ID: 969547977

View in Genome Browser
Species Human (GRCh38)
Location 4:7844434-7844456
Sequence GTGACAAATGCCACCACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969547977_969547982 5 Left 969547977 4:7844434-7844456 CCCCCAGTGGTGGCATTTGTCAC 0: 1
1: 0
2: 0
3: 11
4: 124
Right 969547982 4:7844462-7844484 CATGAGCAGACTAATACACTAGG 0: 1
1: 1
2: 6
3: 57
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969547977 Original CRISPR GTGACAAATGCCACCACTGG GGG (reversed) Intronic
902848920 1:19137643-19137665 TTTACAAATGGCACCGCTGGAGG - Intronic
905443977 1:38012883-38012905 GCGACAAAGGCCAGCACTTGTGG - Intronic
907639715 1:56175268-56175290 GTGAGAAATGACTCCATTGGAGG + Intergenic
907674791 1:56508481-56508503 GGCACAAAGGCCACCACTTGAGG - Intronic
912343400 1:108940525-108940547 GTGCAAGATGTCACCACTGGAGG + Intronic
915837151 1:159186793-159186815 GGGAGAAATGTCACCCCTGGGGG + Intronic
917631802 1:176897951-176897973 ATGACAAATGCGGCCACTAGAGG + Intronic
923850758 1:237791698-237791720 GTGAGAAATGCCTCAACTGAAGG + Intronic
924326721 1:242902043-242902065 GTGATGAATGGCACCACTGTAGG - Intergenic
1065999639 10:31092242-31092264 GTCACAAATTTCACCACTGTAGG - Intergenic
1067443742 10:46327646-46327668 GTGACAAATGCCTCAAATGCTGG - Intronic
1074193945 10:111163099-111163121 CTCTCATATGCCACCACTGGTGG - Intergenic
1075960384 10:126563088-126563110 GTGGCAAATGCTACAACTCGGGG + Intronic
1076619191 10:131776053-131776075 GTGGGAAATGCCTGCACTGGAGG - Intergenic
1077325916 11:1964029-1964051 GTGCCCAATGTCACCACTGCCGG - Intronic
1081503900 11:43695041-43695063 CAGACATATGCCACCACTTGGGG - Intronic
1202808896 11_KI270721v1_random:19208-19230 GTGCCCAATGTCACCACTGCCGG - Intergenic
1091880527 12:3973691-3973713 GTGACCAATGCCGGCACTGCAGG + Intergenic
1091940608 12:4477266-4477288 GTTACAAATGCCAAAAGTGGTGG - Intergenic
1093890923 12:24519730-24519752 GAGAGAAATGAAACCACTGGAGG + Intergenic
1095852371 12:46824944-46824966 GTGTCAGATGTAACCACTGGAGG + Intronic
1096321482 12:50617664-50617686 TGGGCAAATGCCACCACTGCCGG - Intronic
1097957322 12:65499492-65499514 GTGATAAATACAACCACTGATGG - Intergenic
1099281233 12:80649704-80649726 GTGACACATGAAACGACTGGAGG - Intronic
1099419416 12:82437186-82437208 GTCACAAATGCCTTCACTTGAGG - Intronic
1102390524 12:112545560-112545582 GTGAACCATGCCACCACTGTGGG - Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1111901105 13:94200822-94200844 GTGACAAATGCCAAAATTAGTGG + Intronic
1112032596 13:95471284-95471306 GTGACAAGCCCCTCCACTGGTGG - Intronic
1118406010 14:65424367-65424389 GTGTCAAATGCCACCATGTGTGG + Intronic
1118708584 14:68501836-68501858 GTGACATCGGCCACCACTGCTGG + Intronic
1120993821 14:90399752-90399774 GTGAAAAATGGCACCTCTAGTGG - Intronic
1122611116 14:102984196-102984218 GTGGGAAATGCCAACCCTGGGGG - Intronic
1123433912 15:20240952-20240974 GGGACAAATGACACATCTGGGGG + Intergenic
1125262388 15:37842119-37842141 GTAACAAATGGTACCACTGTGGG - Intergenic
1126429877 15:48571240-48571262 GTGATAAATGCTATCAGTGGTGG - Intronic
1128352982 15:66903815-66903837 ATGGCAAATGCCGCCTCTGGTGG - Intergenic
1128686558 15:69690528-69690550 ATGAGAACTGCCCCCACTGGTGG - Intergenic
1129336221 15:74853744-74853766 GGGACAAATGCCCTCTCTGGAGG + Intronic
1131360321 15:91784888-91784910 CTGACACATGCCAACCCTGGTGG - Intergenic
1131389422 15:92034761-92034783 TAGCCACATGCCACCACTGGAGG - Intronic
1131533883 15:93217515-93217537 ATGTCAAATGCCACCACAGCTGG - Intergenic
1133235693 16:4386429-4386451 CACACAAATGCCTCCACTGGGGG + Intronic
1133964656 16:10521850-10521872 TTGTCACATGCCACCACTAGGGG + Intergenic
1135097792 16:19578978-19579000 GTGAAAGATGCCTCCACTGGGGG + Intronic
1136850706 16:33610158-33610180 GGGACAAATGACACATCTGGGGG - Intergenic
1137602911 16:49768739-49768761 GGGACAGATGCACCCACTGGGGG - Intronic
1138223352 16:55271865-55271887 GTGACAAATCCCTCTAGTGGGGG + Intergenic
1141209443 16:81963106-81963128 GTAACTAATCCAACCACTGGGGG - Intergenic
1141716474 16:85729918-85729940 GTGACAAATGACCACGCTGGGGG - Intronic
1203112316 16_KI270728v1_random:1458613-1458635 GGGACAAATGACACATCTGGGGG - Intergenic
1144179093 17:12735039-12735061 GTGACAGATGCCAGCAGTGGTGG + Intronic
1144705659 17:17366218-17366240 GTGACCGATGCCACTCCTGGTGG + Intergenic
1146623018 17:34414797-34414819 GTGACAACTTCCACAAGTGGGGG - Intergenic
1150280876 17:63929085-63929107 GAGACAAATGGCAGCTCTGGTGG + Exonic
1158624217 18:59057670-59057692 GTGACCAATGAGGCCACTGGAGG - Intergenic
1158941120 18:62406505-62406527 GTGAGAAATCCCAGCACTGGAGG - Intergenic
1160195996 18:76755963-76755985 GTAACAAATGCACCCTCTGGTGG + Intergenic
1160249357 18:77187748-77187770 TTGAAAAATGTTACCACTGGGGG - Intergenic
1162465331 19:10836131-10836153 GCTACTAATGCCACCAGTGGAGG - Exonic
1165030124 19:32992079-32992101 GGGACAAATGACACATCTGGGGG + Intronic
1168303910 19:55423678-55423700 GTGACAAAGGCGAACACTGAAGG + Intergenic
925657026 2:6160368-6160390 GTGATAATTGCCACAACTTGGGG - Intergenic
927024205 2:19048988-19049010 GTTAAAAATGTCAGCACTGGGGG + Intergenic
931530177 2:63205106-63205128 GTGACAAAAGCATACACTGGGGG - Intronic
931532592 2:63233017-63233039 GAGACAAATGCCAACATGGGGGG - Intronic
931535614 2:63272056-63272078 GTGACATATGCGGGCACTGGTGG - Intronic
931573290 2:63693088-63693110 GTGGCAAATGCAAACTCTGGTGG + Intronic
932056261 2:68447300-68447322 CTGACAGCTGCCACCACTGCAGG + Intergenic
932355144 2:71062196-71062218 GTGAAAGATGTTACCACTGGGGG + Intergenic
933222312 2:79705002-79705024 TTGACAAATGTCCCCAGTGGTGG - Intronic
935525146 2:104156611-104156633 GTGACACATGACACAACTGTTGG - Intergenic
936350430 2:111708054-111708076 GTGACGAATGTCACCCCAGGAGG - Intergenic
939842037 2:147201047-147201069 GAGACAAATGGCATCCCTGGAGG + Intergenic
946946634 2:224828738-224828760 ATGACAAATGACAAGACTGGTGG + Intronic
946957033 2:224941944-224941966 ATGACAATTGCCACCAATTGAGG + Intronic
1169274195 20:4221925-4221947 GTGTCTACGGCCACCACTGGCGG - Exonic
1172642195 20:36447140-36447162 GAGGCAGATGCCACCCCTGGGGG + Intronic
1173593093 20:44240602-44240624 GTGAGATAAGACACCACTGGAGG + Intergenic
1179408856 21:41146978-41147000 GAGACGAATCACACCACTGGAGG + Intergenic
1181345866 22:22220207-22220229 GTGACAACAGCCAGCACTGGTGG + Intergenic
1181527008 22:23495807-23495829 ATGACAAATGCCAGCACTTTGGG - Intergenic
1182816602 22:33170107-33170129 GTGACACATGCCAGCACTTTGGG + Intronic
1182886486 22:33778079-33778101 GTCACCAAAGCCACCACAGGAGG + Intronic
1184364830 22:44043919-44043941 GGGACAGCTGCCACCACTGCAGG - Intronic
949229520 3:1734258-1734280 GTGAAAAATCCCACTTCTGGGGG - Intergenic
951744992 3:25968342-25968364 GTAACAAATGCAACCAGTGCAGG - Intergenic
953567156 3:44042506-44042528 GTGAGAAATCCCACTGCTGGTGG - Intergenic
954394797 3:50287827-50287849 TGGACAAATGCCACCACAGCAGG - Exonic
954596426 3:51829516-51829538 GGGACAACTCCCACCCCTGGGGG - Intronic
955935401 3:64098199-64098221 GTGAGAAATGCCATCCCTGCTGG - Exonic
962616660 3:137133532-137133554 GTTACTTATGCCACCACTTGTGG - Intergenic
962879424 3:139562249-139562271 GTTACAAATGCCACACCTGGAGG - Intronic
964511767 3:157460321-157460343 ATGGCTAATGCCATCACTGGGGG + Exonic
969223214 4:5774876-5774898 GTGACATATGCCAGCATTAGTGG + Intronic
969255607 4:5999740-5999762 GTGACATGAGCCACCTCTGGTGG - Intergenic
969547977 4:7844434-7844456 GTGACAAATGCCACCACTGGGGG - Intronic
969563372 4:7963301-7963323 GTGACACATGTCACCTCTAGTGG - Intergenic
971564681 4:28122440-28122462 TTGACAAAAGCAAACACTGGGGG - Intergenic
987979440 5:25062733-25062755 GTGAGAAATGACACCAGTTGTGG - Intergenic
990686727 5:58311559-58311581 GTGTCATATGCCATCAATGGTGG + Intergenic
992717676 5:79527056-79527078 GTGACAACTGCCACCACTTTGGG - Intergenic
992992091 5:82294180-82294202 GTGTCAAGTGCCACCATTTGGGG - Intronic
993874154 5:93286462-93286484 GTGAGATCTGCTACCACTGGAGG + Intergenic
994209532 5:97072917-97072939 TGTATAAATGCCACCACTGGTGG - Intergenic
997438383 5:133891459-133891481 GTGACAACAGCCACCTTTGGAGG - Intergenic
1000809332 5:165841306-165841328 CTGACAAATGGCAGCACTGGAGG + Intergenic
1003307989 6:4946384-4946406 GAGGAAAATGCCCCCACTGGGGG - Intronic
1003822133 6:9910393-9910415 GTTACAAATACCACTCCTGGAGG + Intronic
1009687803 6:66986485-66986507 GGTACCAATGCCACCACAGGAGG - Intergenic
1013856092 6:114574107-114574129 GTGGTAAATACAACCACTGGGGG - Intergenic
1014029530 6:116684365-116684387 GAGACAAATCTCACTACTGGTGG - Intronic
1018764764 6:166924816-166924838 GTGGCATATGCCACCACTCTTGG + Intronic
1022655936 7:32319354-32319376 GGCACAGATGCCATCACTGGGGG - Intergenic
1029264344 7:99326277-99326299 GTGACAAATGCCCCCAGCAGAGG - Intronic
1032320000 7:130877310-130877332 GTGATATATGCCACCACTGTTGG + Intergenic
1035244110 7:157551323-157551345 GTGAAAAATACCACAACTGTAGG + Intronic
1036241015 8:7081129-7081151 GTGAAAAAGGCAACCAGTGGGGG - Intergenic
1036426354 8:8648487-8648509 TTGGAAAATTCCACCACTGGAGG - Intergenic
1037097845 8:15006676-15006698 TTGACAGATCCCACCATTGGTGG - Intronic
1038168768 8:25109896-25109918 GTGACAAATGCCCACCCTGTAGG - Intergenic
1046073870 8:109293207-109293229 CTGGCACCTGCCACCACTGGTGG - Intronic
1046492692 8:114973295-114973317 GTGAGAAATGCCATCCCTAGTGG - Intergenic
1046675651 8:117105010-117105032 GTGACAAAAGTGACCTCTGGTGG - Intronic
1051416336 9:16844945-16844967 GTCACAAATGACTCAACTGGGGG - Intronic
1054866851 9:70011551-70011573 GTGACAGAGGCCACAGCTGGTGG - Intergenic
1056144325 9:83714523-83714545 ATATCAAATGCCACCACTGGGGG - Intergenic
1056333289 9:85539880-85539902 ATGACAAGTCTCACCACTGGAGG + Intergenic
1185619175 X:1442883-1442905 GTGGTAAATGCCTCCAGTGGGGG + Intronic
1185719516 X:2371057-2371079 GGGACTAATGCAACCACTGGTGG - Intronic
1186204700 X:7188996-7189018 GTTTCAAATGCCATCTCTGGGGG + Intergenic
1187095275 X:16141458-16141480 GTGAAAAATGGCACCAGTGAAGG - Intronic
1189131820 X:38506924-38506946 ATGACACATGCTACCACAGGAGG + Intronic
1192437390 X:71151457-71151479 GTGACAAATCCCGCCTCTTGAGG + Intronic
1194521820 X:94928801-94928823 GTGAAAAATGCAATCACTGTAGG + Intergenic
1197249429 X:124199580-124199602 GTGACACATACCAGCACTGGAGG + Intronic