ID: 969558969

View in Genome Browser
Species Human (GRCh38)
Location 4:7933661-7933683
Sequence AGCTCAGGACTAGCTAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969558969_969558975 8 Left 969558969 4:7933661-7933683 CCTGGCCTAGCTAGTCCTGAGCT 0: 1
1: 0
2: 2
3: 4
4: 134
Right 969558975 4:7933692-7933714 CACATGCAAAGACCAGATAGAGG No data
969558969_969558978 23 Left 969558969 4:7933661-7933683 CCTGGCCTAGCTAGTCCTGAGCT 0: 1
1: 0
2: 2
3: 4
4: 134
Right 969558978 4:7933707-7933729 GATAGAGGCCTCAGGAGCTGAGG 0: 1
1: 0
2: 1
3: 32
4: 321
969558969_969558976 15 Left 969558969 4:7933661-7933683 CCTGGCCTAGCTAGTCCTGAGCT 0: 1
1: 0
2: 2
3: 4
4: 134
Right 969558976 4:7933699-7933721 AAAGACCAGATAGAGGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969558969 Original CRISPR AGCTCAGGACTAGCTAGGCC AGG (reversed) Intronic
900685765 1:3946650-3946672 AGCTCAGGACCAGCAGAGCCAGG + Intergenic
901456644 1:9366862-9366884 AGCTGAAGACTAGCTGGGCATGG - Intronic
901845657 1:11980526-11980548 TGCTCAGGACTCGCCGGGCCGGG - Intronic
903543854 1:24111485-24111507 AGCTCATGACTGGCAAGGGCAGG - Intronic
905284464 1:36870246-36870268 AGCTCAGGCCTGGCTAGGCCAGG - Intronic
906537422 1:46559206-46559228 AGCTCAGGGCTAGCGTGGACAGG + Intronic
908188106 1:61671898-61671920 AGCTCAAGACCAGCCTGGCCAGG + Intergenic
912354239 1:109042062-109042084 AGCTGAGGAGTCGCTGGGCCGGG - Intronic
912508486 1:110172632-110172654 AGCTCAGGAAAAGGCAGGCCTGG + Intronic
918290296 1:183100883-183100905 AGCTCAGTGCCAGCAAGGCCAGG + Intronic
920431601 1:205922440-205922462 AGCCCAGGGCTAGCAAGGCTGGG - Intronic
920713626 1:208318533-208318555 ACCTCACGACTAGCTAAGTCTGG - Intergenic
922318057 1:224459788-224459810 AGCTCAGAAAAAGCAAGGCCAGG + Intronic
922937930 1:229435087-229435109 AACCCAGGACTGGCTAGACCTGG + Intergenic
923393324 1:233535497-233535519 AGTTCAGGACCAGCCTGGCCAGG + Intergenic
924097288 1:240565632-240565654 AGCTCAGGACGAGATCAGCCTGG + Intronic
1063751393 10:8952319-8952341 TGCTCAGGACTAAGTAGGCATGG + Intergenic
1067017431 10:42768695-42768717 AGCTGAGGACTAACAAGGACTGG - Intergenic
1069692677 10:70364135-70364157 CCCTCAGGACTCGCCAGGCCAGG + Intronic
1073070514 10:100790572-100790594 AACTCAGGAGTAGCAGGGCCCGG - Intronic
1076917178 10:133430110-133430132 AGCCCAGGAGAAGCTGGGCCTGG - Intergenic
1076937273 10:133574869-133574891 AGCCCAGGAGAAGCTGGGCCTGG - Intergenic
1077308363 11:1877817-1877839 GGCGCAGGACTCCCTAGGCCTGG - Intronic
1081852233 11:46281666-46281688 AGCTCAGGAGAAGCCAGGCTAGG - Intronic
1083616433 11:64028742-64028764 AGCTCAGAACCTGCCAGGCCTGG + Intronic
1084180124 11:67441939-67441961 GGCACAGGACTGGCTGGGCCAGG - Intronic
1085140285 11:74134340-74134362 AGCTGAGTACTAGCTGGGCATGG + Intronic
1085957896 11:81422509-81422531 ACTTCAGGACTAGCTAAGTCAGG + Intergenic
1089968179 11:122671196-122671218 AGCTCTGAACTTGCGAGGCCAGG - Intronic
1090080490 11:123609246-123609268 AGCTAAGAAGGAGCTAGGCCGGG + Intronic
1100659208 12:96678545-96678567 AGAACAGGAATAGCTAGGCAGGG - Intronic
1106341968 13:28838517-28838539 AGCTCAGGACAGGCATGGCCAGG - Intronic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1113063031 13:106344300-106344322 CGCTCAGGTCTAGCCAGGGCTGG + Intergenic
1113494855 13:110719058-110719080 AGCACAGGAACAGATAGGCCCGG + Intronic
1117608311 14:57454868-57454890 AGCTCAGAACTAGACAGGTCAGG + Intergenic
1118231736 14:63957765-63957787 TGATCAGCACTAGCTCGGCCAGG - Intronic
1121185312 14:91962411-91962433 AGCTCAGGGCTAGAAAAGCCAGG + Intergenic
1123490414 15:20775741-20775763 AGCTCAGGGCTAGGGAGGGCCGG - Intergenic
1123546915 15:21344828-21344850 AGCTCAGGGCTAGGGAGGGCCGG - Intergenic
1127308116 15:57727999-57728021 AACTCAGGGCTAGCGAGGCAGGG + Intronic
1127626890 15:60788608-60788630 GGCACAGGCCAAGCTAGGCCAGG - Intronic
1129831755 15:78675410-78675432 AGGTCAGGCCTGGCAAGGCCAGG + Intronic
1202955246 15_KI270727v1_random:72044-72066 AGCTCAGGGCTAGGGAGGGCCGG - Intergenic
1132589412 16:720166-720188 GGCTAAGGAGGAGCTAGGCCAGG + Intronic
1134534935 16:15018611-15018633 AGCTCAGGAGTGGCAAAGCCAGG - Intronic
1136181048 16:28552481-28552503 ATATCAGCCCTAGCTAGGCCAGG - Intergenic
1138604738 16:58081502-58081524 AGCTCAGGATGAGCCAGGACAGG - Intergenic
1139861106 16:70022156-70022178 AGCTCAGGAGTGGCAAAGCCAGG + Intergenic
1140056790 16:71532340-71532362 AGAACAGGACCAGCTAGGCCGGG - Intronic
1143062005 17:4209589-4209611 AGCTCAGGTCTGGCCAGGCGCGG - Intronic
1143253917 17:5541936-5541958 AGCTCAGGTCCAGCTCGGTCAGG + Exonic
1144108638 17:12009741-12009763 AGCTCAGGAATGGCCAGGCGCGG - Intergenic
1144685515 17:17223544-17223566 AGCTCAGGCCAGGCCAGGCCAGG - Intronic
1148161726 17:45453994-45454016 AGCTGAGGACTGGCTGGACCGGG - Exonic
1148607863 17:48943924-48943946 GGCTGAGGACCAGCTAGCCCAGG - Exonic
1148759251 17:49991062-49991084 GGCTCAGGAGGAACTAGGCCTGG + Exonic
1150392961 17:64800639-64800661 AGCTGAGGACTGGCTGGACCTGG - Intergenic
1151554595 17:74840355-74840377 AGTTCAGAACTAGCTTGGCCTGG - Intergenic
1151566641 17:74902254-74902276 AGCTCAGGGCTGCCCAGGCCTGG + Intergenic
1154406373 18:14095713-14095735 AGCTCAGTACTAGCTTGACATGG - Intronic
1157471245 18:47990853-47990875 AGCTCTGGGCTAGCTACTCCGGG - Intergenic
1161376653 19:3942529-3942551 AGTTCAAGACCAGCCAGGCCAGG + Intergenic
1162572278 19:11480482-11480504 AACCCGGGCCTAGCTAGGCCTGG + Intronic
1162572280 19:11480485-11480507 GGACCAGGCCTAGCTAGGCCCGG - Intronic
1165455135 19:35906293-35906315 AGTTCAAGACCAGCCAGGCCAGG - Intronic
925906778 2:8544524-8544546 GGCTCAGGATTAAATAGGCCTGG + Intergenic
926903548 2:17784766-17784788 AGTTCAGGACCATCTAGACCAGG + Exonic
927842898 2:26456731-26456753 AGGTCAGGTCTAGCAAGACCAGG + Intergenic
930805398 2:55484542-55484564 AGTTCGAGACTAGCTTGGCCAGG - Intergenic
931641108 2:64381956-64381978 CTCTCAGGACGAGATAGGCCAGG + Intergenic
932667248 2:73707909-73707931 TGCTCTGGACTAGCAGGGCCAGG - Intergenic
935149682 2:100422538-100422560 AGTTCAGGACTAGGAGGGCCAGG - Intergenic
935992986 2:108738363-108738385 AGATCAGGACCAGCTGGGCGCGG - Intronic
937004048 2:118495448-118495470 AGGTCATGACTAGTTTGGCCTGG - Intergenic
937223633 2:120356136-120356158 AGCTCAAGAAGAGCCAGGCCCGG - Intergenic
938144019 2:128819365-128819387 ATCTCAGAACTCCCTAGGCCAGG + Intergenic
942287225 2:174431896-174431918 AGCTAAGCACAAGCTAGGCATGG + Intronic
942573612 2:177339016-177339038 TCCTCAGGACTATCCAGGCCTGG - Intronic
946043234 2:216800434-216800456 AGCTCAGCAGGAGCTAGTCCGGG - Intergenic
948399788 2:237675197-237675219 ATCTCAGGAACAGCTAGGGCTGG - Intronic
1169355070 20:4898899-4898921 AGGGCAGGACAAGCTGGGCCTGG + Intronic
1169384433 20:5136166-5136188 ACCACAGGACTAGCCAGGCATGG - Intronic
1170155134 20:13262266-13262288 AGCTCAGGGCTATAAAGGCCAGG - Intronic
1171010683 20:21507857-21507879 AGCCCAAGTCTAGCTGGGCCCGG + Intergenic
1171871976 20:30535523-30535545 AGTTCAAGACTAGCCTGGCCAGG - Intergenic
1172662316 20:36575634-36575656 ATCTCTGGGCTGGCTAGGCCAGG - Intronic
1172992839 20:39048878-39048900 ACCTCATGAGTAGCTAGGGCTGG - Intergenic
1173306466 20:41855295-41855317 AACTCAGGAGTAGCTTGGCTGGG - Intergenic
1173918197 20:46725327-46725349 GGCCCAGGACCAGCCAGGCCAGG - Exonic
1179923044 21:44517463-44517485 AGCACAGGTCCAGCTAGGCTGGG + Exonic
1183451991 22:37901472-37901494 AGGGAAGGACTGGCTAGGCCAGG - Intergenic
952613654 3:35242860-35242882 AGCTCAAGACCAGCTGGGCATGG + Intergenic
952857383 3:37783451-37783473 AGCTGAGGACTAGCTGAGGCAGG - Intronic
954117732 3:48476475-48476497 AGCTCAGGAGAAGCCAGGCAGGG - Intronic
955575265 3:60354867-60354889 AGGACAGGACTGGCTAAGCCAGG + Intronic
955594397 3:60573163-60573185 AGCTCAGAAGTGGCAAGGCCTGG + Intronic
956000561 3:64725600-64725622 AGATCAGGAATAACTATGCCTGG - Intergenic
956948625 3:74253669-74253691 GGCTCAGGACTAGCTAGGCTAGG + Intergenic
965991276 3:174821588-174821610 AAGTCAAGTCTAGCTAGGCCTGG + Intronic
969558969 4:7933661-7933683 AGCTCAGGACTAGCTAGGCCAGG - Intronic
981957460 4:150495621-150495643 AGCTGAGGCCTAGCTAAGCAAGG + Intronic
983628144 4:169824060-169824082 AGGTCAGGAAAGGCTAGGCCAGG - Intergenic
984626422 4:182012247-182012269 AGTTCTGGACTAGAAAGGCCAGG - Intergenic
984849740 4:184143453-184143475 GGCACAGGACTGGCTAGTCCAGG - Intronic
985867421 5:2524732-2524754 AGCTCTGGACAAGCTGGTCCTGG + Intergenic
990293687 5:54380316-54380338 TGCTCAAGTCCAGCTAGGCCTGG + Intergenic
994641416 5:102414596-102414618 AGCTGAGAACAAGCCAGGCCGGG + Intronic
997537703 5:134635379-134635401 TGCTCAGGGCTAGCTAGGTGTGG - Intronic
1002624817 5:180518610-180518632 GGCTCAGGACTACCTGAGCCTGG - Intronic
1003961117 6:11210404-11210426 AGCCCAGAACTAGATATGCCTGG - Intronic
1005465550 6:26109086-26109108 AGTTCAAGACTAGGTTGGCCTGG + Intergenic
1007737609 6:43991223-43991245 AGGTCAGGCCAAGCTGGGCCTGG + Intergenic
1007978836 6:46129933-46129955 AGCTCAGGGCTGGCTGGGACCGG - Intergenic
1017445625 6:154504795-154504817 AGCTCAGGACAAGATCAGCCTGG + Intronic
1019609859 7:1930893-1930915 TGCTCAGGGCCAGCCAGGCCGGG + Intronic
1019739521 7:2665795-2665817 GGCTCAGGAAGAGCTCGGCCCGG - Intergenic
1021518789 7:21517508-21517530 AGCCCAGGACCAGCTGGGCATGG - Intergenic
1022647437 7:32244419-32244441 AGTGCAGGACTGGCTAGGTCAGG - Intronic
1023865174 7:44235029-44235051 AACTCAGGACTAGCTGTGTCAGG + Intronic
1025607062 7:63047185-63047207 ACCCCAGGACTCTCTAGGCCTGG + Intergenic
1026972102 7:74474779-74474801 GCCTCAGGGCTAGCTGGGCCTGG - Intronic
1027257327 7:76439413-76439435 AGCCCAGGACTGGCCAGGCACGG + Intronic
1027281520 7:76612628-76612650 AGCCCAGGACTGGCCAGGCACGG - Intronic
1027308031 7:76922412-76922434 AGCTCAGGACTATGCAGACCTGG + Intergenic
1032782664 7:135176680-135176702 AGTAGAGGACAAGCTAGGCCAGG + Intergenic
1034285131 7:149879229-149879251 AGCTGAGGACTATCTGGGCAGGG + Intronic
1035693771 8:1577855-1577877 GGCTCAGGACTTGCGGGGCCAGG - Intronic
1035881446 8:3247523-3247545 AGCTCAGGTCCATCTGGGCCAGG + Intronic
1039702826 8:39979114-39979136 AGCTCAGGACCAGGTGGGCCAGG - Exonic
1040603089 8:48903692-48903714 GTCTCAGGAGTAGCAAGGCCAGG - Intergenic
1043861324 8:85320421-85320443 AGCTCAGGACAACCTCTGCCTGG - Intergenic
1053456928 9:38240319-38240341 AGCACAGCACGAGCAAGGCCTGG + Intergenic
1055930366 9:81553941-81553963 ACCTCAGGACGTGCCAGGCCTGG - Intergenic
1058710936 9:107678522-107678544 GGTTCAGGACTAGTTATGCCTGG + Intergenic
1060892553 9:127198027-127198049 ATCTCAGGAATAGCAAGGCCTGG - Intronic
1062109069 9:134772287-134772309 AGCTCAGCAATTGCTAGTCCGGG + Intronic
1062269073 9:135700478-135700500 ACCTCAGCACGAGCCAGGCCAGG - Intergenic
1062373290 9:136251295-136251317 TGCTCAGGACTTGCTGTGCCTGG - Intergenic
1187257760 X:17657178-17657200 TGCTCAGGGCATGCTAGGCCAGG + Intronic
1193093855 X:77526111-77526133 AGCTAAGGACTACCTGGGACTGG + Intronic