ID: 969552221

View in Genome Browser
Species Human (GRCh38)
Location 4:7878132-7878154
Sequence GTCTTTCCCCTTAAGATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969552220_969552221 3 Left 969552220 4:7878106-7878128 CCATTTTAAACTTTTAATACAAA 0: 1
1: 0
2: 14
3: 108
4: 1303
Right 969552221 4:7878132-7878154 GTCTTTCCCCTTAAGATCTAAGG No data
969552219_969552221 11 Left 969552219 4:7878098-7878120 CCAATTCTCCATTTTAAACTTTT 0: 1
1: 1
2: 4
3: 65
4: 839
Right 969552221 4:7878132-7878154 GTCTTTCCCCTTAAGATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969552221 Original CRISPR GTCTTTCCCCTTAAGATCTA AGG Intronic
No off target data available for this crispr