ID: 969565962

View in Genome Browser
Species Human (GRCh38)
Location 4:7978285-7978307
Sequence TTGGCTGAGCCTGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969565953_969565962 12 Left 969565953 4:7978250-7978272 CCCATATGTAGTAACATTTCCAG 0: 1
1: 0
2: 1
3: 9
4: 159
Right 969565962 4:7978285-7978307 TTGGCTGAGCCTGAGGAGGAAGG No data
969565954_969565962 11 Left 969565954 4:7978251-7978273 CCATATGTAGTAACATTTCCAGT 0: 1
1: 0
2: 0
3: 16
4: 181
Right 969565962 4:7978285-7978307 TTGGCTGAGCCTGAGGAGGAAGG No data
969565957_969565962 -7 Left 969565957 4:7978269-7978291 CCAGTTGCCTCCTGGCTTGGCTG 0: 1
1: 0
2: 2
3: 32
4: 290
Right 969565962 4:7978285-7978307 TTGGCTGAGCCTGAGGAGGAAGG No data
969565952_969565962 13 Left 969565952 4:7978249-7978271 CCCCATATGTAGTAACATTTCCA 0: 1
1: 0
2: 0
3: 18
4: 192
Right 969565962 4:7978285-7978307 TTGGCTGAGCCTGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969565962 Original CRISPR TTGGCTGAGCCTGAGGAGGA AGG Intronic
No off target data available for this crispr