ID: 969564087

View in Genome Browser
Species Human (GRCh38)
Location 4:7967453-7967475
Sequence GTAACAAATATGACCACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969564087_969564090 16 Left 969564087 4:7967453-7967475 CCTTCAGTGGTCATATTTGTTAC 0: 1
1: 0
2: 0
3: 15
4: 129
Right 969564090 4:7967492-7967514 AGCTGCCATCCGAGAGCAGGAGG 0: 1
1: 0
2: 3
3: 16
4: 163
969564087_969564093 23 Left 969564087 4:7967453-7967475 CCTTCAGTGGTCATATTTGTTAC 0: 1
1: 0
2: 0
3: 15
4: 129
Right 969564093 4:7967499-7967521 ATCCGAGAGCAGGAGGTGGAAGG 0: 1
1: 0
2: 4
3: 35
4: 320
969564087_969564089 13 Left 969564087 4:7967453-7967475 CCTTCAGTGGTCATATTTGTTAC 0: 1
1: 0
2: 0
3: 15
4: 129
Right 969564089 4:7967489-7967511 CACAGCTGCCATCCGAGAGCAGG No data
969564087_969564091 19 Left 969564087 4:7967453-7967475 CCTTCAGTGGTCATATTTGTTAC 0: 1
1: 0
2: 0
3: 15
4: 129
Right 969564091 4:7967495-7967517 TGCCATCCGAGAGCAGGAGGTGG 0: 1
1: 0
2: 2
3: 21
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969564087 Original CRISPR GTAACAAATATGACCACTGA AGG (reversed) Intronic
902037014 1:13465223-13465245 GTAAGAAATATGACCAAGGAAGG - Intergenic
906005677 1:42467710-42467732 GGTACAAATATGGCCTCTGAGGG - Intronic
909257085 1:73437905-73437927 CTAAAACATATGTCCACTGATGG - Intergenic
911568397 1:99492557-99492579 TTAACACATATGAACACTTAGGG + Intergenic
912464790 1:109864494-109864516 GCAACAAAAGTGACCTCTGATGG - Intergenic
918739448 1:188108466-188108488 GAAACAAAAGAGACCACTGATGG - Intergenic
919264382 1:195242727-195242749 GTAAAAAATATAGTCACTGAAGG - Intergenic
922047820 1:221963913-221963935 GTAATAAAGATGACTAATGATGG - Intergenic
923753840 1:236772286-236772308 GTAGAAAAAATGACCACTGCGGG + Intergenic
923887706 1:238177374-238177396 GTAAAGAATTAGACCACTGAGGG - Intergenic
924632016 1:245750139-245750161 GGACCAAATATGAGCAGTGAAGG - Intronic
1065999639 10:31092242-31092264 GTCACAAATTTCACCACTGTAGG - Intergenic
1067137920 10:43628040-43628062 GTTACAAATATGATCATGGATGG + Intergenic
1072517091 10:96195403-96195425 GCAACACAAATGTCCACTGATGG + Intronic
1075469320 10:122676239-122676261 GGAACACATTTGACCACTCAAGG + Intergenic
1079891138 11:26054820-26054842 GCTACAAAAATGACCACTGAAGG - Intergenic
1080779075 11:35414148-35414170 TAAACAGATATGACCACTGTTGG - Intronic
1083574810 11:63782586-63782608 GAAAAAAATTTGACCAATGATGG - Intergenic
1085471495 11:76761311-76761333 CTAACAAAAATGACCAGAGATGG + Intergenic
1085667898 11:78431977-78431999 GTAACAATTATGAACAGTAAAGG + Intergenic
1087559693 11:99771989-99772011 ATAAAAAATATGGGCACTGAGGG + Intronic
1088099928 11:106143842-106143864 GTTCCACATATGTCCACTGAGGG - Intergenic
1088355460 11:108939134-108939156 TTTACAAATAAGACAACTGAGGG + Intronic
1090809957 11:130229273-130229295 AAAAAAAGTATGACCACTGATGG + Exonic
1091212732 11:133876458-133876480 GAAATAAATATGACCAGTCATGG - Intergenic
1093945632 12:25105374-25105396 TTAACAGATATGAAAACTGAAGG - Intronic
1097144777 12:56932535-56932557 GTAACAAATAACACAACTGTGGG - Intronic
1097957322 12:65499492-65499514 GTGATAAATACAACCACTGATGG - Intergenic
1098730035 12:74024474-74024496 GTAATAAATATGATCACAGAAGG - Intergenic
1099619405 12:84982230-84982252 GATAAAAATATCACCACTGATGG + Intergenic
1101584133 12:106069857-106069879 TTAACAAAAATGACCAATGATGG + Intronic
1101729741 12:107417028-107417050 GGATCAAATTTGACAACTGAAGG + Intronic
1105546413 13:21353939-21353961 GCAACCCATATGTCCACTGAAGG - Intergenic
1106488254 13:30191669-30191691 GTATCACATATGCCCAGTGAAGG - Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108380187 13:49847620-49847642 GTAAAAAAGATGACCAGTGGAGG + Intergenic
1108786759 13:53912319-53912341 GTAAGAAAAATGACCCATGAAGG - Intergenic
1109770449 13:66964261-66964283 GTAACAAATATAAGCACAGAGGG - Intronic
1109936032 13:69285904-69285926 GGCATAAATATGACCATTGAAGG + Intergenic
1111822914 13:93235075-93235097 GTACCAAATATCATTACTGATGG - Intronic
1112230725 13:97586908-97586930 GTTACAAATATGTCTACAGAAGG - Intergenic
1112828426 13:103419373-103419395 GAAACAAATATGAACATTAAAGG + Intergenic
1114881347 14:26789815-26789837 GTCACAAAAATTACCACAGATGG - Intergenic
1118850382 14:69578528-69578550 TTAACAAATGTGAAAACTGAAGG - Intergenic
1119775648 14:77246797-77246819 GTAACAAGTCTGCCCAGTGAGGG - Intronic
1125262388 15:37842119-37842141 GTAACAAATGGTACCACTGTGGG - Intergenic
1127421511 15:58810923-58810945 ATAAAAAATCTGAACACTGAAGG - Intronic
1128266121 15:66268084-66268106 GTAAAAAATATGAGCATTGGAGG - Intergenic
1128624643 15:69187535-69187557 GTATGAAAAATGCCCACTGAGGG - Intronic
1129550443 15:76443031-76443053 GTAAAAAACACCACCACTGAGGG + Intronic
1131365958 15:91839891-91839913 GTAACAAAAGTGACCTCTGGTGG - Intergenic
1131565232 15:93479525-93479547 TTAACAAATTTGACCCCGGAGGG + Intergenic
1136099973 16:27986829-27986851 TTAACAAATAGGACCAACGAAGG - Intronic
1138793705 16:59941632-59941654 GTAACAAATATGAAAATTGCTGG - Intergenic
1140256073 16:73337372-73337394 GTAACAAAGCTCACCACTGAAGG - Intergenic
1140735421 16:77893963-77893985 GTAACAATTATCACCACTAGGGG - Intronic
1141935985 16:87238072-87238094 TTAACAAATATCATCACGGATGG + Intronic
1142549654 17:730922-730944 GTAACTGATACTACCACTGAAGG + Intergenic
1146542607 17:33710693-33710715 TTTACAAATATGAAAACTGAGGG + Intronic
1149534913 17:57425560-57425582 GCAACAAATATGACCATGTAGGG - Intronic
1152975343 18:211579-211601 GCAAGAAAAATGACCACAGAAGG - Exonic
1153110799 18:1583934-1583956 GCAACAGACATGACCAATGAGGG - Intergenic
1153729517 18:7995466-7995488 GTAACAAATAAGACAACTACAGG + Intronic
1155087114 18:22469555-22469577 GAAACAAAAATAACCACTCAGGG + Intergenic
1156248172 18:35323274-35323296 GTAACATATATGACCATAAAAGG - Intergenic
1156646898 18:39174333-39174355 CTATCAAAAATGACAACTGAGGG + Intergenic
1158671861 18:59482602-59482624 GCAATAAATATGACAACTGTAGG + Intronic
1160602665 18:80025815-80025837 ATAACAGATTTGACCCCTGAAGG + Intronic
1162051866 19:8039090-8039112 GAAACAAATATGGGCCCTGATGG + Intronic
1166755987 19:45191928-45191950 GTACCACCTATGTCCACTGAAGG + Intronic
1167398053 19:49244490-49244512 GTAACAACTCTCACCACTGTGGG - Intergenic
925162823 2:1697969-1697991 GGAACACAGATGAACACTGAGGG + Intronic
931017817 2:58006073-58006095 GTAAAAAGTATAACCCCTGAGGG + Intronic
937358855 2:121215058-121215080 GCAACCAAAATGTCCACTGAAGG + Intergenic
939538710 2:143465475-143465497 GTAGCAAATCTGCTCACTGAAGG + Intronic
947121462 2:226819525-226819547 GTAACAAATATACCCTCTGATGG + Intergenic
1170218108 20:13913087-13913109 GTAACAAATGTGATCTCTGGGGG + Intronic
1175580137 20:60092253-60092275 ATAACAATTATAACCTCTGATGG - Intergenic
1175797651 20:61782598-61782620 GTAATAAATATGACAACAGTAGG + Intronic
1176381495 21:6115926-6115948 GAATTAAATATGACCACAGAGGG + Intronic
1176970283 21:15257072-15257094 TTAAAAAAAAAGACCACTGAAGG + Intergenic
1179741977 21:43422313-43422335 GAATTAAATATGACCACAGAGGG - Intronic
1182950747 22:34373422-34373444 GAAATAAATATGACCACTCAGGG + Intergenic
1184776135 22:46624114-46624136 GTAACAAATATGATACATGAAGG - Intronic
1184837962 22:47035271-47035293 GTAACAAACTTGAGCACTAAGGG - Intronic
949493080 3:4607782-4607804 GTTGCAAATCTGACTACTGATGG - Intronic
950136692 3:10586066-10586088 CTAATAAAAATGACCACTAAGGG - Intronic
950348032 3:12316920-12316942 GTAAGAAATATGCTAACTGATGG + Intronic
955576067 3:60364495-60364517 GTAAAACAAATGATCACTGAAGG + Intronic
955810141 3:62779311-62779333 GAAAAAAAGATGACCACTGCGGG - Intronic
959354253 3:105305238-105305260 GCCACAAAGATGATCACTGAAGG + Intergenic
961985350 3:131126305-131126327 GGAAAAAAAATGACCACAGAAGG - Intronic
963999462 3:151752259-151752281 GTATCAATAATCACCACTGAGGG + Intronic
965606736 3:170504994-170505016 GTATCATATATGACTGCTGATGG + Intronic
969245601 4:5930711-5930733 GTAACACATATGTTCACTCATGG - Intronic
969564087 4:7967453-7967475 GTAACAAATATGACCACTGAAGG - Intronic
970835861 4:20406379-20406401 GTAATATATGTAACCACTGAAGG + Intronic
971888873 4:32491580-32491602 GTAACAAATATGTACTCTGATGG + Intergenic
972963440 4:44481581-44481603 TTATCACAAATGACCACTGAAGG + Intergenic
977119365 4:93078026-93078048 GCAAGAAATATGACCTATGATGG - Intronic
977455313 4:97252339-97252361 ATAACAAATATGGCCCCAGAGGG + Intronic
980441633 4:132855091-132855113 GTAATCAATATGAGAACTGATGG - Intergenic
981648710 4:147030323-147030345 GTAAATAATATGACCATTTAGGG - Intergenic
982381564 4:154754509-154754531 GTAAAGAATATGAACACTTAAGG + Intergenic
983142929 4:164175355-164175377 AGAACAAATGTGACCACTTATGG - Intronic
986595734 5:9420004-9420026 GGAACCAATATGGCCACCGAGGG - Intronic
988259786 5:28870920-28870942 GTAACAAATATACCCACTTTGGG - Intergenic
993558992 5:89380066-89380088 GTAACTCATGTGACCAGTGAGGG + Intergenic
994074560 5:95635971-95635993 GTAATTAATATGACCACTGTGGG - Intergenic
994174677 5:96698518-96698540 GTAAAAAATATGAGAACGGAAGG - Intronic
999186143 5:149710872-149710894 GAAAAAAATATGTCCACTCAAGG - Intergenic
999422916 5:151460197-151460219 ATAACAAGCATGACCTCTGAAGG - Intronic
999998401 5:157114187-157114209 GTAACCACAATGACCACTTAAGG + Intronic
1009443170 6:63706811-63706833 GTAACAAATTTTGCCACAGAAGG - Exonic
1012229300 6:96741663-96741685 GTATCAAAGGTGACCAGTGAAGG + Intergenic
1013508663 6:110824723-110824745 GTAACAAAAAAAAGCACTGAAGG + Intronic
1016028005 6:139308472-139308494 GTTACAGATATGACTACTGTAGG + Intergenic
1016278806 6:142388145-142388167 TAAAAAAATATGCCCACTGAAGG - Intronic
1017154493 6:151310909-151310931 GAAACAAATGTGACCTGTGAAGG - Intronic
1020337612 7:7074226-7074248 ATTACAAATATAACCACAGAGGG - Intergenic
1021534763 7:21690799-21690821 GTAATAAATATTCCAACTGATGG - Exonic
1023568228 7:41545419-41545441 TTAAGAAATAAGACCAATGAGGG - Intergenic
1024854158 7:53757483-53757505 GTAACAAATAAGAGAATTGAAGG - Intergenic
1028110907 7:86940009-86940031 GTAAAAAATATCACAATTGAAGG - Exonic
1033786807 7:144741592-144741614 GTTAAAAATATAACAACTGAAGG - Intronic
1034910043 7:154988381-154988403 GATACATATATGACCACTCAGGG - Intronic
1039026472 8:33263635-33263657 GAAACAAAAAAGACCACTGAAGG - Intergenic
1040670554 8:49685234-49685256 GTCTCAGATCTGACCACTGAAGG + Intergenic
1042240038 8:66654590-66654612 TAAACAAATATCTCCACTGAAGG + Intronic
1042773276 8:72402089-72402111 GTTAGAAATCTGACCTCTGATGG + Intergenic
1048246971 8:132815731-132815753 GTAGAAAATATGGCAACTGAAGG - Intronic
1050119240 9:2291289-2291311 GGAACAAATATATCCACAGAGGG - Intergenic
1050645104 9:7711259-7711281 GTAATAAACTTGACCACTGGGGG - Intergenic
1055021378 9:71674163-71674185 GTAACAAGTATGACCAGTAAAGG - Intergenic
1055665886 9:78552447-78552469 GTAACAAATATAACTGCTGTAGG + Intergenic
1058303246 9:103403022-103403044 GTAACAAATATTGCCAAGGATGG + Intergenic
1060790061 9:126480000-126480022 AGAAAAAATATGACCACTGAAGG + Intronic
1185798457 X:2987017-2987039 GTAACCTACATGTCCACTGAAGG + Intergenic
1187472423 X:19580868-19580890 GGAATAGATATGACCACTGCAGG - Intronic
1188812432 X:34667358-34667380 GTAAAAAATAAGAAGACTGAAGG - Intergenic
1192790956 X:74381438-74381460 ATATTAAATATGAACACTGAAGG + Intergenic
1193622140 X:83767209-83767231 GTAACAAATAAGGACACTAAAGG - Intergenic
1197412028 X:126128635-126128657 ATAACACATATGCCCAATGATGG - Intergenic
1197852543 X:130878446-130878468 GGCAGAAATATGACCACTGGAGG - Intronic
1197978563 X:132192613-132192635 GTAACAAATATGATAAATGAGGG - Intergenic