ID: 969563452

View in Genome Browser
Species Human (GRCh38)
Location 4:7963834-7963856
Sequence CTAGACAGTGCAGCACCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969563452_969563453 1 Left 969563452 4:7963834-7963856 CCTCAGGGTGCTGCACTGTCTAG No data
Right 969563453 4:7963858-7963880 ATGCAGCCAGTAGCCACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969563452 Original CRISPR CTAGACAGTGCAGCACCCTG AGG (reversed) Intergenic