ID: 969562934

View in Genome Browser
Species Human (GRCh38)
Location 4:7960918-7960940
Sequence GGTTGTTTTGGAGGAAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969562934_969562941 -1 Left 969562934 4:7960918-7960940 CCAGCCTTTCCTCCAAAACAACC No data
Right 969562941 4:7960940-7960962 CCTTGGTGTTGCATACACGATGG No data
969562934_969562942 0 Left 969562934 4:7960918-7960940 CCAGCCTTTCCTCCAAAACAACC No data
Right 969562942 4:7960941-7960963 CTTGGTGTTGCATACACGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969562934 Original CRISPR GGTTGTTTTGGAGGAAAGGC TGG (reversed) Intergenic
No off target data available for this crispr