ID: 969566974

View in Genome Browser
Species Human (GRCh38)
Location 4:7984478-7984500
Sequence CCACACGGGGAGCAAGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 115}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969566965_969566974 6 Left 969566965 4:7984449-7984471 CCCGGAGAGTTCACGCGGCGTGC 0: 1
1: 0
2: 0
3: 3
4: 32
Right 969566974 4:7984478-7984500 CCACACGGGGAGCAAGGCGCAGG 0: 1
1: 0
2: 0
3: 14
4: 115
969566959_969566974 27 Left 969566959 4:7984428-7984450 CCTCCTAGTAGCCCTGCTGAACC 0: 1
1: 0
2: 1
3: 8
4: 105
Right 969566974 4:7984478-7984500 CCACACGGGGAGCAAGGCGCAGG 0: 1
1: 0
2: 0
3: 14
4: 115
969566963_969566974 15 Left 969566963 4:7984440-7984462 CCTGCTGAACCCGGAGAGTTCAC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 969566974 4:7984478-7984500 CCACACGGGGAGCAAGGCGCAGG 0: 1
1: 0
2: 0
3: 14
4: 115
969566960_969566974 24 Left 969566960 4:7984431-7984453 CCTAGTAGCCCTGCTGAACCCGG 0: 1
1: 0
2: 0
3: 2
4: 103
Right 969566974 4:7984478-7984500 CCACACGGGGAGCAAGGCGCAGG 0: 1
1: 0
2: 0
3: 14
4: 115
969566966_969566974 5 Left 969566966 4:7984450-7984472 CCGGAGAGTTCACGCGGCGTGCC 0: 1
1: 0
2: 0
3: 4
4: 29
Right 969566974 4:7984478-7984500 CCACACGGGGAGCAAGGCGCAGG 0: 1
1: 0
2: 0
3: 14
4: 115
969566962_969566974 16 Left 969566962 4:7984439-7984461 CCCTGCTGAACCCGGAGAGTTCA 0: 1
1: 0
2: 0
3: 9
4: 66
Right 969566974 4:7984478-7984500 CCACACGGGGAGCAAGGCGCAGG 0: 1
1: 0
2: 0
3: 14
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969566974 Original CRISPR CCACACGGGGAGCAAGGCGC AGG Intronic
900118472 1:1038641-1038663 CCAAAAGGGGAGAAAGGCTCAGG + Intronic
900322125 1:2090040-2090062 CCGCACGGGGAGGAAGGGCCCGG - Intronic
901800545 1:11705577-11705599 CCACACGGGGTTCAGGGCTCAGG + Intronic
902598663 1:17526181-17526203 CCACACAGGGAGGAAGGAGAGGG - Intergenic
904130124 1:28269223-28269245 CTCCACGGGGATGAAGGCGCTGG - Exonic
904557179 1:31372926-31372948 TCACTCGGTGAGCAAGCCGCGGG - Exonic
904604422 1:31691087-31691109 CCACAGGGGAAGCAAGTCCCAGG - Intronic
904614744 1:31743619-31743641 CCACTCAGGGAGCAAGGAGCAGG + Intronic
904768993 1:32870687-32870709 CCACAGGCGGAGCGCGGCGCGGG + Exonic
917920141 1:179743899-179743921 CCACCCGGGGAGCATGAGGCCGG + Intronic
1067158562 10:43803151-43803173 CCTCACATGGAGCAAGGGGCCGG + Intergenic
1075456998 10:122591345-122591367 ACACATGGGGAGCAAGTGGCAGG + Intronic
1075458077 10:122597841-122597863 ACACATGGGGAGCAAGTGGCAGG + Intronic
1076658362 10:132039006-132039028 CCACACGGGGAACCAGGCTCAGG + Intergenic
1077556836 11:3230116-3230138 CCACAGGGGCAGCATGGGGCCGG - Intronic
1079393590 11:20043027-20043049 CCACAAGGGGAGCAAAGCAGTGG + Intronic
1083266868 11:61550885-61550907 CCACTCGGGGAGCAGAGCGCTGG - Intronic
1084028529 11:66467303-66467325 CCGCCCGGGGCGCAGGGCGCGGG + Intronic
1084673000 11:70618664-70618686 CGACTGGGAGAGCAAGGCGCAGG + Intronic
1085300501 11:75455675-75455697 GCCCACGGGGAGCCAGGCTCTGG + Intronic
1089729322 11:120510964-120510986 ACACACGGGGAGCAAGTGGCAGG - Intergenic
1091915390 12:4269395-4269417 CCACACGTGGGGGAAGGGGCTGG - Intergenic
1101871853 12:108572073-108572095 CCACCCAGGGAGCAAGCAGCAGG + Intergenic
1102200241 12:111053001-111053023 CCAGACGGGTAGCTAGGTGCAGG + Intronic
1102591114 12:113957621-113957643 ACACACGGCGAGCAAGCGGCAGG + Intronic
1105217432 13:18297470-18297492 GCACGCAGGGAGGAAGGCGCAGG - Intergenic
1105473920 13:20715023-20715045 CCACAGGGGAAGGAAGGGGCAGG - Intronic
1111462031 13:88558120-88558142 CCACACAGGAAGCCAGTCGCTGG + Intergenic
1112430239 13:99344759-99344781 CCACACGAGGAGCACGTGGCAGG - Intronic
1114612552 14:24052245-24052267 CACCACGGGGAGGAACGCGCTGG - Intronic
1115116742 14:29889431-29889453 TCACCCGGGGAGCAAGGGGCTGG + Intronic
1118477798 14:66134667-66134689 TCACAAGGGGAGCAAGTCTCAGG - Intergenic
1118773877 14:68961540-68961562 CCACACGGGGCACAGGGCGCGGG + Intronic
1123473574 15:20571719-20571741 CCACCGGGTGAGCCAGGCGCTGG - Intergenic
1123644435 15:22428634-22428656 CCACCGGGTGAGCCAGGCGCTGG + Intergenic
1123665751 15:22608542-22608564 CCACCGGGTGAGCCAGGCGCTGG + Intergenic
1123733872 15:23166730-23166752 CCACCGGGTGAGCCAGGCGCTGG - Intergenic
1123752010 15:23364110-23364132 CCACCAGGTGAGCCAGGCGCTGG - Intronic
1124284375 15:28388035-28388057 CCACCGGGTGAGCCAGGCGCTGG - Intronic
1124298322 15:28523579-28523601 CCACCGGGTGAGCCAGGCGCTGG + Intronic
1124319572 15:28702956-28702978 CCACCGGGTGAGCCAGGCGCTGG + Intronic
1124482939 15:30092475-30092497 CCACCGGGTGAGCCAGGCGCTGG - Intronic
1124489391 15:30144546-30144568 CCACCGGGTGAGCCAGGCGCTGG - Intronic
1124520638 15:30404743-30404765 CCACCGGGTGAGCCAGGCGCTGG + Intronic
1124538019 15:30561476-30561498 CCACCGGGTGAGCCAGGCGCTGG - Intronic
1124544479 15:30613537-30613559 CCACCGGGTGAGCCAGGCGCTGG - Intronic
1124564442 15:30800972-30800994 CCACCGGGTGAGCCAGGCGCTGG - Intergenic
1124754138 15:32393781-32393803 CCACCGGGTGAGCCAGGCGCTGG + Intronic
1124760631 15:32446109-32446131 CCACCGGGTGAGCCAGGCGCTGG + Intronic
1124778001 15:32602953-32602975 CCACCGGGTGAGCCAGGCGCTGG - Intronic
1132736536 16:1388732-1388754 CCCCACGGGGAGAACGGTGCCGG - Intronic
1136537836 16:30910687-30910709 CCCCACAGGGACCCAGGCGCTGG + Intergenic
1139651085 16:68362369-68362391 CCACAGGGAGGGCAGGGCGCTGG + Intronic
1142611027 17:1109272-1109294 CGAAAGGGGGAGCAAGGCCCGGG + Intronic
1147634867 17:41957648-41957670 CCACAGGGGTAGGAAGGCACTGG + Intronic
1148700489 17:49583857-49583879 CCACACCAGGAGCAAGGCCAAGG - Intergenic
1148779948 17:50115774-50115796 GCACATGGGGAGCCAGGGGCGGG + Intronic
1152239213 17:79152830-79152852 CCACACCAGGAACACGGCGCCGG + Intronic
1156502247 18:37567047-37567069 CCGGAGGGGGAGGAAGGCGCTGG + Intergenic
1161373985 19:3929471-3929493 ACCCACGGGGAGCAAGGCCTGGG + Intergenic
1161390528 19:4018213-4018235 CCACTCGGGCAGCAGGGCGCCGG - Intronic
1164750707 19:30652892-30652914 CCACACGGGGAGTAAGAAGTGGG - Intronic
1165094682 19:33403606-33403628 CCTCATGTGGAGCAAGGAGCAGG + Intronic
1165171066 19:33891927-33891949 CCACAGGGTGAGCAAGGGGTGGG + Intergenic
1166747446 19:45148104-45148126 CCACACGGGAAACAAGGGGATGG - Intronic
929508791 2:42550607-42550629 GTACATGGGGAGAAAGGCGCTGG + Intronic
929990453 2:46781806-46781828 CCAAGTGGGGAGCAAGGAGCAGG + Intergenic
934554476 2:95280060-95280082 CCACACCGGGAGCTATGCTCAGG - Intronic
937113417 2:119385171-119385193 CCACATGGGGAGCCAGGTGTAGG - Intergenic
937846260 2:126582461-126582483 CCACACTAAGAACAAGGCGCTGG - Intergenic
940075664 2:149739256-149739278 CCATTGGGGGAGCAAGGAGCAGG - Intergenic
941207027 2:162586370-162586392 CCACGTGGGGAGAAAGGCCCAGG + Intronic
943783106 2:191846580-191846602 CAACACGGTGAGCAAGCTGCTGG - Exonic
947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG + Intergenic
947868339 2:233417320-233417342 GCACAAGGGGGGCTAGGCGCAGG - Intronic
948301975 2:236914455-236914477 GCAGACAGGGAGCAAGACGCAGG - Intergenic
948739418 2:240033205-240033227 CCAAACAGGGAGCCAGGAGCGGG - Intergenic
1173909740 20:46657811-46657833 CCAGAGCAGGAGCAAGGCGCTGG + Intronic
1173920768 20:46743222-46743244 ACTCATGGGGAGCAGGGCGCTGG + Intergenic
1174361373 20:50030858-50030880 CCACAGAAGGAGCGAGGCGCAGG + Intergenic
1181833004 22:25578230-25578252 CCACACCTGGAGTCAGGCGCAGG - Intronic
1182126666 22:27821052-27821074 CCAGACGTGGAGCAGGGAGCAGG - Intergenic
1182218841 22:28742112-28742134 CCACACCCGGAGCAAAGCCCCGG - Exonic
1183708555 22:39489350-39489372 CCACACGGAGCCCAAGGCCCAGG - Exonic
1183728232 22:39601355-39601377 ACACACGGGGACCAGGGCGCTGG + Intronic
950526256 3:13526030-13526052 CCACACGGGGAGGAGGGCTCTGG + Intergenic
954155953 3:48685153-48685175 TCCAACGGGGGGCAAGGCGCGGG + Intronic
955688897 3:61571240-61571262 TCACCGGGGTAGCAAGGCGCGGG + Intronic
956681445 3:71785221-71785243 ACACGCGGGGGGCACGGCGCGGG + Intergenic
963123875 3:141797728-141797750 GCAGACGGGGAGAAAGGAGCCGG - Intronic
963152881 3:142065269-142065291 CCACACAAGGAGCAAGGAGCTGG + Intronic
963234944 3:142947313-142947335 CCACAGGAGGAGGAAGGGGCAGG + Intergenic
965562066 3:170071452-170071474 CTACACAGGAAGCATGGCGCTGG - Intronic
969566974 4:7984478-7984500 CCACACGGGGAGCAAGGCGCAGG + Intronic
982341312 4:154302319-154302341 TCACAGGGAGCGCAAGGCGCTGG - Intronic
983721906 4:170865683-170865705 AAACACAGGGAGCAAGGAGCTGG - Intergenic
994043357 5:95283768-95283790 CCACCCGGGGAGCGGGGGGCGGG - Intronic
997594263 5:135095723-135095745 TCACACGGGGAAGAAGGCTCGGG - Intronic
1004322335 6:14641819-14641841 TGACACGGGAAGGAAGGCGCGGG + Intergenic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1007789410 6:44300639-44300661 CCACATGGGGGGCAAGGCGTGGG - Exonic
1016633049 6:146254328-146254350 CCACACTGGAAGGAAGGCCCTGG + Intronic
1018974613 6:168555529-168555551 TCCCACGGGGAGCAGGGTGCTGG - Intronic
1019256710 7:57132-57154 CCACACGCGGTGCAACGCGGTGG + Intergenic
1022478919 7:30730266-30730288 CCACACAGTAAGCAAGGCGCAGG - Intronic
1023094969 7:36650959-36650981 CCAGCAGGGGAACAAGGCGCTGG + Intronic
1027476681 7:78640671-78640693 CCTCACGGGGAGCAACTGGCTGG + Intronic
1029264157 7:99325445-99325467 CCACAGAGGGAGCACGGCGGGGG + Intergenic
1035553183 8:545128-545150 CCACACTGGGAGGAGGGGGCCGG - Intronic
1036816665 8:11907645-11907667 TGACACGGGGAGCAAGGTGGTGG + Intergenic
1038002490 8:23403692-23403714 GCGCCCGGGGAGCGAGGCGCTGG - Intronic
1038268215 8:26052123-26052145 CCACTCGGGGAGCTCGGCTCTGG - Intergenic
1039395544 8:37222382-37222404 CCACAGGGGGAACAAGGGTCAGG - Intergenic
1039502830 8:38030707-38030729 CCACCCCGGGAGGTAGGCGCGGG + Exonic
1040981615 8:53251177-53251199 CCACCCGGGCCGCAAGTCGCCGG + Intronic
1049634057 8:143676672-143676694 CGATACCGGGAGCAAGGTGCTGG - Intergenic
1053145109 9:35706782-35706804 CCTCACGGGGAGCAAGCTGCTGG + Exonic
1056684426 9:88747706-88747728 CCACACAGGGAGAGAGGGGCAGG + Intergenic
1059260504 9:112971576-112971598 CTGCAAGTGGAGCAAGGCGCAGG + Intergenic
1062075278 9:134585278-134585300 CCACACAGGAAGCAGGGCCCCGG - Intergenic
1062582898 9:137236259-137236281 CCAGACGGGGAGCCAGGCCCAGG - Exonic
1062710923 9:137974813-137974835 CCACATGGAGAACAAGGCCCTGG - Intronic
1203794159 EBV:167461-167483 CCACACAGGTAGCAAGGACCCGG - Intergenic
1186529108 X:10277511-10277533 CCACATGGGGAGCAAGTCATGGG + Intergenic
1190221323 X:48514221-48514243 CCACCTGGGGAGAAAGGGGCAGG - Exonic
1194086925 X:89539305-89539327 GCACACTGGGAGCAGTGCGCTGG + Intergenic
1197709255 X:129654241-129654263 CCACGCGGGGTGCAGGGCGTGGG + Intronic
1200439582 Y:3195174-3195196 GCACACTGGGAGCAGTGCGCTGG + Intergenic