ID: 969565822

View in Genome Browser
Species Human (GRCh38)
Location 4:7977438-7977460
Sequence GGCACACAAACGTCCCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969565822 Original CRISPR GGCACACAAACGTCCCCTGT GGG Intronic
902925031 1:19690384-19690406 AGCACACTAACGCCCCCTCTGGG + Intronic
924246927 1:242094257-242094279 GGCACTCAAAAGTCCCCTGAAGG - Intronic
1067877461 10:50018748-50018770 GGCATAGAAAGGACCCCTGTGGG + Intergenic
1069294767 10:66830016-66830038 GTCACATAAAAATCCCCTGTGGG - Intronic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1084609602 11:70193815-70193837 GGCACACAAATGACTCCTGGGGG - Intergenic
1097997373 12:65903695-65903717 GGAACACAAACAGCCTCTGTAGG - Intronic
1100112328 12:91260673-91260695 GGTACACAAAGTTCCCCAGTTGG + Intergenic
1106104431 13:26721862-26721884 GGCACACAAACGTGCGCTCATGG - Intergenic
1107667287 13:42704386-42704408 GGCAAACAAATGTCCCCAGGAGG + Intergenic
1113112856 13:106842521-106842543 GACACACACAAGTGCCCTGTAGG + Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1117869785 14:60188052-60188074 GGCTCACAAAGGTACCCAGTGGG - Intergenic
1119379619 14:74220152-74220174 GGAACACAGACTTCCCCTGAGGG + Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202857160 14_GL000225v1_random:58698-58720 GGCACATGAAAGACCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202864269 14_GL000225v1_random:104948-104970 GTCTCACAAAAGCCCCCTGTGGG + Intergenic
1129338916 15:74872486-74872508 ATCAGACAAACGTTCCCTGTGGG + Intronic
1134691884 16:16196463-16196485 GGCACACAACTGCACCCTGTAGG - Intronic
1135762549 16:25148781-25148803 GGCTCACAAGCCTCCCCTGCAGG + Intronic
1136036137 16:27542050-27542072 GGCACACAAAGCTCCTCTGTGGG + Intronic
1148237812 17:45981134-45981156 GACACACAAAGGTAACCTGTGGG - Intronic
1149569573 17:57663017-57663039 GGAAGACAGACGTCCTCTGTAGG + Intronic
1152513052 17:80803332-80803354 GTCACACGAGGGTCCCCTGTCGG + Intronic
1153604876 18:6823000-6823022 GGCACAATAACGTCCACTGTGGG - Intronic
1164303531 19:23983048-23983070 GTCCCAAAAATGTCCCCTGTGGG + Intergenic
929043428 2:37768785-37768807 GACACATAAATGTCCCCAGTGGG + Intergenic
929314186 2:40457723-40457745 GTCACACAAAAGTCACCTTTGGG + Intronic
932283777 2:70516024-70516046 GGCACATAAAGGTCATCTGTTGG - Intronic
937262767 2:120596950-120596972 GGCACACACATGTGTCCTGTTGG - Intergenic
939995526 2:148915855-148915877 GGCACCCAGACCTCCCCAGTGGG - Intronic
940173089 2:150849776-150849798 GGCACACTAACGCCCCTTTTGGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1173246351 20:41340470-41340492 GGCGCTCAAACGTCCCCTCCTGG - Intergenic
1174340243 20:49890894-49890916 GGCACACAAAGGAATCCTGTGGG - Exonic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1203295582 22_KI270736v1_random:40227-40249 GACACATAAAAGTCCCCAGTGGG + Intergenic
953134113 3:40167948-40167970 GGCACAGAAACCTTCCTTGTTGG - Intronic
955517693 3:59744079-59744101 GGCAGACATTCGTCCCCTGAAGG + Intergenic
963007100 3:140736712-140736734 GGCACACAAAAGTCCTCTTTGGG + Intergenic
963071978 3:141311929-141311951 GGCTCACGAACGACCCCTGGAGG - Intergenic
966882894 3:184359955-184359977 GGGACACAAAGGGCTCCTGTTGG + Intronic
969565822 4:7977438-7977460 GGCACACAAACGTCCCCTGTGGG + Intronic
972174884 4:36391367-36391389 GTCACCCAAACATCCCCAGTAGG + Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
989771904 5:45155243-45155265 GAAACACAAACTTCCCCAGTGGG + Intergenic
1001258195 5:170201307-170201329 GTCAAACAAACGGCCCTTGTAGG - Intergenic
1004191789 6:13470506-13470528 GGTAAACAAATGTCCCATGTGGG + Intronic
1008628185 6:53338001-53338023 GCCCCACATACCTCCCCTGTTGG - Intronic
1019429199 7:990964-990986 GGGGCACAAGGGTCCCCTGTAGG - Intergenic
1023459677 7:40381993-40382015 GACACACACACGTCCCTTGATGG - Intronic
1036767562 8:11558427-11558449 TGCCCACAAACATCTCCTGTAGG + Intronic
1037892070 8:22628759-22628781 GGCACAGAAAAGCCCTCTGTGGG + Intronic
1040638008 8:49298379-49298401 TGCACACTAACCTCACCTGTGGG + Intergenic
1044429457 8:92091510-92091532 GGCACAGGAATCTCCCCTGTTGG + Intronic
1044669852 8:94668122-94668144 AGGACAAAAGCGTCCCCTGTTGG - Exonic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1056539735 9:87561040-87561062 GGCACTCAAATGTCCACTGATGG - Intronic
1056786166 9:89594005-89594027 GGCACACAAACATCACCAGCAGG + Intergenic
1060220275 9:121760813-121760835 GCCAAACACACGTCCCCTGTGGG + Intronic
1203740054 Un_GL000216v2:171068-171090 GTCTCACAAAAGCCCCCTGTGGG - Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1186031590 X:5374917-5374939 GCCACACAAATGTCCACTGGTGG - Intergenic
1187830985 X:23380741-23380763 GTCTCCCAAAGGTCCCCTGTGGG - Intronic
1200212774 X:154354276-154354298 GGCATCCGAACCTCCCCTGTGGG + Exonic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic
1201179700 Y:11332936-11332958 GGCTCACAAAAGCTCCCTGTGGG - Intergenic