ID: 969566741

View in Genome Browser
Species Human (GRCh38)
Location 4:7983205-7983227
Sequence CATCTGCGGGGACTCTCGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969566726_969566741 24 Left 969566726 4:7983158-7983180 CCCCCACGGTGGCCCCTTGGGCA 0: 1
1: 0
2: 0
3: 19
4: 143
Right 969566741 4:7983205-7983227 CATCTGCGGGGACTCTCGCATGG 0: 1
1: 0
2: 0
3: 3
4: 52
969566730_969566741 12 Left 969566730 4:7983170-7983192 CCCCTTGGGCAACGACCTTGACA 0: 1
1: 0
2: 1
3: 4
4: 71
Right 969566741 4:7983205-7983227 CATCTGCGGGGACTCTCGCATGG 0: 1
1: 0
2: 0
3: 3
4: 52
969566731_969566741 11 Left 969566731 4:7983171-7983193 CCCTTGGGCAACGACCTTGACAC 0: 1
1: 0
2: 1
3: 4
4: 48
Right 969566741 4:7983205-7983227 CATCTGCGGGGACTCTCGCATGG 0: 1
1: 0
2: 0
3: 3
4: 52
969566727_969566741 23 Left 969566727 4:7983159-7983181 CCCCACGGTGGCCCCTTGGGCAA 0: 1
1: 0
2: 0
3: 7
4: 129
Right 969566741 4:7983205-7983227 CATCTGCGGGGACTCTCGCATGG 0: 1
1: 0
2: 0
3: 3
4: 52
969566736_969566741 -3 Left 969566736 4:7983185-7983207 CCTTGACACCACGGAGGAGGCAT 0: 1
1: 0
2: 2
3: 9
4: 134
Right 969566741 4:7983205-7983227 CATCTGCGGGGACTCTCGCATGG 0: 1
1: 0
2: 0
3: 3
4: 52
969566728_969566741 22 Left 969566728 4:7983160-7983182 CCCACGGTGGCCCCTTGGGCAAC 0: 1
1: 0
2: 0
3: 10
4: 77
Right 969566741 4:7983205-7983227 CATCTGCGGGGACTCTCGCATGG 0: 1
1: 0
2: 0
3: 3
4: 52
969566732_969566741 10 Left 969566732 4:7983172-7983194 CCTTGGGCAACGACCTTGACACC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 969566741 4:7983205-7983227 CATCTGCGGGGACTCTCGCATGG 0: 1
1: 0
2: 0
3: 3
4: 52
969566729_969566741 21 Left 969566729 4:7983161-7983183 CCACGGTGGCCCCTTGGGCAACG 0: 1
1: 0
2: 0
3: 5
4: 50
Right 969566741 4:7983205-7983227 CATCTGCGGGGACTCTCGCATGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969566741 Original CRISPR CATCTGCGGGGACTCTCGCA TGG Intronic
901438967 1:9265999-9266021 CATCTCAGGGGACTCCCGGATGG + Exonic
901755423 1:11438821-11438843 CATCTCCGGGGTCTCACCCAGGG + Intergenic
907108701 1:51906989-51907011 CATCTGCCAGGACTCAGGCATGG - Intergenic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
907312287 1:53545826-53545848 CCTCTGCAGCGACTCACGCAAGG - Intronic
910430669 1:87156690-87156712 CATCTGCTGTGACTGTCCCAAGG + Intronic
917952387 1:180053062-180053084 AATCTGCGGTGACTCTCTGAAGG - Exonic
919233450 1:194806547-194806569 CATCTGCTAGGACTCAGGCAAGG - Intergenic
922786133 1:228283199-228283221 CATCCGCGGGGCCTCGCTCAAGG + Exonic
1075086693 10:119418571-119418593 CATCAGAGTGGACTCTGGCAGGG + Intronic
1084713917 11:70861736-70861758 CATCTGCTGGGATTGTCTCAAGG - Intronic
1084901834 11:72315549-72315571 CAGCTGCAGGGCCTCTAGCAAGG - Intronic
1086296421 11:85373034-85373056 CATCTGAGGGGAGTGTCCCATGG - Intronic
1087389728 11:97517387-97517409 CTTCTGCAGAGACTCTCTCAGGG + Intergenic
1110084565 13:71362208-71362230 CATCTGCAAGGACTCTTGGAAGG - Intergenic
1113899912 13:113790958-113790980 CATCTGCGAGGACGTTCGCAGGG + Intronic
1116467691 14:45252982-45253004 CATCTGCGGGGACCCGCGGTAGG + Intronic
1121767132 14:96497662-96497684 CATGTGCTGGGACTCTCTGAAGG + Intergenic
1123584702 15:21747342-21747364 CATCTGCTGGGATACTCACATGG + Intergenic
1123621347 15:22189949-22189971 CATCTGCTGGGATACTCACATGG + Intergenic
1124343780 15:28907714-28907736 AATCTGTGGGGACTCTCCCTGGG + Intronic
1133756669 16:8767290-8767312 CCTCTCCGGGCACTCTCCCATGG - Intronic
1138509435 16:57499707-57499729 CTTCTATGGGGCCTCTCGCAAGG + Intergenic
1140980290 16:80102310-80102332 CATCTGGGGAGAATCTCTCAGGG + Intergenic
1141604856 16:85146931-85146953 CAGCTGCAGTGACTCTCCCAGGG - Intergenic
1141860687 16:86714213-86714235 CATCTTCGGGGTGTCTGGCAAGG - Intergenic
1142711387 17:1725627-1725649 CATCTCCGGCGACTCCAGCAAGG - Exonic
1151767630 17:76140395-76140417 TGTCTGCGGGGACTCTCCGAGGG + Exonic
1153257926 18:3191495-3191517 TATTTGCTGGGACTCACGCAAGG - Intronic
925097541 2:1219252-1219274 CATCTGCTGGGACTCTGGGGAGG - Intronic
933384309 2:81590181-81590203 CATCTGCAGGGACACTGGTATGG - Intergenic
935407753 2:102726842-102726864 CACCTGCCGGGACTCTAGCCAGG + Exonic
1176101322 20:63365777-63365799 CAGCAGCCGGGACTCCCGCAGGG - Intronic
968978582 4:3834703-3834725 CATCTGTGGGGTCGCTTGCAGGG + Intergenic
969566741 4:7983205-7983227 CATCTGCGGGGACTCTCGCATGG + Intronic
993994662 5:94708520-94708542 CATCTGAAGGGACTCTGGAAAGG + Exonic
995341908 5:111070306-111070328 CATTTGCTGGGACTCACACACGG + Intronic
1003191788 6:3880960-3880982 CATCAGTGGGGTCTCCCGCAGGG + Intergenic
1012625050 6:101394140-101394162 CAGCTACGGGGACTCACGCGAGG + Intergenic
1015892339 6:137981268-137981290 CTTCTGAGGGCACTCACGCAGGG - Intergenic
1016400401 6:143673809-143673831 CCTCTGCAGAGACTCACGCAGGG + Intronic
1018226478 6:161634256-161634278 CATCTGCGGGGACGCTCACCAGG - Intronic
1019178476 6:170173115-170173137 CATCTGTGGGGCCTCCCGCGAGG + Intergenic
1020275550 7:6622446-6622468 CATCTGCGGGGAGTGCGGCAAGG + Exonic
1023888126 7:44375171-44375193 CCTCTGAGGGGACCCTCCCAGGG + Intergenic
1024202411 7:47120589-47120611 CCTCTGCTGGGACTCAGGCAGGG + Intergenic
1025182940 7:56832867-56832889 CATCTGCGGAGACTGTCGTGAGG + Intergenic
1029374902 7:100171594-100171616 GGTGTGCGGAGACTCTCGCATGG - Exonic
1034686315 7:152974340-152974362 CCTCAGCGGGGACTCTCAGATGG + Intergenic
1037790443 8:21934883-21934905 CAGTTGCAGGGACTCACGCAAGG + Intronic
1046953593 8:120041352-120041374 CATCTGCCAGGACTGGCGCAGGG + Intronic
1048344644 8:133567573-133567595 CATCTGTGGGGACTCCCAAATGG - Intronic
1049161551 8:141101475-141101497 CATCTGCTGGGGCTCTCGGGCGG - Intergenic
1052126075 9:24775937-24775959 CCTCTGTGGGGACTTTGGCAGGG - Intergenic
1054995802 9:71387355-71387377 CATCTGTGGGATCTCTCTCAGGG + Intronic
1058449685 9:105084412-105084434 CATCTGAGTGGACTCACCCAAGG + Intergenic