196081 22:49470308-49470330 GTGAGAATGTGGGTGGAAGATGG + Intronic
1185289640 22:50017001-50017023 GTAGGGATGTGGGGTGAAGAGGG + Intronic
1185310057 22:50149360-50149382 CTAGAGATGTGGAGGGAAGAAGG - Intronic
1203215002 22_KI270731v1_random:1325-1347 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1203275634 22_KI270734v1_random:84064-84086 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
949345360 3:3071692-3071714 GGGAGGCTGAGGTGGGAAGATGG - Intronic
950077975 3:10200655-10200677 GTGAGGCTGAGGCGGGAGGATGG + Intronic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950553641 3:13682423-13682445 GTGAGGGTGTAGAGGGAGCAGGG + Intergenic
950564900 3:13763079-13763101 TGGAGGATGTGGAGGGAAGCAGG - Intergenic
950663462 3:14481246-14481268 GAGAAGATGTGGGGGAAAGAGGG + Intronic
950763423 3:15255411-15255433 GTGGGGATGCGGGGGGATGAGGG - Exonic
950777634 3:15364426-15364448 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
951037838 3:17952883-17952905 GGGAGGCTGAGGTGGGAAGATGG - Intronic
951046182 3:18041069-18041091 GAGAGGACAAGGAGGGAAGAGGG - Intronic
951686646 3:25351732-25351754 GTGAGGATGGGGATGGAACAAGG - Intronic
952031713 3:29150640-29150662 AAGAGGATGTGGAGAAAAGAAGG + Intergenic
952049700 3:29369539-29369561 GTGAGGGTGAGGAGGAGAGAGGG + Intronic
952300704 3:32102387-32102409 GTGAGGATGTGGGGGTTGGAAGG - Intergenic
952474432 3:33692062-33692084 GGGAGGCTGTGGTGGGAGGATGG + Intronic
952647616 3:35680760-35680782 GGGAGGAGGAGGAAGGAAGAGGG - Intronic
952845125 3:37681815-37681837 GTGAGGAGATGGAGGGAAATGGG - Intronic
953088616 3:39700373-39700395 GGGAGGATGTGGAGAAAAGGGGG + Intergenic
954187601 3:48930559-48930581 GGGAGGCTGAGGTGGGAAGATGG - Intronic
954271349 3:49512134-49512156 GGGAGGCTGAAGAGGGAAGAAGG - Intronic
954701228 3:52451930-52451952 GTGAGGATGCGGTGAGAACATGG - Intronic
954722508 3:52577324-52577346 GGGAGGCTGAGGTGGGAAGATGG + Intronic
955131329 3:56171933-56171955 GTGTGGAGGTGGATGGAAGGGGG + Intronic
955200519 3:56847947-56847969 GTTAGGATGTGGGGGAAGGAAGG + Intronic
955369131 3:58335903-58335925 GTGAAGAGATGGAGGGAGGAAGG - Intronic
955750752 3:62183811-62183833 GTGGGGATGGGGAAGGATGAAGG + Intronic
955778821 3:62462336-62462358 GAGAGGAGCTGGAGGGAGGAGGG - Intronic
956746998 3:72318216-72318238 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957048534 3:75394795-75394817 GGGAGGAGGTGGTGGGAAGGAGG + Intergenic
957099762 3:75812185-75812207 GTGAGGATGTGGAGGTTGAAAGG + Intergenic
958108239 3:89105150-89105172 GTAAGTCTGTGGTGGGAAGAAGG + Intergenic
958586123 3:96090571-96090593 GTGAGGATATGGTGGGAAATTGG + Intergenic
958904489 3:99927039-99927061 GGGAAGATATGGAGTGAAGATGG - Intronic
959535878 3:107484132-107484154 GGGAGGCTGAGGTGGGAAGACGG + Intergenic
959662411 3:108883510-108883532 TTGAGGAGGTGGAGGCAGGAAGG + Intergenic
959844402 3:111016692-111016714 GAGAGGATGTGTTGGGAGGAAGG - Intergenic
960391108 3:117078602-117078624 GGGAGGCTGTGGTGGGAGGATGG - Intronic
960647837 3:119909121-119909143 GGGAGGATGAGGTGGGAGGATGG - Intronic
960662912 3:120080301-120080323 GGGAGGAGGGGGAGGGAAGAAGG + Intronic
960786027 3:121373515-121373537 GGGTGGATGTGGAGGGATGTTGG - Intronic
960928755 3:122822954-122822976 GTGGGGAGGTGGAGGGCGGATGG - Intronic
961028282 3:123580369-123580391 GGGAGGATGAGGTGGGAGGATGG + Intronic
961108533 3:124263253-124263275 ATCAGGATGTTGAGGGACGATGG - Intronic
961130564 3:124462849-124462871 ATGAGGATGTTGAGGAGAGATGG - Intronic
961169231 3:124784558-124784580 TTAAGGCAGTGGAGGGAAGATGG + Intronic
961238463 3:125389181-125389203 GAGAGGATGAGGTGGGAGGATGG + Intergenic
961380208 3:126492091-126492113 GTGAGGGGGTGGTGGGAAGGAGG - Intronic
961621821 3:128230392-128230414 GGGAGGCTGAGGAGGGAGGATGG - Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961635794 3:128331507-128331529 TTGAGGAAGGAGAGGGAAGAGGG - Intronic
961666757 3:128497600-128497622 GTGCGAGTGTGGAAGGAAGAGGG + Intergenic
961678639 3:128583960-128583982 GGGAGGAAGTGCAGGGAAAAAGG - Intergenic
961684977 3:128623603-128623625 GGGAGGATGAGGTGGGAGGATGG + Intronic
961827933 3:129608280-129608302 GCGAGGGTGTTGAGGGAAGTGGG - Intergenic
962203278 3:133416696-133416718 GAGAGGATGGGGAGAGTAGAGGG - Intronic
962350475 3:134652141-134652163 GTGAGAAGGTGGAGGGAAAATGG - Intronic
962538385 3:136352264-136352286 GGGAGGCTGAGGTGGGAAGATGG - Intronic
962720743 3:138172488-138172510 GGGAGGCTGTGGTGGGAGGATGG + Intronic
962755474 3:138462610-138462632 GGGAGTAGGTGGAGGGAACAAGG - Intronic
963003974 3:140708776-140708798 GAGAGGATGAGGAGGAAGGAAGG + Intergenic
963108432 3:141665681-141665703 GAAAGGAGGGGGAGGGAAGAAGG + Intergenic
964004687 3:151813024-151813046 GCGAGAAGGAGGAGGGAAGAAGG - Intergenic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964207307 3:154188799-154188821 ATGAAGATGTGGAGGAAAAAGGG - Intronic
964291074 3:155180622-155180644 GAAAGGGTGTGGAGGGAGGAAGG + Exonic
964616354 3:158670827-158670849 GGGAGGCTGAGGTGGGAAGATGG + Intronic
964958347 3:162391073-162391095 TTGAAGATGTGGAGGGCTGAAGG + Intergenic
965079539 3:164019675-164019697 GTGAGAAGGAGGAGGGAAGAGGG + Intergenic
965285342 3:166812022-166812044 GGAGGGATGTGGAGGGAGGAAGG + Intergenic
965378878 3:167962719-167962741 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
965621344 3:170644950-170644972 GTGAAGCTGTAGAGGGAGGAGGG - Intronic
965797560 3:172457232-172457254 GTGAGGATGCAGTGAGAAGATGG - Intergenic
965925929 3:173979510-173979532 GTGAGGATAAGAAGGGAAAATGG + Intronic
966205814 3:177405333-177405355 GGGAGGATGTTGGGGGGAGATGG - Intergenic
966276922 3:178184187-178184209 TTCAGGATTAGGAGGGAAGAGGG - Intergenic
966434544 3:179868831-179868853 TTGAGGTTGTGGAGAGAATATGG - Intronic
967116209 3:186341405-186341427 GGGAGGCTGAGGAAGGAAGATGG + Intronic
967145874 3:186605608-186605630 TTGAGGATGTGGAGATATGAGGG - Intergenic
967193824 3:187009525-187009547 GGGAGGCTGAGGAGGGAGGATGG + Intronic
967419847 3:189260806-189260828 GTCAGCAGGTGGAGGGAGGAAGG + Intronic
967481446 3:189977847-189977869 GGGAGGCTGAGGAGGGAGGATGG - Intronic
967715391 3:192756855-192756877 GGGAGGCTGAGGTGGGAAGATGG - Intronic
967937015 3:194737145-194737167 GGCAGGGTGGGGAGGGAAGAGGG - Intergenic
968074711 3:195810051-195810073 GTGAGGACGTGGAGGCCGGAAGG - Intronic
968267659 3:197375209-197375231 GTGGGGATGGGGAGAGAGGATGG - Intergenic
968426309 4:525838-525860 GTGAGGAAGCGGAGGGGGGACGG + Intronic
968546229 4:1200392-1200414 GGGAGCAAGTGGAGGGAGGAAGG + Intronic
968621205 4:1604203-1604225 GTGTGGATGGGTGGGGAAGAAGG + Intergenic
968653501 4:1769119-1769141 GTGGGCATGTGGGGGGCAGAGGG - Intergenic
968862815 4:3185955-3185977 GGGAGGAAGGGGAGGGAGGAAGG + Intronic
968962240 4:3751537-3751559 GTGAGGAAGAGGAGCGAGGATGG - Intergenic
969086466 4:4660165-4660187 GCGAGGCTGGGGAGGGAACAGGG + Intergenic
969147707 4:5138787-5138809 CTGAGGATGTAGAGAGAACAAGG + Intronic
969275854 4:6135335-6135357 GTGAGGACATGGGGAGAAGACGG + Intronic
969532308 4:7736759-7736781 GTGGGCATGTGGTGGGGAGAGGG - Intronic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
969632956 4:8349056-8349078 GTGAGGACACGGAGGGAAGGTGG - Intergenic
969835439 4:9836437-9836459 GTGGAGATGTGGATTGAAGACGG + Intronic
969838176 4:9860398-9860420 GTGAGGGTGTTGAACGAAGATGG + Intronic
970128811 4:12843981-12844003 GTGAAGATGCGGGGAGAAGATGG - Intergenic
970159349 4:13173329-13173351 GGGAGGAAACGGAGGGAAGAAGG + Intergenic
970616678 4:17774261-17774283 GGGAGGCTGAGGTGGGAAGATGG + Intronic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970813994 4:20131424-20131446 GTGAGGATGGAGTGGGAAGGTGG + Intergenic
970874940 4:20858285-20858307 GTGAAGATGGAGTGGGAAGATGG + Intronic
971116240 4:23648795-23648817 GTGGGGAAGTGGAGAGAAAATGG - Intergenic
971153477 4:24058501-24058523 CTGGGTATGTGGTGGGAAGAGGG - Intergenic
971156368 4:24087573-24087595 ATGAGGACTTGGAGGGAAGATGG - Intergenic
971810572 4:31420363-31420385 GCGAGGATGTGGAGAAAAGGGGG - Intergenic
972168764 4:36319444-36319466 ATGAAGATGTGGAGTGGAGAGGG + Intronic
972242555 4:37208935-37208957 GTGTGGAGGTGGAGGGAGGGAGG - Intergenic
972345869 4:38191856-38191878 GTGAGGAAGTGGATAGAAAATGG - Intergenic
972385311 4:38560131-38560153 GGGAGTATGTGCAGGGATGATGG + Intergenic
972498148 4:39652990-39653012 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
972821122 4:42702418-42702440 TTGAGGAGGTGGAGCCAAGATGG - Intergenic
972884461 4:43468983-43469005 GTGAGGATGTGGGGGTTAAAAGG - Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973096870 4:46213263-46213285 GTGAGGACATGGTGAGAAGATGG + Intergenic
973317367 4:48776225-48776247 GGGAGGCTGAGGCGGGAAGATGG - Intronic
973620171 4:52718245-52718267 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
974540737 4:63230922-63230944 GAGAGGATGGGGAGGGACGAGGG + Intergenic
974825051 4:67117447-67117469 GTCAGGGGGTGGAGGGAAAAGGG + Intergenic
974887106 4:67833302-67833324 CTGAGGCTGAGGAGGGAAGCTGG - Exonic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975101841 4:70522538-70522560 GGGATGGTGTGGAGGGAAGGGGG - Intronic
975351255 4:73349899-73349921 GAGTGGATGTTGAGGGCAGAGGG + Intergenic
975460859 4:74651279-74651301 GGGAGGAGGGGGAGGGAGGAGGG + Intergenic
975460866 4:74651292-74651314 GGGAGGAGGGGGAGGGAGGAGGG + Intergenic
975460873 4:74651305-74651327 GGGAGGAGGGGGAGGGAGGAGGG + Intergenic
976077090 4:81312144-81312166 CTGAGGATTTGGAGGCAAGAAGG + Intergenic
977355226 4:95937982-95938004 AGGAGGTTGGGGAGGGAAGAGGG + Intergenic
977433360 4:96960899-96960921 CTGAGGATGGGGAAGGAATATGG - Intergenic
977638587 4:99329535-99329557 GTGAGGATACAGAGGGAAGGTGG + Intergenic
977696632 4:99972682-99972704 GTGATCATTTGGAGGAAAGAAGG - Intergenic
977758991 4:100708081-100708103 GTGAAAGTGTGGAGGGAAGGAGG + Intronic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
978507163 4:109471245-109471267 GTGAGGCTGAGGTGGGAGGATGG - Intronic
978785126 4:112600822-112600844 GTGAGAATGTGGAGGTCAAAAGG - Intronic
978913234 4:114091381-114091403 GGGAGGCTGAGGTGGGAAGAGGG - Intergenic
979116480 4:116830347-116830369 GTGGTCATGTGGAGGAAAGAGGG - Intergenic
979306855 4:119155580-119155602 GTGGGGCTGAGGAGGGCAGAGGG + Intronic
980044726 4:127974746-127974768 GGGAGGCTGAGGAGGGTAGAGGG + Intronic
980189289 4:129502727-129502749 GTGTGGATGTGAAGAGAGGAGGG + Intergenic
980691877 4:136305698-136305720 GAGAGGCTGAGGTGGGAAGATGG + Intergenic
980904529 4:138934395-138934417 GAGGGGATGAGAAGGGAAGATGG + Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
981417129 4:144506328-144506350 ATAAGGATGTGGATGAAAGAGGG - Intergenic
981479352 4:145221708-145221730 GTGAGGATGTGAAGAAAAGGTGG + Intergenic
981702499 4:147622180-147622202 GTGAGGCTGAGGAGGGCAGATGG - Intronic
982101301 4:151970885-151970907 GTGAGGATGTGGCGGGAAAAGGG - Intergenic
982405636 4:155016718-155016740 GCAGGGATGTGGAGAGAAGATGG + Intergenic
982709939 4:158747914-158747936 GTGATGATGTGGGGGGAGAAAGG + Intergenic
982710688 4:158755949-158755971 GAGAGGAGGGGGAGGGAAGAGGG - Intergenic
982718801 4:158838323-158838345 GTGAGGCTGAGGTGGGAGGATGG - Intronic
982772888 4:159414450-159414472 GACAGGATGTGGGTGGAAGAAGG - Intergenic
983711789 4:170726199-170726221 GTGAGGTGGTGGAAGGAAGGTGG + Intergenic
984134398 4:175917230-175917252 GTGATTGTGTGGAGGGAGGAGGG - Intronic
984763228 4:183379948-183379970 GTGAGGATGTGGTGAGAAGATGG + Intergenic
984825069 4:183916855-183916877 GATAGGAAGTAGAGGGAAGAGGG - Intronic
984910285 4:184668045-184668067 GTGAGGATAGAGTGGGAAGAGGG - Intronic
985117277 4:186604817-186604839 GTGAGGAGGAAGAGGGAGGAGGG + Intronic
985283790 4:188313466-188313488 GTCAGGCGGTGGAGGGAAAAGGG - Intergenic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985809960 5:2075598-2075620 GGGAGGGTGTCTAGGGAAGAAGG - Intergenic
986009049 5:3695443-3695465 TGGGGGAGGTGGAGGGAAGAAGG - Intergenic
986207747 5:5641521-5641543 GTGAGGGTGTGTAGGAAAGCAGG + Intergenic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
986631861 5:9781836-9781858 GTGAGGATAGGCAGGGATGATGG - Intergenic
986677139 5:10195998-10196020 GTGAGGACATGGTGAGAAGACGG - Intergenic
986792857 5:11180622-11180644 GGCAGGATGTAGAGTGAAGAAGG + Intronic
986832901 5:11600854-11600876 GTAAAAATGTGGTGGGAAGAAGG + Intronic
986967931 5:13297960-13297982 GTGAGAATGTGGAGAAAAGGTGG + Intergenic
987353213 5:17039907-17039929 AGGAGGATGGGGGGGGAAGAGGG - Intergenic
987684756 5:21182695-21182717 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
987686305 5:21208097-21208119 ATGAGCATGGGGAGGTAAGAGGG - Intergenic
987707916 5:21478923-21478945 GTGAGGATACTGAGAGAAGATGG - Intergenic
987876450 5:23687354-23687376 GTGAGAATGTGGAGGCCAAAAGG - Intergenic
988296244 5:29366255-29366277 GTGAGGATGTGGAGAAAAGGGGG - Intergenic
988487478 5:31678709-31678731 GAGAGGCTGAGGTGGGAAGATGG - Intronic
988690014 5:33562452-33562474 GTGAGGATGAGCAGGGGAGAGGG - Intronic
988751866 5:34196014-34196036 GTGAGGATACTGAGAGAAGATGG + Intergenic
989066437 5:37467355-37467377 GTGAGGATACTGAGAGAAGATGG - Intronic
989685658 5:44083762-44083784 CTAAGGAAGTGGAGGCAAGATGG - Intergenic
989820074 5:45786141-45786163 TTGAGGAGGTGGAGCCAAGATGG + Intergenic
990556745 5:56944037-56944059 GTGAGGAAATGGAGGTGAGAGGG - Intronic
990575428 5:57119433-57119455 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
990815840 5:59783951-59783973 GGGAGGCTGAGGTGGGAAGATGG + Intronic
991248817 5:64536289-64536311 GTGAGGAAGTGGAGAGCATATGG + Intronic
991350179 5:65713254-65713276 GTGAGGGGGAGGAAGGAAGAAGG - Intronic
991718159 5:69471391-69471413 GAGAGGATGTGGAGAGAAATAGG + Intergenic
991737194 5:69638799-69638821 GTGAGGATACCGAGAGAAGATGG + Intergenic
991739631 5:69656831-69656853 GTGAGGATACCGAGAGAAGATGG + Intergenic
991757871 5:69896346-69896368 GTGAGGATACCGAGAGAAGATGG - Intergenic
991788768 5:70218525-70218547 GTGAGGATACCGAGAGAAGATGG + Intergenic
991791206 5:70236572-70236594 GTGAGGATACCGAGAGAAGATGG + Intergenic
991813519 5:70493631-70493653 GTGAGGATACCGAGAGAAGATGG + Intergenic
991816651 5:70514914-70514936 GTGAGGATACCGAGAGAAGATGG + Intergenic
991819091 5:70532955-70532977 GTGAGGATACCGAGAGAAGATGG + Intergenic
991837274 5:70772228-70772250 GTGAGGATACCGAGAGAAGATGG - Intergenic
991881215 5:71218889-71218911 GTGAGGATACCGAGAGAAGATGG + Intergenic
991883652 5:71236913-71236935 GTGAGGATACCGAGAGAAGATGG + Intergenic
991930603 5:71749822-71749844 GGGAGGATGTGGAGGGAGGGAGG + Intergenic
992403478 5:76432932-76432954 GTGAGGAAGCTGAGGGAAGGAGG - Intronic
992465886 5:77003981-77004003 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
992648402 5:78833549-78833571 GGGAGGCAGTGGAGGGAGGAAGG + Intronic
992832540 5:80608337-80608359 GGGAGGCTGTGGTGGGAAGATGG + Intergenic
992986260 5:82233704-82233726 GTAAGGAAGTTGAGGGCAGAGGG - Intronic
993140820 5:84031027-84031049 GTGAAGACATGGAGAGAAGATGG - Intronic
993141019 5:84033597-84033619 GTGAGGTTGAGGTGGGAGGATGG + Intronic
993391959 5:87329335-87329357 GGGAGGCTGTGGTGGGAAGATGG + Intronic
993472138 5:88319054-88319076 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
993525164 5:88956368-88956390 GAGAGGAAGTGTTGGGAAGAGGG + Intergenic
993775314 5:91987236-91987258 AGGAGGATGTGGAGGGAACCTGG + Intergenic
994419984 5:99519901-99519923 GTGAGGATACTGAGAGAAGATGG - Intergenic
994487226 5:100395241-100395263 GTGAGGATACTGAGAGAAGATGG + Intergenic
994727793 5:103456715-103456737 GTTAGGGTGTGGATGGAAGGAGG - Intergenic
994728876 5:103468862-103468884 GTCAGGATCAGGAGGGGAGAGGG - Intergenic
996352145 5:122556277-122556299 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
996469594 5:123844557-123844579 GTGAGGATGCTGAAAGAAGATGG - Intergenic
996732079 5:126726124-126726146 GAGAGAATGAGGAGGGAAGTAGG + Intergenic
996798665 5:127378555-127378577 GGGAGGCTGAGGTGGGAAGATGG - Intronic
997477735 5:134155897-134155919 GAGAGGCTGAGGTGGGAAGATGG - Exonic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998066661 5:139164734-139164756 GTAAGGAAGAGGTGGGAAGATGG + Intronic
998305259 5:141069804-141069826 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
998316303 5:141185640-141185662 GGGAGGCTGAGGAGGGAGGATGG - Exonic
998662110 5:144250389-144250411 GTGAGTATGGGGAGGGAAGTGGG + Intronic
998757821 5:145400016-145400038 GTGAGGGTGTGGAGATAATATGG - Intergenic
999156951 5:149464885-149464907 GTGAGGGTCTGGCTGGAAGATGG - Intergenic
999229538 5:150053517-150053539 GTGAGGCTGTGGAGTGAAGGCGG + Exonic
999672651 5:153971365-153971387 GTGAGGATGGAGAGAGGAGATGG - Intergenic
999672981 5:153973917-153973939 ATGAGGACATGGAAGGAAGAGGG - Intergenic
999835363 5:155364522-155364544 GTGAGGATGAGAAGAGAAGAGGG + Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1001209186 5:169794283-169794305 GTGGGGAAGTGGAGGGAAGGAGG - Intronic
1001219074 5:169883658-169883680 GCGAGTAGGTGGGGGGAAGATGG + Exonic
1001224537 5:169932409-169932431 GAGAGAATGGGGAAGGAAGATGG + Intronic
1001682490 5:173569267-173569289 GGGAGGGGGTAGAGGGAAGAAGG + Intergenic
1001919376 5:175588522-175588544 GGGAGGAGAGGGAGGGAAGAAGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1001961216 5:175881146-175881168 GTGGGGATGGTGAGGGAAGAGGG + Exonic
1002074563 5:176700460-176700482 GCGAGGATTTGTAGGGGAGAGGG + Intergenic
1002123336 5:177022720-177022742 GTGAGGGTTTGCGGGGAAGATGG + Exonic
1002361370 5:178673891-178673913 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
1002406989 5:179042453-179042475 GGGAGGGTGAGGAGGGAAGTAGG + Intergenic
1002614477 5:180442222-180442244 GACAGGATGTGGAGGGGAGAGGG + Intergenic
1002768056 6:260304-260326 GCAAGAATGTGGAGGGAAGGAGG - Intergenic
1002850909 6:995645-995667 TTGAGGATGGAGAGGGAAGGAGG - Intergenic
1002851853 6:1003643-1003665 GTGTGGATGTGGAGAGAGGTGGG - Intergenic
1003130664 6:3392756-3392778 CTGAGGATGTGGGAGGAAGGAGG + Intronic
1003263557 6:4546808-4546830 GTGTGGACTTGGAGGGAAGGGGG + Intergenic
1003385771 6:5666030-5666052 GGCAGGATCTGGAGGGAGGAAGG + Intronic
1003420484 6:5953274-5953296 GTGGGGATGGGGAGGGAAATGGG - Intergenic
1003483106 6:6551160-6551182 GTGAGGATCTGGAAGGAGGCAGG + Intergenic
1003491740 6:6628268-6628290 GGGAGGAAGGGGAGGGAAGGAGG - Intronic
1003600444 6:7512058-7512080 GGGAGGATGAGGTGGGAAGATGG + Intergenic
1003822172 6:9910902-9910924 GTGATGATGGGGAGGAGAGATGG - Intronic
1003901485 6:10659607-10659629 GTGAGGAGGGGGAGAGGAGAGGG + Intergenic
1003968689 6:11278076-11278098 CTGAGGCTGTGGAGAGAAGCAGG - Intronic
1004144742 6:13054874-13054896 TTGAGGATGTAGAGGGAAGAAGG - Intronic
1004189014 6:13447993-13448015 GGGTGGATTTGGAGGGAGGAGGG + Intronic
1004704955 6:18116209-18116231 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1004816450 6:19316286-19316308 GTGAGGATACAGAGAGAAGACGG + Intergenic
1005211306 6:23467444-23467466 TTGAGGATGTAAAGGGAGGATGG + Intergenic
1005265218 6:24105262-24105284 GAGAGTATGTGGAGGGAAGTGGG - Intergenic
1005280336 6:24267165-24267187 GTGAGGGTGAGGAGTGGAGATGG + Intronic
1005310552 6:24555103-24555125 GTAAGGATGTGGAAGGAATGAGG - Intronic
1005473466 6:26184643-26184665 GTGAGGCGGTAGAGGGAAGAGGG - Intergenic
1005550029 6:26902717-26902739 GTGAGGATACTGAGAGAAGATGG + Intergenic
1005677008 6:28165036-28165058 GTGAGAAAGTGGGTGGAAGAGGG - Intergenic
1005805282 6:29468538-29468560 GTGTGGATGTGGGGAGAGGAGGG + Intergenic
1006108647 6:31731004-31731026 CTGAGGATGGGGAGAGGAGAGGG + Intronic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1006808443 6:36804561-36804583 GTGAGGTTGTTGAAGGAGGAGGG - Intronic
1006945051 6:37779320-37779342 GGGTGGAGGGGGAGGGAAGAAGG + Intergenic
1007150980 6:39690598-39690620 GTAAAGATGAGGAGGGAAGGAGG + Intronic
1007245764 6:40461165-40461187 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1007533551 6:42564301-42564323 GGGAGGAGGAGGAGAGAAGATGG + Exonic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1007976815 6:46110189-46110211 GTGAGAATGTGGAGGACAAAAGG - Intergenic
1008936421 6:56997414-56997436 GTGTGTATGTGGTGGGGAGATGG - Intronic
1009020292 6:57941616-57941638 GTGAGGATACTGAGAGAAGATGG + Intergenic
1009558581 6:65208309-65208331 ACAAGGATGTGGAGAGAAGAAGG + Intronic
1009720872 6:67467617-67467639 GTTAGGATTTGAAGGAAAGAGGG - Intergenic
1010461538 6:76119456-76119478 GTGAGTAAGTTGAGGAAAGATGG + Intergenic
1011009908 6:82692128-82692150 GTGTGTATGTGGAGGGGAGGAGG - Intergenic
1011221436 6:85058355-85058377 TTGAGTTTGAGGAGGGAAGAAGG + Intergenic
1011443446 6:87411922-87411944 GTGAGGATGCAGAGAAAAGATGG + Intronic
1011494225 6:87922825-87922847 GGGAGGCTGTGGAGGAGAGATGG + Intergenic
1011532120 6:88334112-88334134 GCGAGGAAGTGGAGGAAAGTGGG + Intergenic
1011542597 6:88448222-88448244 GTGAAGATGTGGAGAGAAATTGG + Intergenic
1011632339 6:89339551-89339573 GAAGGGATGGGGAGGGAAGAGGG + Intronic
1011681910 6:89791730-89791752 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1011723512 6:90184467-90184489 GTGAAGGGGTGGAGGGAGGAAGG - Intronic
1011997623 6:93613120-93613142 GTGGGGCGGTGGGGGGAAGAGGG + Intergenic
1012066916 6:94559665-94559687 ACGAAAATGTGGAGGGAAGAAGG + Intergenic
1012311083 6:97724657-97724679 GTGAGTATATGGAGAGAAAACGG + Intergenic
1012454847 6:99392527-99392549 GTGTGTAGGTGGAGGGCAGAAGG - Intronic
1012688126 6:102277721-102277743 ATTAGAATGTGGAGGGAGGAGGG - Intergenic
1012914172 6:105150774-105150796 GTGAGGATGTGGAGAAAGGTTGG - Intergenic
1012953688 6:105545659-105545681 GTGTGGATGAGGAGAGCAGAAGG - Intergenic
1013009916 6:106110637-106110659 GGGAGGATGAGGTGGGAGGATGG - Intergenic
1013118397 6:107120467-107120489 GAGAGGGTGAGGTGGGAAGATGG - Intergenic
1013413073 6:109898739-109898761 GAGAGGCTGAGGTGGGAAGATGG - Intergenic
1013422384 6:109978494-109978516 TTGAGGATGTGGGGAGAGGAGGG + Intronic
1013480307 6:110547172-110547194 GGGAGGCTGGGGTGGGAAGATGG + Intergenic
1013512371 6:110856766-110856788 TTCAGGCTCTGGAGGGAAGAAGG + Intronic
1013878216 6:114860617-114860639 GTGGGGGTGTGGAGGGTAGGGGG + Intergenic
1014159717 6:118154002-118154024 CTGAGGATGAGGTGGGAATATGG + Intronic
1014340336 6:120197647-120197669 TTGAGGAGGAGGAGGGATGATGG - Intergenic
1014344685 6:120253194-120253216 GTCAGGAAGTGGAGGGCAGGGGG + Intergenic
1014648366 6:124004432-124004454 GGGAGGGTGGGGAAGGAAGAGGG + Intronic
1014688636 6:124533870-124533892 GTGAGGACACAGAGGGAAGATGG - Intronic
1014937091 6:127397680-127397702 GTGAGGATGTGGGGGTAAACAGG - Intergenic
1015042524 6:128739462-128739484 GTGAGGCTGAGGTGGGTAGATGG - Intergenic
1015072034 6:129106021-129106043 GTGAGAAGGTGGTGGTAAGAAGG - Intronic
1015257642 6:131197938-131197960 GTGAGGATGTGGAGGTTGAAAGG + Intronic
1015568789 6:134600980-134601002 GTGAGGATGTGGGGGTTAAAAGG + Intergenic
1015570833 6:134619708-134619730 GTGAGGAGATGCAGGGAGGATGG + Intergenic
1015810827 6:137160579-137160601 AGGAGGAGGAGGAGGGAAGAAGG - Intronic
1015970805 6:138741225-138741247 GCAGGGATGGGGAGGGAAGATGG - Intergenic
1016390161 6:143566396-143566418 GTGAGGCTGAGGTGGGAGGATGG - Intronic
1016526502 6:145007245-145007267 GTGAGGACGCGGTGAGAAGATGG + Intergenic
1016679231 6:146809022-146809044 GTGAGAATGTGGAGGTCAAAAGG + Intronic
1016679796 6:146815966-146815988 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
1016792366 6:148079173-148079195 GTGAGGAAGGAGAGTGAAGAGGG + Intergenic
1016848337 6:148591485-148591507 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1017081490 6:150673651-150673673 GAGAGGGAGGGGAGGGAAGAGGG - Intronic
1017108954 6:150914190-150914212 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1017385276 6:153875875-153875897 GTGAGGGTGTGGAGGGGTGAGGG - Intergenic
1017517254 6:155167734-155167756 GGGAGGTTGAGGTGGGAAGATGG - Intronic
1017858783 6:158376108-158376130 GAGAGGAGGTGCAGGGAAAAGGG - Intronic
1018033794 6:159865188-159865210 GTGGGGATGTGGGGTGAAGAGGG + Intergenic
1018373825 6:163192753-163192775 GTGTGTATTTGCAGGGAAGATGG + Intronic
1018609109 6:165629636-165629658 GGGAGGCTGGGGTGGGAAGATGG - Intronic
1018770744 6:166969661-166969683 AAGAGGATGTGAAGGGCAGAAGG - Intergenic
1018897172 6:168027697-168027719 GTGGGGATGTGGAGGGAAGCCGG - Intronic
1019079153 6:169417808-169417830 GGGAGTATGGTGAGGGAAGAGGG - Intergenic
1019106470 6:169671649-169671671 GTGAGGGTGAGAAGGGATGAAGG - Intronic
1019347188 7:536898-536920 GGGAGGCTGAGGCGGGAAGATGG + Intergenic
1019358436 7:592929-592951 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1019457404 7:1137701-1137723 GGGAGGATGAGGCGGGAGGACGG + Exonic
1019746056 7:2700926-2700948 GTCAGGATGGGGTGGGAGGAAGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019797204 7:3059584-3059606 GGGAGGCTGAGGCGGGAAGACGG + Intergenic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1019993002 7:4705290-4705312 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1019997218 7:4732395-4732417 GGGAGGCTGAGGAGGGAAGATGG - Intronic
1020108587 7:5434859-5434881 GTGAGGACGTAGGGAGAAGACGG - Intronic
1020283541 7:6663779-6663801 GTGGGGGGGTGAAGGGAAGAGGG + Intergenic
1020441098 7:8217365-8217387 GTGTAGAGGTGGAGGGAAGGAGG - Intronic
1020508391 7:9020936-9020958 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1020693284 7:11385863-11385885 GTGAGGGGGTGGAGGTAAGGGGG - Intronic
1020847508 7:13306117-13306139 GTGAGGATGCGGAGAAAAAAAGG + Intergenic
1021038804 7:15835386-15835408 GTGAGGAATTGGAGGGAACCTGG + Intergenic
1021056764 7:16058717-16058739 GTTAGGAGATGGAGGAAAGAGGG + Intergenic
1021174667 7:17437428-17437450 GTGGGGAATTGGAGGGCAGAAGG + Intergenic
1021192461 7:17637389-17637411 GGGAGGATGGGGAGGAAAGCTGG + Intergenic
1021732789 7:23612566-23612588 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1021795075 7:24246371-24246393 GTGAGGTTGAGGAGGCAACAGGG - Intergenic
1021969969 7:25956168-25956190 GGTAGGACGTGGAGGGAAGGAGG + Intergenic
1021979393 7:26039862-26039884 ATCAGAATGTGCAGGGAAGAGGG + Intergenic
1022159532 7:27695297-27695319 ATGATGCTGTGGAGGGCAGAGGG - Intergenic
1022309838 7:29186465-29186487 GGGAGGCTGAGGAGGGAGGATGG + Exonic
1022454403 7:30545976-30545998 GTGAGAATGTGGAGGTCAAAAGG - Intronic
1022473337 7:30694890-30694912 GGGATGATGAGGAGAGAAGAAGG + Intronic
1022557528 7:31313834-31313856 GGGAAGAGGTGGTGGGAAGAAGG - Intergenic
1022633216 7:32105640-32105662 GGGAGGATGAAGAGGGAGGATGG - Intronic
1022733420 7:33053554-33053576 GGGAGGCTGAGGGGGGAAGACGG + Intronic
1022780710 7:33579749-33579771 GTGAGGAGGTGGAGGGAATTGGG - Intronic
1022833121 7:34088161-34088183 GCCAGGATGTGGTGGGAAGTAGG + Intronic
1023179135 7:37463668-37463690 GTGAGGAAGTGGGGAGAGGAAGG + Intergenic
1023275862 7:38517993-38518015 GTGAGCCTGTGGAGGGTGGAGGG - Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023618784 7:42048582-42048604 GTAGGGATGTGGAGGGCTGAAGG + Exonic
1023770661 7:43553840-43553862 TTGTGCAAGTGGAGGGAAGAAGG - Intronic
1023862998 7:44226797-44226819 GGGGGGGTGTGGGGGGAAGATGG + Intronic
1023910579 7:44552862-44552884 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1024145603 7:46513535-46513557 GTGAGGATGTGGAGGAATGAGGG - Intergenic
1024295965 7:47842579-47842601 ATGAAGATGGGGTGGGAAGAAGG - Intronic
1024525254 7:50343158-50343180 GGGAGGGTGGGGAGGGAAGGAGG - Intronic
1025056599 7:55770405-55770427 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1026009837 7:66628467-66628489 TGGAGGATGTGGCGGGAGGAGGG - Intergenic
1026134402 7:67646798-67646820 TTGAGGATGTGGAGGAGGGAAGG - Intergenic
1026305246 7:69134735-69134757 GAGAGGAAGAGGAGGAAAGAGGG - Intergenic
1026355396 7:69552962-69552984 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1026403165 7:70036873-70036895 GTGGGGATGTAGAGGGACAAAGG + Intronic
1026527881 7:71171394-71171416 GGGACGATGAGGCGGGAAGATGG + Intronic
1027224990 7:76238072-76238094 CTGAGGATGGGGAGGGCAGGGGG - Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027584334 7:80039211-80039233 GTAAGGATGTTGAAAGAAGAAGG + Intergenic
1027837465 7:83263756-83263778 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1028447000 7:90935807-90935829 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1028684375 7:93575524-93575546 GAGAGGATGGCGAGGGAAGACGG + Intergenic
1029159557 7:98541777-98541799 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1029438752 7:100576145-100576167 CAGAGGATGTGGAGGGAGGCTGG + Intronic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1029985662 7:104921012-104921034 GTGGGGTGGGGGAGGGAAGATGG - Intergenic
1030088133 7:105834849-105834871 GTGATGGAGTGGAGGGGAGAGGG + Intronic
1030630350 7:111888723-111888745 GTGAGGAAGAGGGGGGAAGATGG - Intronic
1031247688 7:119337675-119337697 GTGAGGAGGGAGAGGGAGGAGGG - Intergenic
1032003522 7:128282188-128282210 CTGAGGATGAGGAGTGAAGGAGG + Intergenic
1032392200 7:131562604-131562626 GTGTGGATGGGAAGGGAAGGAGG + Intergenic
1032850878 7:135794083-135794105 GTGAGTATTTGGTTGGAAGAGGG + Intergenic
1032960439 7:137027355-137027377 GTGAGGATGGAGAGGAAGGAGGG - Intergenic
1033116814 7:138632682-138632704 TGGAGAATGTGCAGGGAAGATGG + Intronic
1033342906 7:140505889-140505911 GTGAGGATATGGGGAGAAGGTGG - Intergenic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1033363140 7:140652054-140652076 GTGAGTGTGGGGTGGGAAGAGGG + Intronic
1033449351 7:141448927-141448949 GTGAACAGGAGGAGGGAAGAGGG + Intronic
1033521731 7:142167675-142167697 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1033554805 7:142479567-142479589 GTGAGGCTGTCGAAGGGAGAGGG + Intergenic
1033597416 7:142867374-142867396 GTGTGGATGTGGAGGGCTGTGGG + Intronic
1033646231 7:143306733-143306755 GAGAGGCTGAGGCGGGAAGATGG - Exonic
1033668403 7:143465588-143465610 GGTAGGATGTGGAGGGGAAAGGG - Intergenic
1033832667 7:145272325-145272347 GTGAGAATCTTCAGGGAAGAGGG + Intergenic
1034218848 7:149429108-149429130 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1034402703 7:150876078-150876100 GTGAGGACGCAGTGGGAAGATGG - Intergenic
1034416220 7:150965587-150965609 GGGAGGAGTTGGAGGGAAGAGGG - Intronic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034465439 7:151225772-151225794 GTAAGTTTTTGGAGGGAAGACGG + Intronic
1034816560 7:154176936-154176958 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1035044500 7:155954785-155954807 GTCAGGAGGTGGAGGGCAGGAGG - Intergenic
1035173906 7:157037100-157037122 GTGGGGATGAGGAGGGCAGGAGG - Intergenic
1035657363 8:1320119-1320141 GTGAGGAAGAGGAGGGCTGAAGG + Intergenic
1035987540 8:4451224-4451246 GGGAGGCTAAGGAGGGAAGATGG + Intronic
1036042527 8:5101846-5101868 GGGAGGTTGAGGTGGGAAGATGG - Intergenic
1036575851 8:10027172-10027194 GTGAGGAAATGGCGGGGAGAAGG - Intergenic
1036576569 8:10032976-10032998 GGAAGGAAGGGGAGGGAAGAAGG - Intergenic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036999021 8:13695458-13695480 GGGTGGATGTGGAGGGATGCTGG + Intergenic
1037219428 8:16499716-16499738 GTGAGAATGTGGAGGTCAAAAGG - Intronic
1037386409 8:18347422-18347444 GTGTGCAGGTGGAGGGGAGATGG + Intergenic
1037473663 8:19236497-19236519 GGGAGGATGTGGGGGTAGGAGGG + Intergenic
1037886591 8:22599224-22599246 GAGAGGGTGGGGAGGGGAGAGGG - Intronic
1037927044 8:22851744-22851766 GCGAGGACTTGGGGGGAAGAGGG + Intronic
1038129829 8:24717663-24717685 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1038150948 8:24942114-24942136 GGGAGGAGGAGGAGGGAGGAGGG - Intergenic
1038461358 8:27720062-27720084 CAGAGGATGGGGAGGGATGAGGG + Intergenic
1038524494 8:28261424-28261446 GTGAAGACATGGAGAGAAGACGG + Intergenic
1038709026 8:29923464-29923486 GTTGGGATGGGGAGTGAAGAGGG - Intergenic
1038969989 8:32622505-32622527 GGGAGGCTGAGGAAGGAAGATGG - Intronic
1039212917 8:35236211-35236233 GAGAGGAAGTGGAGAGGAGAGGG - Intronic
1039917016 8:41867583-41867605 GGAAGGATGTGGTGGGCAGAGGG - Intronic
1039957284 8:42217380-42217402 GTAAGGATTTGAAGAGAAGAGGG + Intergenic
1039971524 8:42324996-42325018 GGGAGGATGTGGAGCCAGGATGG + Intronic
1040437400 8:47404711-47404733 GAGAGGATGTGGAGAGAAATAGG + Intronic
1040661180 8:49577643-49577665 CTGAGGAATGGGAGGGAAGAAGG - Intergenic
1041497768 8:58505955-58505977 ATGAGGAAGTAGAGGCAAGAAGG + Intergenic
1041719588 8:60964138-60964160 GAGGGGGTGGGGAGGGAAGAAGG + Intergenic
1041726457 8:61022165-61022187 GTGAGGATGTGCAGGGAAATCGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1041853594 8:62421891-62421913 GTCAGTATGTGGTGGGAAGCTGG + Intronic
1042057552 8:64782037-64782059 GAGAGGATGGTAAGGGAAGATGG - Intronic
1043153363 8:76746298-76746320 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1043523796 8:81074313-81074335 GTGAGGATCATGAGGGAAGAGGG + Intronic
1044164364 8:88962974-88962996 GAGAGGAAGTGGAGTGAAGGGGG + Intergenic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1044667711 8:94647900-94647922 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1044734037 8:95259347-95259369 GTGAGAAAGTGGAGGCAGGAAGG + Intronic
1044843239 8:96355842-96355864 GGGAGGCTGCGGTGGGAAGATGG + Intergenic
1044974905 8:97654985-97655007 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1045179915 8:99769917-99769939 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1045281126 8:100750554-100750576 TTTAGGAAGAGGAGGGAAGAGGG + Intergenic
1045618660 8:103949020-103949042 GAGAGGATGAGGTGGTAAGATGG + Intronic
1045962880 8:107989379-107989401 TGGAGGAGGTAGAGGGAAGAAGG - Intronic
1046411495 8:113849218-113849240 GTGAGGTTGTGGGGGAAAAAAGG - Intergenic
1046449959 8:114375904-114375926 GTGAGGGAGTGGGGGGGAGAAGG - Intergenic
1046555455 8:115768309-115768331 GGGAGGAAGGGAAGGGAAGAAGG - Intronic
1046555486 8:115768453-115768475 GGGAGGAAGAGAAGGGAAGAAGG - Intronic
1046555502 8:115768510-115768532 GGGAGGAAGAGAAGGGAAGAAGG - Intronic
1046555567 8:115768735-115768757 GGGAGGAAGGGAAGGGAAGAAGG - Intronic
1046562429 8:115854890-115854912 ATGTGGATGTGGAGGCAAAAGGG - Intergenic
1046708412 8:117481095-117481117 ATGTGGATGTGGAAAGAAGAAGG + Intergenic
1046829633 8:118730340-118730362 GTGAGGGTGGGGAAGGGAGATGG - Intergenic
1046885188 8:119359053-119359075 GTGAGTATGTGGAAGGAGAAGGG + Intergenic
1046910951 8:119626116-119626138 GGGAGGCTGAGGCGGGAAGATGG + Intronic
1047300748 8:123611886-123611908 GTGTGCATGTGTAGGGAAGTAGG + Intergenic
1047507190 8:125489152-125489174 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1047676633 8:127209562-127209584 GGGAGGGTGGGGAGGGAAGATGG + Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1047802184 8:128321485-128321507 GTGAGGGTGTGCAGGGGTGAGGG + Intergenic
1047830848 8:128628137-128628159 AGGAGGATGGGGAAGGAAGAGGG - Intergenic
1048516564 8:135116778-135116800 GGGAGGAGGAGGAGAGAAGAAGG - Intergenic
1048544375 8:135372683-135372705 GTGAGGACATGGGGGGAAGATGG + Intergenic
1048831544 8:138482249-138482271 GTGAGGAAGTGTAGGGAAGAGGG + Intronic
1048876642 8:138841678-138841700 TTGACGAAGAGGAGGGAAGAGGG + Intronic
1049083134 8:140457917-140457939 GGGAGGAGGAGGAGGGAGGAGGG + Intronic
1049097628 8:140558227-140558249 GTGAGGCTCAGGAAGGAAGAGGG + Intronic
1049886533 9:30757-30779 GTGAGGATGCGAAGAGAAGGTGG + Intergenic
1050160343 9:2712211-2712233 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1051297339 9:15610660-15610682 GAGAGGCTGAGGTGGGAAGATGG - Intronic
1051531415 9:18108302-18108324 GGGAGGATGAGGTGGGAAGATGG - Intergenic
1051559599 9:18425613-18425635 AGGAGGCTGAGGAGGGAAGATGG + Intergenic
1051669250 9:19493815-19493837 GTTCCGATGAGGAGGGAAGATGG + Intergenic
1051844687 9:21438253-21438275 ATGTGGATGTGGAGGCATGAGGG + Intronic
1051888657 9:21921729-21921751 GTGAGGCTGAAGAGGGCAGATGG + Intronic
1051944227 9:22547064-22547086 GTGAAGATGTGGAGAGGAGATGG - Intergenic
1052104575 9:24497141-24497163 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1052333650 9:27297568-27297590 GTGAGAAGGAGGATGGAAGAAGG + Intergenic
1052405790 9:28059248-28059270 GTGAGAATGTGGAGGTCAAAAGG - Intronic
1052529316 9:29659936-29659958 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
1052538255 9:29775701-29775723 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
1052715927 9:32117074-32117096 ATGTGCATGTGGAGAGAAGATGG - Intergenic
1052951994 9:34220100-34220122 GAGGGGAGGGGGAGGGAAGAGGG - Intronic
1053289143 9:36868539-36868561 GTGAGGATGGGGAGGGAGAAAGG + Intronic
1053461991 9:38278360-38278382 GTGAGGATGGGGGAGGAACAGGG - Intergenic
1053522190 9:38791491-38791513 GTGTGGAGGGGGTGGGAAGAAGG - Intergenic
1053542787 9:38992719-38992741 GTGGTCATTTGGAGGGAAGAAGG + Intergenic
1053599334 9:39594117-39594139 GTGAGAATGTACAGGAAAGAAGG - Intergenic
1053693436 9:40612462-40612484 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1053752011 9:41266612-41266634 GTGGGGAAGGGGAGGGACGAGGG - Intergenic
1053807235 9:41816236-41816258 GTGGTCATTTGGAGGGAAGAAGG + Intergenic
1053857039 9:42348303-42348325 GTGAGAATGTACAGGAAAGAAGG - Intergenic
1053940424 9:43242856-43242878 ATGAGGCTGAGGTGGGAAGACGG - Intergenic
1054254190 9:62748269-62748291 GTGAGAATGTACAGGAAAGAAGG + Intergenic
1054257532 9:62830942-62830964 GTGGGGAAGGGGAGGGACGAGGG - Intergenic
1054271394 9:63027623-63027645 ATGAGGCTGAGGTGGGAAGATGG + Intergenic
1054304679 9:63411690-63411712 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1054333781 9:63784780-63784802 GTGGGGAAGGGGAGGGACGAGGG + Intergenic
1054403426 9:64735711-64735733 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1054437048 9:65221199-65221221 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1054493350 9:65800793-65800815 ATGAGGCTGAGGTGGGAAGATGG + Intergenic
1054568255 9:66782439-66782461 GTGAGAATGTACAGGAAAGAAGG + Intergenic
1054623357 9:67371191-67371213 GTGGTCATTTGGAGGGAAGAAGG - Intergenic
1054825330 9:69567564-69567586 GTGGGGTTGTGGAGGGGGGAGGG - Intronic
1054902141 9:70380568-70380590 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1055115143 9:72597872-72597894 GTGAGGTTATGGAATGAAGATGG - Intronic
1055228576 9:74031707-74031729 GTGAGAATGGGAAGGGAAGGAGG + Intergenic
1055283882 9:74706918-74706940 GTGAGGATGGGGCGATAAGAAGG + Intergenic
1055397717 9:75891926-75891948 GAAAGGAGGGGGAGGGAAGAGGG + Intronic
1055407431 9:75989387-75989409 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1055494932 9:76844594-76844616 GTATGTATGTGGAGGGGAGATGG - Intronic
1055818159 9:80231768-80231790 GCCAGGATGTGGAGTGAAGAGGG + Intergenic
1055825867 9:80323881-80323903 GTGAGGATGAGGAAGGTAGCTGG - Intergenic
1055831028 9:80379096-80379118 GTTGGGATGTGGGTGGAAGAGGG - Intergenic
1056020945 9:82437743-82437765 GGGAGGATGAGGTGGGAGGATGG + Intergenic
1056021248 9:82440640-82440662 CTGAGGCTGTGCAGGGAAGCTGG - Intergenic
1056198659 9:84253279-84253301 ATGAGGCTGTGTAGGGAAGAGGG - Intergenic
1056410328 9:86319935-86319957 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1056587847 9:87939953-87939975 GTGACGAGGAGGAGGAAAGAGGG + Intergenic
1056609020 9:88112992-88113014 GTGACGAGGAGGAGGAAAGAGGG - Intergenic
1056911783 9:90707713-90707735 GGGTGGATGTGTGGGGAAGATGG - Intergenic
1057070949 9:92099582-92099604 GGGAGGATGAGGTGGGAAGATGG - Intronic
1057149873 9:92787177-92787199 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1057519362 9:95749083-95749105 GGGAGGCTGTGGTGGGAGGATGG - Intergenic
1057744777 9:97742083-97742105 AGGAGGAGGAGGAGGGAAGAAGG + Intergenic
1057791885 9:98130183-98130205 GGGAGGCTGAGGCGGGAAGATGG - Intronic
1057851480 9:98570131-98570153 GTGAGGGAGTGGAGGCAAGGAGG - Intronic
1058090672 9:100802214-100802236 GTGAGTATCTGGAGGGATGAAGG + Intergenic
1058119536 9:101123621-101123643 GTGAGAATGTGGAGGTCAAAGGG + Intronic
1058373644 9:104298388-104298410 GGGAGGATTTGGAGGATAGAGGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058923592 9:109640733-109640755 GTGCGGGTGGGGAGGGGAGACGG + Intergenic
1058989892 9:110245512-110245534 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1059108410 9:111531784-111531806 ATGAGGCTGAGGAGGGAGGATGG - Intronic
1059639618 9:116203949-116203971 TTGAGGTTGTAGAAGGAAGAAGG + Intronic
1060227682 9:121804591-121804613 GCAAGGATGTGGAGAGAAAAGGG - Intergenic
1060265708 9:122110444-122110466 GTGAGGATGGGGTTTGAAGAGGG - Intergenic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1061265461 9:129502234-129502256 GTGAGGATGTGGAATGGAGTGGG + Intergenic
1061278825 9:129585391-129585413 GGGAGGGAGGGGAGGGAAGAAGG + Intergenic
1061287739 9:129633719-129633741 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1061451267 9:130668084-130668106 GTGTGGATGTGCCTGGAAGATGG + Intronic
1061690090 9:132320487-132320509 GGGAGGTTGAGGAGGGAAAATGG + Intronic
1061807066 9:133142551-133142573 GTGAGGAAGTGGAGAGGAAAGGG - Intronic
1061895605 9:133645649-133645671 GTAGGGGTGTCGAGGGAAGAAGG + Intronic
1062719096 9:138025678-138025700 GTGAGCAAGGGGAGGAAAGAAGG - Intronic
1203492345 Un_GL000224v1:118994-119016 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1203504968 Un_KI270741v1:60866-60888 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1185449521 X:275096-275118 GGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1186398184 X:9231799-9231821 GTGAGGATGTGAAGGGCAGCCGG + Intergenic
1186480485 X:9893205-9893227 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1186494099 X:9998125-9998147 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1186576776 X:10775130-10775152 GGGAGGAGGGGGAGGGGAGATGG + Intronic
1186597803 X:11002818-11002840 GTGTGGATGTTGGGGGAGGAGGG - Intergenic
1186621303 X:11243224-11243246 GTGAGTAGGTGGAGGGGAGCAGG - Intronic
1186630109 X:11339512-11339534 GTGAGGAAATGGAGGTATGATGG - Intronic
1187035979 X:15539939-15539961 GAGAGGATGTGGAGAGAAATAGG + Intronic
1187342444 X:18433121-18433143 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1187743751 X:22385541-22385563 GTGTGGATGTTGGGGGTAGATGG - Intergenic
1187758012 X:22547275-22547297 GTGCTGATTTGGAGGGGAGAAGG + Intergenic
1187995766 X:24924794-24924816 GTAAGGGTGTGGAGGAAGGAAGG + Intronic
1188058966 X:25577040-25577062 GTTAGGATGGGGAGTGAAGGTGG - Intergenic
1188489659 X:30723816-30723838 GGGAGGGTGAGGAGGGAGGATGG - Intronic
1188735821 X:33714120-33714142 GTGAGGAGGTGTTGGGAATAAGG + Intergenic
1188845503 X:35066999-35067021 ATGAGGACGTGGAGAAAAGAGGG - Intergenic
1188945019 X:36290019-36290041 GAGAGGGTGTGGAGGGAGAATGG - Intronic
1189247117 X:39571810-39571832 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1189468844 X:41298672-41298694 GAGAGGAGGAGGAGAGAAGAAGG - Intergenic
1189560135 X:42183829-42183851 GTGTGGAAGTGCAGAGAAGATGG + Intergenic
1189579304 X:42388929-42388951 GTGGGGTTGGGAAGGGAAGATGG + Intergenic
1189872397 X:45397656-45397678 GTGACACTGTGGAAGGAAGAGGG + Intergenic
1190150534 X:47943861-47943883 GTGAGGATGGGGAGGGGATCTGG - Intronic
1190203125 X:48381260-48381282 GGGAAGATGGGAAGGGAAGAAGG - Intergenic
1190207413 X:48414149-48414171 GGGAAGATGGGAAGGGAAGAAGG + Intergenic
1190305491 X:49079412-49079434 TTGAGGATTTGAAGGGAAGTTGG - Intronic
1190337040 X:49269059-49269081 GGGAGGACTTGGAGGCAAGATGG - Intergenic
1190458247 X:50645687-50645709 GAGAGGTGGTGGAGGGAAAAGGG + Intronic
1190464808 X:50715697-50715719 GTGAGGCTGTGGAGGAAAGGTGG + Intronic
1190515924 X:51223519-51223541 GGGAGGATGAGGAAAGAAGAGGG + Intergenic
1191796279 X:65025251-65025273 GGGAGGCTGTGGTGGGAGGATGG - Intronic
1192267944 X:69552937-69552959 GTGAGGATGTGATGAGAAGATGG - Intergenic
1192594191 X:72388826-72388848 GTGAGAATGTGGCAGGAAGGTGG + Intronic
1192639258 X:72847030-72847052 GGGAGGAGGTTGAGGGAACAGGG + Intronic
1192642453 X:72873775-72873797 GGGAGGAGGTTGAGGGAACAGGG - Intronic
1193516985 X:82478261-82478283 CTGAGGATCTGGAGGGAGGCAGG - Intergenic
1193824452 X:86205663-86205685 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1193933990 X:87592491-87592513 GTGAGGATGTGGAGAAAAGGGGG - Intronic
1194050530 X:89062140-89062162 GAGAGGATGTGGAGAAAAAAAGG + Intergenic
1194956725 X:100189662-100189684 ATCAGAGTGTGGAGGGAAGAAGG + Intergenic
1195115241 X:101691034-101691056 GGGAGGCTGAGGTGGGAAGACGG - Intergenic
1195301178 X:103531134-103531156 GAGAGCATATGGAGAGAAGAAGG - Intergenic
1195343434 X:103926382-103926404 GTGAGGATATGGATGGAGCAGGG + Intronic
1195363563 X:104107085-104107107 GTGGGGATGTGGATGGAGCAGGG - Intronic
1195364149 X:104111609-104111631 GTGAGGAGGTAGTGGGGAGAGGG - Intronic
1195548536 X:106139720-106139742 GTGGTCATGTGGAGGAAAGAAGG - Intergenic
1195860695 X:109380060-109380082 GAGATGGCGTGGAGGGAAGAAGG + Intronic
1196322677 X:114360707-114360729 GTGGGAAAGTGGAGGGGAGATGG + Intergenic
1197032435 X:121833588-121833610 GTGAGGGTTGGGAGGGAAGTGGG + Intergenic
1197555591 X:127948685-127948707 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1197969187 X:132097119-132097141 GTGAGGATCTGGAGAGAGGATGG - Intronic
1198764190 X:140064177-140064199 GTGAGGATGTGATGGGGGGAAGG - Intergenic
1198924451 X:141772066-141772088 GTGTGGAGGGGGAAGGAAGAAGG + Intergenic
1199207148 X:145161996-145162018 GTGAGGCTGAGGTGGGAGGATGG + Intergenic
1199838680 X:151620892-151620914 AGGAGGAGGTGGAGGGAAAAAGG - Intronic
1201227684 Y:11834166-11834188 GTGAGGAAGGGGAGTGATGAAGG - Intergenic
1201512219 Y:14777619-14777641 GTGAGTGTGAGGGGGGAAGAGGG + Intronic
1201586524 Y:15567184-15567206 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1201614481 Y:15882022-15882044 GTGAGGATGTGGAAAAAAAAGGG - Intergenic
1201615887 Y:15897753-15897775 GTGAGGATGTGGAAAAAAAAGGG + Intergenic